Məlumat

Eyni uyğunsuzluq qrupundan olan plazmidlərin birgə transformasiyası

Eyni uyğunsuzluq qrupundan olan plazmidlərin birgə transformasiyası


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Eyni replikasiya mənşəli (məsələn, pBR322 ori) və beləliklə, eyni uyğunsuzluq qrupundan olan iki plazmid E. coli-də uğurla birgə transformasiya edilə bilərmi? İki plazmidin birlikdə mövcud olmasına mane olan mexanizmlər hansılardır? İkili müqavimət seçiminin nə olmasının əhəmiyyəti varmı? Birgə transformasiyanın səmərəliliyi uni-transformasiyanın səmərəliliyi ilə necə müqayisə edilə bilər?


Məlum oldu ki, çoxlu uyğun gəlməyən plazmidlərin birgə mövcudluğunun qarşısını almaq üçün xüsusi bir mexanizm yoxdur. Velappan və digərləri müxtəlif seleksiya genləri olan birdən çox uyğunsuz plazmid qoydular və bakteriyaları tək bir antibiotikin üzərinə qoydular və vaxtaşırı ikinci vektoru yoxladılar (ikinci antibiotik müqavimətini yoxlayaraq). Görünür, ikinci vektorun yox olması həftələr çəkdi - bir çox nəsillər.

Daha yüksək nüsxə sayı plazmidləri daha yaxşı etdi, ikinci plazmidi daha uzun müddət itirdi. Onlar belə nəticəyə gəlirlər ki, plazmidlərin təbii itkisi bakteriyaların ikinci plazmidi seçmədən itirməsinə səbəb olacaq. Təsəvvür edirəm ki, mədəniyyətdə iki antibiotiklə bir neçə ay çəkəcək və siz bakteriyaları qeyri-müəyyən müddətə -80C-də saxlaya bilərsiniz. Yenə də əksər eksperimentlərdə bu, təkrarlanmanın uyğun mənşəyinin plazmidləri saxlamaq üçün daha tipik yarım ömrünə malik olduğu əlavə bir baş ağrısı olacaq.

Onlar həmçinin bildirirlər ki, ikiqat transformasiyaların tezliyi adətən təqdir ediləndən daha tez-tez olur, bu, plazmid hazırlayıcılarından tipik yüksək effektiv transformasiyadan bəzi koloniyalar əldə edəcəyinizi nəzərdə tutur. Bununla belə, onlar bu işdə transformasiya deyil, fagemid infeksiyası ilə çoxsaylı plazmidləri təqdim etdilər.


Plazmid profili və çoxlu dərmanlara davamlıların uyğunsuzluq qruplaşması Salmonella enterica serovar Typhi, Keniyanın Nayrobi şəhərində təcrid olunur

Plazmidlər çoxlu dərmanlara davamlı patogenlərin yaranmasına kömək edən antibiotik müqavimət genlərini saxlayır. Çox dərmana davamlı plazmidlərin mövcudluğunu aşkar etdik Salmonella enterica serovar Typhi (S. Typhi) əvvəlki tədqiqatımızdan təcrid edir və nəticədə onların uyğunsuzluq qruplarını və konyuqasiya ötürülməsi imkanlarını müəyyən etmişdir. Plazmidlər çoxlu dərmana davamlı 98 dərmandan çıxarılıb S. Qələvi lizis texnikasına əsaslanan typhi təcridləri. Plazmid uyğunsuzluğu qruplaşması FIA, FIB, FIC, HI1, HI2, I1-Iγ, L/M, N, P, W, T, A/C, K, B/ gücləndirmək üçün 18 cüt primerdən istifadə etməklə PCR replikon tiplənməsi ilə yaradılmışdır. O, X, Y, F və FIIA replikonları. Antibiotik müqavimətinin fenotipləri konyuqal olaraq köçürüldü S. Tifi plazmidlərlə təcrid edir Escherichia coli Plazmidlərdən məhrum olan K12F ştammı.

Nəticələr

MDR-in təxminən 79,6%-i S. Tifi izolatları plazmidlərin mövcudluğu ilə əlaqəli idi. Uyğunsuzluq (Inc) HI1 qrupuna aid plazmidlərin 93,6%-ni aşkar etdik. Müəyyən edilmiş digər uyğunsuzluq qruplarına IncFIC (16.7%), IncP (1.3%) və IncI1 (1.3%) daxildir ki, bunlar Inc HI1 ilə birlikdə görünür. MDR S. Təcrid olunmuş tif HI1 uyğunsuzluq qrupunun homoloji plazmidini daşımışdır ki, bunun da əksəriyyəti ampisilin, tetrasiklin və xloramfenikolun müqavimət fenotiplərini transkonjuqantlara köçürmüşdür.


4 saylı Texniki Klinika: Tək E.coli 2 plazmid ala bilərmi?

Aşağıdakı sual Beheroze Sattha tərəfindən Bitesize Bio-a e-poçtla göndərildi və mən bu problemi məmnuniyyətlə qəbul etdim və cavabı dərhal bildim. Ya da mən belə düşünürdüm.

Pubmed, Genes V (bilirəm, yeni versiyaya ehtiyacım var) və Molekulyar Klonlama ilə bağlı geniş araşdırmadan sonra mən bir cavab tapdım, lakin bu, əvvəlcə düşündüyüm kimi deyildi və plazmidlər, klonlaşdırma və s. haqqında anlayışımın bəzi aspektlərini dəyişdirdi. başlarında transformasiya. Beləliklə, bu mənim ən yaxşı cavabım olsa da, bu barədə fikirlərinizi eşitmək istərdim.

Budur Beheroze'nin sualı:

Tək olub-olmadığını düşünürdüm E. coli iki plazmid tuta bilir. SNP-ləri axtarmaq üçün mitoxondrial genomun bir hissəsini klonlayıram. Klonlamadan sonra və
ardıcıllıqla, bəzi ardıcıllıqların qarışıqları göstərdiyini görürəm, məsələn, Y və ya R. Bu o deməkdirmi ki, xüsusi E.coli iki plazmid götürmüşdü, biri C və
digəri isə (SNP) T ilə, ardıcıllıqla Y kimi görünür.

İlkin reaksiyam hər biri idi E.coli hüceyrə yalnız bir plazmid molekulu ilə çevrilə bilər, daha sonra yalnız bir plazmid növünü ehtiva edən bakteriyanın klonal populyasiyasını yaratmaq üçün yayılır. Anladığım qədər ümumi hikmət budur. Amma bu doğrudurmu? Və əgər belədirsə, bu necə baş verir?

Yenə də ilkin mülahizələrim ondan ibarət idi ki, tək E.coli-nin bir transformasiyada iki plazmid molekulu tərəfindən çevrilməsi olduqca nadirdir. Amma bu doğrudurmu? Yaxşı, yox.

İkiqat çevrilmə heç də çox nadir deyil!

Bacarıqlı hüceyrə hazırlığınızda, hüceyrələrin yalnız bir hissəsi bakteriyaları qəbul etmək qabiliyyətinə malikdir və onların bir alt populyasiyası bir transformasiyada asanlıqla iki və ya daha çox plazmidi qəbul edə bilər.

Bu, 1979-cu ildə Weston və başqaları tərəfindən E.coli-nin CaCl2 transformasiyası üçün göstərilmişdir [1] və daha yaxınlarda elektroporasiya üçün [2]. Weston və başqaları doza cavab əyrilərini (alınan transformantların sayına qarşı plazmid DNT-nin konsentrasiyası) qurdular ki, bu da hüceyrə populyasiyasının yalnız 0,26%-nin dəyişdirilə bildiyini və bu səlahiyyətli hüceyrələrin yalnız 10-20%-nin (yəni təxminən 0,052%) olduğunu göstərdi. populyasiya iki və ya daha çox plazmid molekulunu qəbul edə bilər. Elektroporasiya ilə bağlı daha yeni işdə, Goldsmith və digərləri də bir transformasiyada hüceyrələrin iki müstəqil plazmid molekulu tərəfindən çevrilməsinin mümkün olduğunu və ikiqat çevrilmələrin tezliyinin hətta plazmid konsentrasiyası ilə eksponent olaraq artdığını göstərdi.

Beləliklə, tək transformasiya prosedurunda iki (və ya daha çox) plazmid molekulunun tək E.coli-yə ikiqat transformasiya daxil olması o qədər də nadir deyil. Əslində Weston və digərlərinin statistikasına görə, transformantlarınızın 20%-ə qədəri ikiqat transformant ola bilər.

Bəs eyni replikonu daşıyan plazmidlər haqqında nə demək olar?

Lakin Beheroze təcrübəsində klonların eyni plazmid onurğasında müxtəlif əlavələr var –, onların hamısı eyni replikasiya mənşəyinə malikdir. Ənənəvi müdriklik deyir ki, transformasiya zamanı həmin plazmidlərdən ikisi tək E.coli-yə daxil olarsa, plazmid uyğunsuzluğu onların hər ikisinin yayılmayacağını diktə edir.

Plazmid uyğunsuzluğu eyni hüceyrədə birgə yaşayan iki plazmidin sabit miras alınmaması kimi müəyyən edilir. Bənzər təkrarlanma mənşəli plazmidlərin və buna görə də plazmidin təkrarlanması və seqreqasiyasını tənzimləyən oxşar sistemlərin eyni “uyğunsuzluq qrupunda” olduğu deyilir və hər ikisi ardıcıl olaraq qız hüceyrələrə ötürülə bilməz. Bunun səbəbi, plazmidin nüsxə nömrəsinin replikon tərəfindən ciddi şəkildə tənzimlənməsi və eyni replikona malik iki plazmidin olması bu tənzimləməyə mane olmasıdır, çünki onlar hüceyrə bölünməsi zamanı təkrarlanma və ya bölünmə üçün tələb olunan tənzimləyici amilləri bölüşürlər. Effektiv olaraq, iki plazmid klonu replikasiya və bölmə üçün tələb olunan mövcud amillər üçün rəqabət aparır.

Plazmid uyğunsuzluğu ikiqat transformatorda necə təsir göstərir?

Bu barədə düşünməyin sadə yolu, iki nüsxə nömrəsi olan bir plazmidi təsəvvür etməkdir (şəkil 1A-a baxın). Replikasiyanın mənşəyinin tənzimləyici mexanizmi nüsxə sayını ikidə saxlamaq üçün qurulmuşdur, lakin eyni replikasiya mənşəli iki müxtəlif plazmid klonu olan qoşa transformantda replikonun surət nömrəsi artıq ikidir, ona görə də replikasiya baş verməyəcək. İki plazmid daha sonra hüceyrə bölünməsindən sonra fərqli qız hüceyrələrə ayrılacaq, buna görə də hər bir qız hüceyrəsi homogen plazmid populyasiyasını ehtiva edəcəkdir.

Hər şey çox yaxşıdır, lakin hüceyrələr bölünmə şansı olmayana qədər örtülürsə, bu, –mənim fikrimcə– iki fərqli plazmid klonu olan bir klonla nəticələnə bilər. Üstəlik, əksər plazmidlərin nüsxə nömrəsi 2-dən yüksəkdir, buna görə də vəziyyət daha mürəkkəbdir. Hətta nüsxə sayı 4 olsa belə, heterojen plazmid populyasiyasının yayılma şansı artır, görünür.

Ümumilikdə başa düşülən müdriklik ondan ibarətdir ki, iki plazmid klonunun digərinə nisbətən daha sürətli replikasiya dərəcəsinə və ya artan toksikliyə malik olmasına səbəb olan kiçik fərqlər olacaq. Bunun plazmidlərin asimmetrik şəkildə təkrarlanmasına səbəb olduğu və nəticədə klonlardan birinin itirilməsinə səbəb olduğu deyilir.

Göründüyü kimi, bu, bir çox hallarda doğrudur, lakin Velappan və digərlərinin [3] 2007-ci ildəki məqaləsi bildirir ki, təkrarlanmanın eyni mənşəli iki plazmiddən ibarət ikiqat transformantlar eyni E.coli-də bir çox günlər ərzində sabit saxlanıla bilər, xüsusən də yüksək surət sayı mənşəli (pUC kimi) istifadə olunur.

Əgər bunun transformasiya konteksti olduğunu qəbul etsəniz, mənə elə gəlir ki, Beheroze qarışıq plazmid populyasiyasından ibarət koloniya əldə etmişdir. Bu, tək E.coli-nin transformasiya zamanı iki fərqli klonu götürməsi və ya eyni hüceyrələrdə, ya da koloniya böyüdükcə ayrı-ayrı populyasiyalarda (və ya hər ikisində) çoxalması nəticəsində yarana bilərdi.

İkiqat transformatorların qarşısını necə almaq olar?

Buradan belə görünür ki, qarışıq plazmid populyasiyasının çevrildiyi və homogen klonlaşdırılmasının istəndiyi hər hansı bir təcrübədə ikiqat transformasiyaları nəzərə almaq, diaqnoz qoymaq və mümkün olan yerlərdə qarşısını almaq lazımdır.

1. Plazmidin aşağı konsentrasiyalarından istifadə edin. Goldsmith et al göstərdi ki, ikiqat transformasiya plazmid konsentrasiyası ilə eksponent olaraq artıb, buna görə də təcrübənizin məhdudiyyətlərini nəzərə alaraq plazmid konsentrasiyasını mümkün qədər aşağı saxlamaq kömək etməlidir.

2. Koloniya PCR və ya ardıcıllıqla istifadə edərək klonları yoxlayın. PCR müsbət və mənfi klonlar üçün fərqli zolaqlar verəcəksə, koloniya PZR xüsusilə yaxşı işləyəcək.
Əgər ikiqat transformantınız varsa, o, iki lent verəcəkdir. Beheroze ortaya çıxan plazmid hazırlayıcılarını ardıcıllıqla sıralayaraq və bunun fərqinə vararaq ikiqat klonları müəyyən edib
qarışıqda iki fərqli ardıcıllıq ola bilər.

3. Birdən çox klon seçin. Əgər bəzi ikiqat transformantlarınız varsa, müsbət klonlar bankını seçsəniz, onlar azlıqda olmalıdır. Tək-tək çevrilmiş pozitivlər koloniya PCR və ya ardıcıllıqla asanlıqla müəyyən edilməlidir.

4. Əgər çoxlu sayda müsbət klonlarınız yoxdursa — yenidən təcrid edin. Müsbət klonlar təcrid olunmalı və təzə kulturanın aşılanması üçün istifadə edilməli, aşağı sıxlıqda agar plitəsinə qoyulmalı və ayrı-ayrı koloniyalar yenidən təhlil edilməlidir. Əgər orijinal klon ikiqat transformasiya və ya çox yüksək sıxlıqda örtülmə səbəbindən müxtəlif plazmidləri ehtiva edən iki hüceyrə tipli qarışıq populyasiyadan ibarətdirsə, bu, ikisini həll edəcək (bu, Beheroze'nin nəticəsi üçün digər mümkün izahatdır). Alternativ olaraq, siz plazmid(ləri) müsbət klondan təcrid edə və yenidən transformasiya edə bilərsiniz. Əgər plazmid populyasiyanız qarışıqdırsa, siz əvvəlcə birgə transformasiya olunmuş plazmiddən bir və ya digərini ehtiva edən (əsasən) tək transformantlardan ibarət bir boşqab alacaqsınız.

Deməliyəm ki, bu, mənim üçün əsl göz açan oldu, amma heç bir dəlil olmadan yaxın tutduğum bir qavrayışı müəyyən etməyi və onu işıqlandırmaq üçün işləməyi xoşlayıram. Bununla belə, burada bir şey çatışmır, ona görə də əlavə işıqlandırma təmin edə bilsəniz və ya hər hansı bir sualınız varsa, şərh yazmaqdan çekinmeyin.

1. Weston A, et al Uyğun və Uyğun Olmayan Plazmid DNT Molekullarının Cütləri ilə Escherichia coli-nin eyni vaxtda çevrilməsi. Mol Gen Genetika (1979) 172 s113


İki plazmidi olan bakteriyaların zülal ifadəsi? - Plazmidlərin uyğunsuzluğu (27 iyul 2007)

salam!
Mən bakteriyalarda iki plazmid ifadə etməyi planlaşdırıram. F1 mənşəli iki fərqli pET vektorum olacaq. Fərqli antibiotik müqavimətinə malikdirlər. Kiminsə iki PET vektorunu ifadə etməkdə `pis`və ya `yaxşı`təcrübəsi varmı? Oxudum ki, bhttp://www.protocol-online.org/forums/style_images/1/folder_post_icons/icon2.gif-də iki plazmid ifadə etmək problemli ola bilər.
http://www.protocol-online.org/forums/styl. iki plazmidin uyğunsuzluğuna görə con2.gifacteria. Amma uyğunsuz sayılacaq kriteriyalar haqqında heç bir məlumat tapa bilmədim.
Cavablarınıza görə minnətdar olaram.
Çox sağ ol

Mən həqiqətən başa düşmürəm. Bakteriyaların içərisində 2 plazmidin çevrilməsini nəzərdə tutursunuz? Hmm.. bu haqda ilk dəfədir eşidirəm. Öz fikrimcə, eyni anda 2 plazmidi ifadə etməyin çox yaxşı bir fikir olacağını düşünmürəm. 1 plazmidin özünü ifadə etmək çətindir.

5 plazmid? Hmm hansı bakteriyalar bunu edə bilər? Mən sadəcə maraqlıyam. Bu işdə mütəxəssis deyil. =)

Etmək istədiyiniz şey mümkündür, çünki hər bir plazmid növü öz antibiotik seçim markerinə malikdir. Bununla belə, sistem qeyri-sabitdir, çünki eyni uyğunsuzluq qrupundan olan iki plazmid bir-birinin sabit irsiliyinə müdaxilə edir. Beləliklə, A plazmidinin B plazmidinə nisbəti hüceyrədən hüceyrəyə dəyişir. bəzi hüceyrələrdə daha çox plazmid A, digərlərində isə daha az olacaq. Bu da öz növbəsində hər bir plazmid tərəfindən ifadə edilən zülalların hüceyrələr arasında fərqli nisbəti ilə nəticələnir.

30-a yaxın uyğunsuzluq qrupu var. Yəni nəzəri olaraq mən ola bilərdim

Hər bir plazmid fərqli uyğunsuzluq qrupundan gəldiyi müddətcə 30 plazmid yan-yana yaşayır.

Yenə də 5 çox şeydir. Haqqında ən çox oxuduğum 4-dür. E coli hüceyrələri çox da xoşbəxt deyildi. Həddindən artıq antibiotik.

1 E.coli içərisində 2 plazmid saxlaya bilərsiniz, lakin sizə lazımdır:
- Müxtəlif replikator faktorları (fərqli ori)
- Müxtəlif seçim markerləri.

F1 mənşəli 2 fərqli pET vektorunuz olduğunu dediyiniz üçün mən belə hesab edirəm ki, hər iki vektor üçün ori bölgəsi eynidir? Əgər belədirsə, iki plazmid bir-birinə uyğun gəlmir, eyni bakteriyalarda uzun müddət saxlanıla bilməz. Fərqli ori seçin.


Nuklein turşularının radioizotoplarla etiketlənməsi

6.2 Plazmid nüsxə nömrəsinin təxmin edilməsi

Plazmidlər - rekombinant genlərin klonlanması üçün istifadə olunan avtonom şəkildə təkrarlanan, dairəvi DNT elementləri - hüceyrə daxilində birdən bir neçə yüz nüsxədə mövcuddur. Fərdi hüceyrədə plazmidin neçə nüsxəsinin olduğunu müəyyən etmək üçün bir texnikada plazmid daşıyan ştammın kulturu [3H]-timin və ya [3H]-timidin (ehtiyacdan asılı olaraq) iştirakı ilə yetişdirilir. gərginlikdən). Log fazasına qədər böyümədən sonra hüceyrələr yığılır və parçalanır və ümumi DNT təcrid olunur. İzolyasiya edilmiş DNT nümunəsi plazmidi xromosomal DNT-dən ayırmaq üçün etidium bromid-sezium xlorid qradientində sentrifuqa edilir. Santrifüjdən sonra santrifüj borusu dibindən deşilir, fraksiyalar filtr disklərinə yığılır və trikloroasetik turşu (TCA) və etanol ilə müalicə olunaraq DNT filtrlər üzərində çökdürülür. Filtrlər qurudulur və sintillyasiya spektrometrində hesablanır. Fraksiya sayı və cpm qrafiki Şəkil 6.1-də göstərildiyi kimi profil yarada bilər. 12 nömrəli fraksiyada mərkəzləşmiş kiçik zirvə, superburuq şəklində, 26 nömrəli fraksiyada mərkəzləşmiş kəsilmiş xromosom DNT-dən daha sıx olan plazmid DNT-ni təmsil edir.

Şəkil 6.1. Plazmidi xromosom DNT-dən ayıran etidium bromid-sezium xlorid gradientindən toplanmış fraksiyalar. Hüceyrələr radioaktiv timin və ya timidinin iştirakı ilə yetişdirilir ki, replikasiya edən DNT tritium izotopu ilə işarələnsin. 12-ci fraksiya ətrafında mərkəzləşmiş super qıvrılmış plazmid DNT, kəsilmiş xromosom DNT-dən daha yüksək sıxlıqda olan çöküntülər, 26-cı fraksiya ətrafında mərkəzləşmişdir.

Plazmid nüsxə nömrəsi aşağıdakı əlaqə ilə hesablanır:

Problem 6.3

6000 bp plazmidin nüsxə nömrəsini təyin etmək üçün bir təcrübə E. coli əvvəl təsvir edildiyi kimi həyata keçirilir. Əsas plazmid tərkibli fraksiya 25 000 cpm ehtiva edir. Xromosom pik fraksiyasında 220 000 cpm var. Plazmid nüsxə nömrəsi nədir?

Həlli 6.3

Bu problemin həllində ilk addım plazmidin və plazmidin molekulyar çəkilərini hesablamaqdır E. coli xromosom. Plazmid 6000 bp-dir. The E. coli xromosomun uzunluğu təxminən 4,6 milyon bp-dir. Onların molekulyar çəkiləri 660 dalton/bp çevrilmə əmsalı ilə hesablanır.

Plazmidin molekulyar çəkisi

Molekulyar çəkisi E. coli xromosomdur

Bu dəyərlər daha sonra nüsxə nömrəsini hesablamaq üçün tənliyə (bu problemdən əvvəl) daxil edilə bilər:


İçindəkilər

Ester M. Lederberq və Luici L. Kavalli-Sforza "F" i kəşf etdilər, [5] sonradan Joshua Lederberg ilə birlikdə nəşr etdilər. [6] Onun nəticələri elan edildikdən sonra digər iki laboratoriya tədqiqatlara qoşuldu. "Bu, F-nin eyni vaxtda müstəqil kəşfi deyildi (anlaşılana qədər mən məhsuldarlıq faktoru adlandırıram.) Biz Hayes, Jacob və Wollman-a yazdıq, onlar daha sonra tədqiqatlarına davam etdilər." [7] "F"nin kəşfi bəzən William Hayesin "cinsiyyət faktoru" kəşfi ilə qarışdırılırdı, baxmayaraq ki, o, heç vaxt prioritet iddia etməmişdir. Həqiqətən, "o [Hayes] F-nin həqiqətən lambda olduğunu düşünürdü və biz onu [bu olmadığına] inandırdıqda, o, işə başladı." [8]

F faktorlarını təşkil edən ən ümumi funksional seqmentlər bunlardır: [9]

  • OriT (Origin of Transfer): Konyuqativ köçürmənin başlanğıc nöqtəsini qeyd edən ardıcıllıq.
  • OriV (Vegetativ Replikasiyanın Mənşəyi): Plazmid-DNT-nin alıcı hüceyrədə təkrarlanacağı ardıcıllıq.
  • tra-region (transfer genləri): F-Pilus və DNT transfer prosesini kodlayan genlər.
  • IS2-nin bir nüsxəsindən, IS3-ün iki nüsxəsindən və IS1000-in bir nüsxəsindən ibarətdir: "eqoist genlər" (özlərinin nüsxələrini müxtəlif yerlərdə birləşdirə bilən ardıcıllıq fraqmentləri). [10]

Bəzi F plazmid genləri və onların funksiyası:

F faktorunu özündə saxlayan episom müstəqil plazmid kimi mövcud ola və ya bakteriya hüceyrəsinin genomuna inteqrasiya edə bilər. Mümkün dövlətlər üçün bir neçə ad var:

  • Hfr bakteriyaları bakteriya genomuna inteqrasiya olunmuş bütün F epizoma malikdir.
  • F + bakteriya bakterial genomdan asılı olmayan bir plazmid kimi F faktoruna malikdir. F plazmidində yalnız F faktorlu DNT var və bakteriya genomundan DNT yoxdur.
  • F' (F-əsas) bakteriyalar xromosomdan səhv kəsilməklə əmələ gəlir, nəticədə F episomunun daxil edildiyi yerin yanında olan bakteriya ardıcıllığını daşıyan F plazmid olur.
  • F - bakteriyalar F faktorunu ehtiva etmir və alıcı kimi çıxış edir.

Bir F + hüceyrəsi bir F - hüceyrəsi ilə birləşdikdə/birləşdikdə nəticə iki F + hüceyrəsi olur, hər ikisi plazmidi konyuqasiya yolu ilə digər F - hüceyrələrinə ötürə bilir. F+ hüceyrəsindəki pilus resipient hüceyrə ilə qarşılıqlı əlaqədə olur və cütləşmə qovşağının əmələ gəlməsinə imkan verir, DNT bir zəncirlə bağlanır, açılır və alıcıya ötürülür. [3] [9]

F-plazmid, məhsuldarlığın qarşısını alan (Fin) sistemi ilə bakteriyaların cinsi funksiyalarını idarə edən konyuqativ plazmidlər sinfinə aiddir. Bu sistemdə trans-fəaliyyət göstərən amil FinO və antisens RNT-lər FinP birləşərək aktivator gen TraJ-nin ifadəsini sıxışdırır. TraJ tənzimləyən transkripsiya faktorudur tra operon. The tra operona konjugasiya və plazmid transferi üçün lazım olan genlər daxildir. Bu o deməkdir ki, F+ bakteriyası həmişə donor hüceyrə kimi çıxış edə bilər. The finO orijinal F plazmidinin geni (E. coli K12-də) IS3 daxil edilməsi ilə kəsilir, nəticədə konstitusiya tra operon ifadəsi. [11] [12] F + hüceyrələrində bakterial səthdə TraS və TraT səthi istisna zülalları da var. Bu zülallar eyni uyğunsuzluq (Inc) qrupuna aid plazmidləri əhatə edən ikincil cütləşmə hadisələrinin qarşısını alır. Beləliklə, hər bir F + bakteriyası hər hansı bir uyğunsuzluq qrupunun yalnız bir plazmid növünə sahib ola bilər.

Hfr ötürülməsi vəziyyətində, əldə edilən transkonjuqatlar nadir hallarda Hfr olur. Hfr/F − konyuqasiyasının nəticəsi yeni genotipli F − ştammıdır. F-prime plazmidləri alıcı bakterial hüceyrəyə köçürüldükdə, rekombinasiyada vacib ola biləcək donorun DNT hissələrini daşıyırlar. Biomühəndislər daxil edilmiş xarici DNT-ni ehtiva edə bilən F plazmidləri yaratdılar, buna bakterial süni xromosom deyilir.

Təsvir edilən ilk DNT helikazı F-plazmiddə kodlanır və plazmid transferinin başlanmasına cavabdehdir. Əvvəlcə adlanırdı E. coli DNT Helikaz I, lakin indi kimi tanınır F-plazmid TraI. Helikaz olması ilə yanaşı, 1756 amin turşusu (ən böyüklərdən biri E. coli) F-plazmid TraI zülalı həm spesifik, həm də qeyri-spesifik tək zəncirli DNT-nin bağlanmasına cavabdehdir, həmçinin transferin başlanğıcında tək zəncirli DNT-nin bağlanmasını kataliz edir.


Materiallar və metodlar

Plazmid Kolleksiyası

Kolleksiyamıza bütün tam plazmidlər ("Yığılmış molekul" statusu ilə) daxildir. A. baumannii RefSeq və GenBank məlumat bazalarında (NCBI) avqustun 14-də mövcuddur ci , 2017. Biz GenBank və fasta fayllarını bütün sonrakı analizlər üçün Python 2.7-də SeqIO Biopython modulu (Cock və digərləri, 2009) ilə təhlil etdik.

Plazmid kolleksiyamızın müxtəlifliyini artırmaq üçün biz PacBio RSII və Illumina NextSeq platformalarından istifadə edərək 10 Meksika izolyatının tam genom ardıcıllığını əldə etdik. Üç izolatın, yəni 7804, 810CP və 3207-nin genom ardıcıllığı əvvəllər bu əlyazmanın bəzi müəllifləri tərəfindən bildirilmişdir (Castro-Jaimes et al., 2016 Pérez-Oseguera et al., 2017).

Digər səkkiz təcrid üçün biz SPAdes v3.9.0 və ya Unicycler v0.4.1 istifadə edərək hər iki platformadan oxunan hibrid birləşmələr qurduq (Bankevich et al., 2012 Wick et al., 2017). NCBI Prokaryotic Genome Annotasiya Boru Kəməri ilə funksional annotasiya yerinə yetirdik. Meksika təcridlərinin genomlarının GenBank qoşulma nömrələri Əlavə Cədvəl S10-da verilmişdir. Buna görə də, ümumilikdə 173 tam plazmidi təhlil etdik və plazmidlərin və ştammların tam siyahısı Əlavə Cədvəl S1-də göstərilmişdir.

Plazmid xəttinin delimitasiyası

Kolleksiyamızdakı bütün 173 tam plazmid arasında qoşalaşmış BLASTn (Camacho et al., 2009) axtarışları həyata keçirdik. Biz hər biri müəyyən edilmiş əhatə dairəsinə (40-90%) əsaslanan müxtəlif plazmid şəbəkələri qurduq. Hər bir plazmid cütü üçün, əgər ən kiçik plazmid digər plazmidin ən azı müəyyən edilmiş faizini əhatə edərsə, plazmidlər arasında əlaqə qoyduq, burada əhatə dairəsi 90%-dən çox eynilik ilə düzülmə uzunluqlarının cəmi ilə müəyyən edilirdi. Sonra adaları və ya Python 2.7-də NetworkX (Hagberg et al., 2008) ilə 𠇋irləşdirilmiş komponentlər”. Hər bir qoşulmuş komponent üçün istinad kimi istifadə etmək üçün ən çox bağlı plazmidi (hub) çıxardıq. Birdən çox mərkəz olduqda, biz hubları ölçülərinə görə çeşidlədik və ən böyük plazmidi seçdik. Plazmid nəsilləri və əlaqəli istinadlar Əlavə Cədvəl S1-də verilmişdir.

Plazmid Replikasiya Zülallarının çıxarılması

Plazmid başlanğıc replikasiya zülallarını çıxarmaq üçün annotasiyaya əsaslanan yanaşmadan istifadə etdik. Plazmid GenBank fayllarından istifadə edərək, biz məhsullarda aşağıdakı açar sözlər üçün hərflərə həssas olmayan axtarış apardıq: “replication protein”, “plasmid replikasiya başlatıcısı”, “plazmid replikasiya”, ””, ””””” , “plazmid replika”, “replication a”, “replication b”, “replication c”, “RepB””, “repB””, ”övlət başlatma, ”, ”& #x201Creplicase”. Sonra həm nukleotid, həm də zülal ardıcıllığını çıxardıq və qismən genləri və psevdogenləri xaric etdik. Əlavə olaraq, əlavə analizlər üçün Rep geninin yuxarı və aşağı axınında 500 nukleotid çıxardıq. Bütün bu proses Python 2.7 və Biopython SeqIO modulu ilə həyata keçirilmişdir (Cock et al., 2009).

Homologiya Qrupunun Təyinatı üçün İstinad Zülalları

Bertini və digərləri tərəfindən bildirilən bütün replikasiya (Rep) zülallarını tərtib etdik. (2010) (Bertini et al., 2010) mövcud olduqda gen adı, plazmid adı və plazmid qoşulma nömrəsi ilə. Rep zülallarının lokus etiketi və ya gen adına malik olmadığı hallar üçün biz replikon identifikatoru və replika adından istifadə edərək qurulmuş süni lokus etiketi əlavə etdik. Replika adı mövcud olmadıqda, replikaları ayırd etmək üçün ‘rep’ sözünü və ardınca GenBank faylında görünmə qaydasında nömrə təyin etdik. Bəzi hallarda, eyni plazmiddə iki replikasiya zülalı olduqda, bu zülalları müəyyən homoloji qruplar üçün istinad kimi düzgün təyin etmək üçün biz GenBank nr verilənlər bazasına qarşı bu zülalların BLAST axtarışını həyata keçirdik. Acinetobacter Bertini və başqalarının Əlavə Cədvəl S1-də verilmiş cins. (2010). İki zülal müəyyən edilə bilmədi: Ab599 plazmidindən olan Aci3 replikazı (GR3 üzvü), çünki plazmid ardıcıllığı verilənlər bazasında yerləşdirilməmişdir və MAD plazmidindən Aci2 replikazı, çünki plazmidin qismən ardıcıllığı var idi. replika. Buna görə də biz bu zülalları analizlərimizdən çıxardıq və yerinə eyni homoloji qrupların digər üzvlərini araşdırdıq. Lean və Yeo (2017) tərəfindən bildirildiyi kimi, GR2 homoloji qrupu iki qrupa bölünməlidir, buna görə də GR2-ni təmsil edən zülalları yeni yaranan GR20-nin zülallarından ayırdıq. Bundan əlavə, (Cameranesi et al., 2017) bu yaxınlarda yeni homoloji qruplar haqqında məlumat verdi, beləliklə, biz bu qrupları təmsil edən replikaları saxlayan plazmidləri endirdik və bu genləri çıxardıq. Əlavə Cədvəl S2 bu işdə istinad kimi istifadə edilən bütün zülalları, o cümlədən S1, S2 Əlavə Materiallarına daxil edilmiş çoxlu FASTA fayllarında istifadə olunan mənşəyi, birləşmələri, nömrələri və başlıqları sadalayır.

Rep Zülalları üçün Homoloji Qrup Təyinatı

Əvvəlcə plazmid kolleksiyamızda mövcud olan replikasiya başlanğıc zülallarını kodlayan bütün genlər arasında qoşalaşmış BLASTn (Camacho et al., 2009) axtarışları həyata keçirdik. Biz 74%-dən çox nukleotid eyniliyinə malik olan və sorğunun ən azı 90%-ni əhatə edən hitləri saxladıq. Sonra, sorğu kodlaşdırma ardıcıllığı (CDS) yalnız bir homoloji qrupa uyğunlaşdırılıbsa, biz ardıcıllığı həmin qrupa aid etdik, halbuki müxtəlif homoloji qruplar üçün birdən çox hit varsa, sorğunu ən yüksək olan GR-yə təyin etdik. faiz şəxsiyyəti. Əlaqədar istinad (KY984047_repAci23) GR8 (GU979000.1_p11921_repA) istinadlarından biri ilə 100% eyni olduğu üçün GR23 homologiya qrupunu ləğv etdik.

Plazmid Rep Proteinin Filogenetik Təhlili və Yeni Homologiya Qruplarının Təyinatı

İki genin ən azı 74% nukleotid eyniliyini və 90% əhatə dairəsini paylaşdığı halda, Rep proteinini kodlayan hər bir genin digərinə qoşulduğu bir şəbəkə qurduq. Sonra, istinad cədvəlində Rep zülalı olmayan adalar və ya əlaqəli komponentlər üçün mərkəzi istinad olaraq seçdik və onu Əlavə Cədvəl S1-ə əlavə etdik. Bundan əlavə, biz cari təyinatları və yeni homoloji qrupları təsdiqləmək üçün plazmid replikasiyasının başlanğıc zülalının filogeniyalarını qurduq. 21 fevralda əldə edilmiş Pfam verilənlər bazasında (El-Gebali et al., 2019) əlaqəli Pfam domenlərini axtardıq. st , 2018, zülalları konservləşdirilmiş domenlərə görə ayırmaq və bu zülallar çox fərqli olduğu üçün ayrı-ayrılıqda hizalamalar həyata keçirmək. Biz amin turşularını uyğunlaşdırmaq üçün Clustal Omega (Sievers et al., 2014) və tərcümə edilmiş CDS ilə nukleotidlərin uyğunlaşdırılmasına rəhbərlik etmək üçün RevTrans (Wernersson və Pedersen, 2003) istifadə etdik. Sonra adekvat təkamül modelini axtarmaq üçün jModelTest2 (Darriba et al., 2012) işlədik və seçilmiş modellə PHYML (Guindon və Gascuel, 2003) ilə filogenetik ağac qurduq. Vizual yoxlama ilə biz yeni homologiya qruplarının, yeni sinifləri təmsil edə biləcək seçilmiş zülalların istinadlarını təsdiq etdik və bu zülalları Əlavə Cədvəl S2-də ətraflı təsvir olunduğu kimi yeni homoloji qruplar kimi təyin etdik.

Ribozomal zülalların və MLST-nin Filogenetik Təhlili

Biz Roary-dən (Page et al., 2015) əsas genoma aid olan ribosomal zülalları kodlayan monokopiya genlərini çıxarmaq üçün istifadə etdik və uyğunlaşmada boşluqların qarşısını almaq üçün bütün suşlarda eyni ölçüdə idi. RevTrans (Wernersson və Pedersen, 2003) ilə nukleotid uyğunlaşmasına rəhbərlik etmək üçün ribosomal zülalları Clustal Omega (Sievers et al., 2014) ilə uyğunlaşdırdıq. RDP4 ilə aşkar edilmiş rekombinasiya siqnalları olan ardıcıllıqları atdıq (Martin et al., 2015). Qalan nukleotid uyğunlaşmalarını FASconCAT-G (K࿌k və Longo, 2014) ilə birləşdirdik və PHYML (Guindon və Gascuel) ilə filogenetik ağac yaratmaq üçün təkamül modelini seçmək üçün jModelTest2 (Darriba və digərləri, 2012) istifadə etdik. Biz ribosomal zülallardan istifadə etdik Acinetobacter haemolyticus Xarici qrup kimi CIP 64.3 gərginliyi. Hər birinin ardıcıllıq növü (ST) təyinatı A. baumannii Oksford və Pasteur MLST sxemləri altında təcrid olunmuş maddələr PubMLST verilənlər bazasından 1 əldə edilmişdir (Bartual et al., 2005 Diancourt et al., 2010).

Plazmidlərdə ifrazat sistemlərinin, antibiotiklərə qarşı müqavimət genlərinin və daxiletmə ardıcıllığının müəyyən edilməsi

Plazmid kolleksiyasındakı ifrazat sistemlərini müəyyən etmək üçün TXSSCAN profilləri (Abby və Rocha, 2017) ilə MacSyFinder və plazmid dəstimizdə mövcud olan əldə edilmiş antibiotik müqavimət genlərini müəyyən etmək üçün ResFinder istifadə etdik (Zankari et al., 2012). 2-də ISfinder verilənlər bazasından istifadə edərək plazmidlərdə mövcud olan daxiletmə ardıcıllığı (IS) elementlərini müəyyən etdik (Siguier et al., 2006).

Identifikasiyası pdf Plazmidlərdəki saytlar (XerC/D və Xer D/C).

müəyyən etmək üçün pdf Plazmid dəstimizdəki saytları sorğu kimi istifadə edərək BLASTn analizi etdik pdf pS30-1 plazmidinin yerləri: XerC/D, ATTTCGTATAAGGTGTATTAT- GTTAATT və XerD/C, ATTTAACATAATGGCTGTTATGCGAAAC (Blackwell and Hall, 2017).

COG Tapşırıqları

Gizli Markov modeli (HMM) axtarışları əsasında hər bir plazmid üçün homoloji gen təyinatlarını təyin etdik. hmmsearch proqram (Eddy, 2011). Bu HMM axtarış prosesində 4873 COG və 8539 Qalan Ortoloji Qrupların (ROG) hər birini təmsil edən əvvəllər qurulmuş model dəstindən istifadə edilir (Tatusov və digərləri, 2003 Taboada et al., 2010). Sonra Perl skriptlərindən istifadə edərək, Tatusovun [66] ümumi təsnifat sxemindən istifadə edərək hər təyin edilmiş COG-ni təsnif etdik. Hər bir genin sinif üzrə tezliyini hesabladıq və nəticələri ggplot2 R skriptlərindən istifadə edərək tərtib etdik 3 (Wickham, 2009).


PCURE: Antibiotik müqavimətinin yükünü azaltmaq üçün plazmidlərin hədəflənməsi

Antibiotiklərə davamlı infeksiyalar, onlarla mübarizə üçün konkret yeni yanaşmaların olmaması səbəbindən güclənən əsas qlobal sağlamlıq problemi kimi tanınıb. Plazmidlər müqavimət genlərinin sürətlə dünya miqyasında yayılmasına əsas töhfə verənlərdən biri kimi tanınır. Bununla belə, hazırda xüsusi olaraq plazmidləri hədəf alan bir neçə strategiya həyata keçirilir. Bizim işimiz plazmidlə kodlanmış toksin/anti-toksin sistemlərini neytrallaşdırmaqla hüceyrələrin canlılığını pozmadan uyğunsuzluq funksiyalarından istifadə edərək plazmidləri öz sahiblərindən çıxarmaq yollarını inkişaf etdirir. Bu yanaşma ümidvericidir in vitro nəticələr, lakin müqavimət problemi ilə mübarizə aparmaq üçün əlverişli bir seçim kimi daha da inkişaf etdirilməli və tanınmalıdır.

Çox dərmana davamlı (MDR) bakteriyaların hal-hazırda geniş yayılması milli səhiyyə xidmətləri üçün əsas yükə çevrilib və bakterial infeksiyalar səbəbindən ölüm halları artıb. Problemə böyük töhfə verən amillərdən biri yeni və mövcud müqavimət determinantlarının bakteriya sahibləri arasında nə qədər sürətlə hərəkət etməsidir. Qlobal miqyasda uğurlu patogenlərin bir çox ştammları mobil genetik elementlərdə (MGE) əldə edilən müqavimət genləri nəticəsində geniş şəkildə yayıla bilmişdir. (1). This rapid spread is in part due to the extensive movement of people, goods and animals for example, all of which allow for the interaction between different bacterial strains and their MGEs, resulting in a globalized gene pool (2).

Plazmidlər

Joshua Lederberg first coined the term “plasmid” in 1952 (3), and since their discovery as “extra-chromosomal hereditary determinants”, studies have highlighted their role in horizontal gene transfer (HGT) and usefulness as tools in molecular biology. Much of the early work on plasmids focused on the observation that resistance to antibiotics seemed to transfer from one strain to another, leading to the description of R-factors (4, 5). However, in the early 1970s, Stanley Falkow, Stanley Cohen, Herbert Boyer, Donald Helinski, Charles Brinton and several others developed the concept of using plasmids as tools for gene cloning. The discovery that plasmids could be efficiently used as cloning vectors led to an increased interest in understanding plasmid biology, as well as stimulating new types of biotechnology.

Plasmids are typically circular (but also less commonly linear) double-stranded DNA molecules that are able to independently control their multiplication and stable inheritance from generation to generation in their bacterial h osts (2). In addition, many plasmids can transfer from one bacterium to another, the most sophisticated mechanism being by conjugation in which the plasmid carries genes that can create a bridge between bacteria through which a copy of the plasmid can move (Fig 1a). Some plasmids are not able to do this on their own, but can use the bridge made by other plasmids to transfer themselves. The set of genes for multiplication, stable inheritance and transfer are called the plasmid backbone or core. Plasmids can also pick up a variable cargo of other genes that can help their host bacterium grow or survive in different environments – the plasmid spreads them between bacteria and if a survival advantage is gained due to the carried genes on the plasmid there will be positive selection for its carriage. Amongst the favourable traits carried on plasmids, genes conferring antibiotic resistance are of particular concern in the spread of drug-resistant infections (6).

Although all plasmids basically function in similar ways, what makes targeting plasmids difficult is that the genes and proteins they need for multiplication and stable inheritance are highly diverse making it unlikely to find a single compound that will block them all.

Dominant plasmids

The role of plasmids, particularly those able to transfer autonomously (conjugative), in the spread of antibiotic resistance was quickly established. But it was not until techniques like DNA sequencing became commonplace that the extent of the role plasmids play in the dissemination and evolution of resistance traits became clear (7). Genetically identical plasmids were identified globally in different, completely unrelated strains of bacteria. Genes such as NDM-1 conferring resistance to β -lactam antibiotics, and other essential antibiotics, have been observed on dominant plasmid types that are known to have been in circulation for over 50 years. For example, resistance determinants on one type of plasmid isolated from outbreaks of disease caused by E. coli in Canada were also identified only a few years later on different plasmid backbones in outbreaks of K. pneumoniae infection in Sweden . It appears that past antibiotic usage has selected certain plasmids, which are then more likely to pick up the next resistance gene that comes along.

Incompatibility and toxin/anti-toxin systems

All plasmids have ways to control their multiplication so that they do not become a burden to their host bacterium. Closely related plasmids that use the same or similar multiplication genes will therefore compete with each other and cannot be stably inherited together. This is called plasmid “incompatibility” and has been historically used to classify plasmids into different incompatibility groups – plasmids that compete with each other are classified into the same incompatibility group (11). As DNA sequencing technologies developed it became clear that groups of incompatible plasmids shared key parts of their backbones and could be identified by PCR methods . Another class of evolutionary adaptation to ensure stable inheritance inside a host are the toxin/anti-toxin (TA) systems. Many plasmids carry such TA systems, which are usually composed of a stable toxin and an unstable anti-toxin. This means that if the plasmid is lost, the stable toxin outlives the unstable anti-toxin, resulting in death or reduced viability of the plasmid-free cell, and thus maintenance of the plasmid within the overall population (14).

Plasmid curing

As the problem of antibiotic resistance grows, and the number of new antibiotics fails to provide a solution, novel approaches are required to tackle the issue. Since the initial discovery of plasmids, efforts have been made to eliminate, or “cure”, them from their hosts in order to better understand the biological role that these elements have. Early attempts to eliminate plasmids by Salisbury et al. (15) involved stressing the host either by growing the bacterium at higher than optimal temperatures, or by adding chemical compounds such as acridine orange, sodium dodecyl sulfate (SDS) or ethidium bromide. These interventions were only successful for some plasmids and generally also resulted in mutations and damage to the host. Approaches such as these are also not amenable to use in curing plasmids beyond the laboratory.

As more was learned about plasmid replication in the 1970s and with the development of gene cloning, plasmid regions that specifically interfered with stable inheritance were discovered. Different groups, including Hynes et al. (16), developed techniques that relied on identifying the incompatibility groups of the target plasmids and then introducing plasmids with the same incompatibility group to induce curing. This technique was refined by Stolt et al. (17), who cloned only the specific regions that determine incompatibility onto a vector, and showed that this could cure a plasmid carried by Mycobacterium fortuitum. Uraji et al. (18) refined the work of Stolt et al. (1996), by cloning the replication functions to induce incompatibility onto a vector carrying a gene that could be induced to self-destruct. This allowed for the selection of completely plasmid-free strains.

Although the mentioned studies demonstrated the feasibility of using incompatibility to stably cure plasmids from bacterial populations, using this, as an alternative approach to deal with increasingly antibiotic resistance strains was first truly conceptualized in a patent application filed by Filutowicz (19).

Denap et al. (20) took the concept of incompatibility and used it as a rationale to test small chemicals that specifically target functions required for plasmid replication. They used aminoglycosides, which are known to target RNA, and tested their ability to block the replication of plasmids that use RNA as control elements during replication. Their studies showed that when using these drugs a bacterial population could be re-sensitized. However, using antibiotics to try and reduce the problem of antibiotic resistance is not an optimal strategy and many plasmids carry aminoglycoside resistance genes. Nevertheless, it brought forward the concept that plasmids could be a good target for new therapeutic strategies, an idea which was supported by Latha et al. (21) who isolated plant extracts with anti-plasmid properties.

More recently, several groups including ours have looked at ways to specifically target plasmids that carry antibiotic resistance using genetic techniques. Bikard et al. (22) and Ji et al. (23) used CRISPR-Cas to design target-specific systems delivered either by bacteriophages (22) or conjugative plasmids (23). These approaches highlight how genetic techniques can be used instead of chemical compounds as antimicrobials and warrants further development alongside approaches such as phage therapy.

PCURE

The presence of large antibiotic resistance plasmids in bacterial populations is the major determinant of poor clinical outcome during hospital-acquired infections (HAI). Vulnerable or immunocompromised patients commonly suffer from HAIs when bacteria that are normally carried in the gut or on the skin infect wound sites following surgery or form biofilms on indwelling devices such as ventilators and catheters leading to pneumonia or UTIs (Fig. 2). Due to the facility with which plasmids can transfer among bacteria, including gut bacteria, developing a system whose purpose is to displace antibiotic resistance plasmids from particular environments could be a good approach to reduce the burden of antibiotic resistance.

T he pCURE system was developed in the Thomas laboratory by combining functions to block replication of a target plasmid whilst also neutralizing any TA system it carries (Fig. 1b). These “curing functions” are cloned into a different vector that is not itself incompatible with (and therefore blocked by) the target plasmid(s). The combination of targeting multiple replicons and neutralizing TA systems makes our approach unique and essential for applications in environments where one would not want to disrupt the normal ecological balance. For example, it could provide a clear advantage over antibiotic treatment, which can often disrupt the gut microbiota and can result in overgrowth of resistant pathogens such as C. difficile. Hale et al. (24) showed that the pCURE system could be engineered and applied to target different types of plasmids and that it cured at very high efficiency. Although useful in an in vitro setting as shown by several groups who used the system to cure important resistance plasmids (25, 26), the pCURE described by Hale et al. (24) could not be used in more complex environments because it is not self-transmissible.

Currently work in our group is being undertaken to develop a pCURE system that is self-transmissible and could therefore spread among complex microbial communities, displacing antibiotic resistance plasmids as it does so (Fig. 1c). To achieve this goal we are using conjugative IncP-1 plasmids as the core of our vector because of their very broad host range (27) allowing efficient spread through complex communities. We have so far shown that these conjugative pCURE plasmids can transfer, invade and displace an IncF plasmid from a bacterial population in the absence of external selection (Lazdins et al. unpublished results). Work is currently ongoing to expand the curing potential to target a range of natural antibiotic-resistance plasmids and to optimize transfer rates.

Future work and applications for pCURE

In countries where general rates of antibiotic resistance are low (e.g., The Netherlands) it is common practice that all patients entering intensive care units (ITUs) undergo selective digestive and/or oropharyngeal decontamination (SDD and SOD) (28). These involve the administration of prophylactic antibiotics in order to try and reduce the prevalence of infections that would lead to increased mortality. Although effective in decreasing the mortality rates (29), the disruption caused to the normal flora and the possible development of further antibiotic-resistant strains is not ideal. Our vision for pCURE is that it could be used as a prophylactic measure in a similar way to SDD or SOD, given to patients who enter healthcare settings. By giving pCURE to patients at risk of developing infections upon admission to hospital, the idea is that if an infection develops, then it is more likely for it to be sensitive to standard antibiotic therapy, due to displacement of the plasmids carrying resistance (Fig. 2). This can also be applied to healthcare workers to limit possible spread of any antibiotic-resistant strains that they may be carrying.

Another area where we think that pCURE would be particularly useful is in limiting the international spread of resistance. There are places where the number of strains carrying plasmids with multiple antibiotic resistance genes is higher than others (Southeast Asia vs. Scandinavia for example) and studies have demonstrated that individuals travelling to places with higher occurrence will quickly be colonized by resistance strains even without becoming ill and these strains can remain in their flora for extended periods (30). Therefore, upon returning from places with a high risk of colonization, travellers could take a course of pCURE to eradicate any problematic resistance genes they have acquired. For this vision to be realised several steps need to be taken to ensure that pCURE becomes a cost-efficient, adaptable and, most importantly, safe system to use in human medicine.

Bacterial conjugation in the gastrointestinal tract (GIT) of humans is poorly understood, and although there is evidence that conjugation is an important factor influencing HGT in the GIT (See (31)) for a current review), more work will be needed to fully understand the extent of pCURE spread once administered. These studies will require the use of animal models or complex in vitro gut models. Once these studies are done, more work can be undertaken to optimize pCURE as a transfer agent, but also to find the best way to administer it. We are currently taking inspiration from probiotics and faecal transplant treatments, where in both cases live bacteria are successfully delivered to the gastrointestinal tract.

Safety considerations are essential when establishing how best to administer pCURE and track how it spreads. Plasmids have the ability to pick up resistance genes extremely easily as well as having the ability to integrate into bacterial-host chromosomes. To ensure safety and avoid fears of releasing genetically modified elements into nature, we would need to prevent the acquisition of resistance genes by the pCURE vector as well as the potential for chromosomal integration by including genetic safeguards in our system. These would include systems that specifically block the ability of plasmids to acquire extra resistance genes as well introducing specific self-destruct mechanisms to avoid pCURE from working outside of the body.

Extensive discussions will also be needed with safety governing bodies (for example, the FDA or EMA) regarding the classification and requirements for the usage of pCURE. At present, pCURE sits somewhere between a food, a drug and a biologic so specific requirements for trials and approval in human usage will need to be clarified. Alongside this clarification, studies on how the public would perceive pCURE as a product are essential. A lot is known about the reticence that people have for using genetically modified organisms (GMOs) (32, 33), but would this reticence change in the face of the dangers of antibiotic resistance?

Nəticə

Even though plasmids are the major reason for the development and spread of resistance among naïve bacterial populations, very little attention is being given to these elements as targets for combating the maintenance and spread of antibiotic resistance. The knowledge and technology to develop plasmid-curing technologies is accessible, and many groups have used a range of approaches to achieve this goal in vitro. However, the jump to using these kinds of systems in more complex environments has yet to be realized. We believe that the practical value of pCURE should be explored as an efficient way to cure antibiotic-resistance plasmids from strains colonizing the GIT in a way that would not disrupt the normal flora, resulting in a reduced clinical burden if infection were to manifest itself.

Biographies

Dr Claire Miller gained her PhD in Bacterial Genetics from the University of Leicester, followed by a three year post-doctoral research position in the same laboratory. She is currently working in the laboratory of ProfessorThomas at the University of Birmingham. She joined the laboratory on a Wellcome Trust ISSF Translational Award to develop plasmid curing as a method for reducing antibiotic resistance carriage in bacteria.

Dr Mark A Webber is interested in the study of the mechanisms and biology of antibiotic resistance, bacterial responses to stress and biofilm formation and has published over 50 articles in these areas since 2001. He was awarded a BBSRC David Phillips Fellowship in 2007 and took up a tenured position within the Institute for Microbiology and Infection at Birmingham at the beginning of 2012.

 Professor Christopher M Thomas is Professor of Molecular Genetics in the School of Biosciences and Institute of Microbiology and Infection at the University of Birmingham. He has been passionate about bacterial plasmids as systems ever since his DPhil in Oxford with Keith Dyke and postdoc with Donald Helinski at University of California, San Diego. He led the creation of the International Society for Plasmid Biology in 2004 and set up Plasgene in 2006 based on plasmid curing technology.


How Much Do You Know About the Prokaryotic Expression System?

E. coli protein expression system is the most commonly used expression system for recombinant proteins. Prokaryotic expression vectors generally consist of the replicon, promoters, selection markers, multiple cloning sites (MCS) and fusion tags / restriction sites.


The replicon is comprised of the origin of replication (ORI) and all of its control elements. The ORI is the place where DNA replication begins, enabling a plasmid to reproduce itself as it must to survive within cells. The best choice of ORI depends on how many plasmid copies you want to maintain, which host or hosts you intend to use, and whether or not you need to consider your plasmid's compatibility with one or more other plasmids. Commonly used pET (Novagen) series vectors mainly carry pMB1 ori, providing a copy number of 15-60 pQE vectors (Qiagen) carrying ColE1 ori provides a copy number of 15-20 pACYC and pBAD series of vectors carry p15A ori, giving a copy number of 10-12, and are commonly used for the co-expression of two recombinant proteins. (Misunderstanding: Does high copy number of the carrier result in high protein expression yield? High copy of the exogenous plasmids will create a greater burden on the normal metabolism of the host, which may slow down cell proliferation, destabilize the plasmid, and eventually compromise the final expression yield of the recombinant protein.) This following table defines common cloning vectors, their copy number, ORI, and incompatibility groups.

Table 1. Common Prokaryotic Expression Vectors and ORIs


Cullum, J., Collins, J. F., Broda, P.: Factors affecting the kinetics of progeny formation with F'lac in Escherichia coli K12. Plazmid 1, 536–544 (1978a)

Cullum, J., Collins, J. F., Broda, P.: The spread of plasmids in model populations of Escherichia coli K12. Plazmid 1, 545–556 (1978b)

Cullum, J., Broda, P.: Rate of segregation due to plasmid incompatibility. Genet. Res. 33, 61–79 (1979)

Finger, J., Krishnapillai, V.: Host range, entry exclusion, and incompatibility of Pseudomonas aeruginosa FP plasmids. Plazmid 3, 332–342 (1980)

Ishii, K., Kashimoto-Gotoh, T., Matsubara, K.: Random replication and random assortment model for plasmid incompatibility in bacteria. Plazmid 1, 435–445 (1978)

Nordström, K., Molin, S., Aagaard-Hansen, H.: Partitioning of plasmid R1 in Escherichia coli. I. Kinetics of loss of plasmid derivatives deleted of the par region. Plazmid 4, 215–227 (1980)

Nordström, K., Aagaard-Hansen, H.: Maintenance of bacterial plasmids: comparison of theoretical calculations and experiments with plasmid R1 in Escherichia coli. Mol. Gen. Genet. 197, 1–7 (1984)

Novick, R. P., Hoppensteadt, F. C.: On plasmid incompatibility. Plazmid 1, 421–434 (1978)

Simmons, G. F.: Introduction to topology and modern analysis. McGraw-Hill, New York 1963

Stewart, F. M., Levin, B. R.: The population biology of bacterial plasmids: a priori conditions for the existence of conjugationally transmitted factors. Genetika 87, 209–228 (1977)

Van der Hoeven, N. A mathematical model for the co-existence of incompatible, conjugative plasmids in individual bacteria of a bacterial population. J. Teor. Biol. 110, 411–423 (1984)

Van der Hoeven, N.: Evolution of bacterial surface exclusion against incompatible plasmids. J. Teor. Biol. 117, 431–452 (1985)

Willetts, N., Maule, J.: Interaction between the surface exclusion systems of some F-like plasmids. Genet. Res. 24, 81–89 (1974)


Videoya baxın: Uşağın qan qrupu necə təyin olunur? (Iyul 2022).


Şərhlər:

  1. Teoxihuitl

    Daha çox belə məqalələr

  2. Barden

    Bu qiymətli ifadəlidir

  3. Stamitos

    Səhv etmək. Bunu sübut edə bilərəm. Mənə baş nazirlə yaz, müzakirə edin.

  4. Hjalmar

    Fikirinizi tam bölüşürəm. Bunda bir şey var və düşünürəm ki, bu çox yaxşı bir fikirdir. Mən sizinlə tamamilə razıyam.

  5. Nilmaran

    Məncə, doğru deyilsən. Mən mövqeyi müdafiə edə bilərəm. PM-də mənə yaz.



Mesaj yazmaq