Məlumat

Aşağı ifadə səviyyələrində işləyən sitoplazmik vektor üçün seçim markeri?

Aşağı ifadə səviyyələrində işləyən sitoplazmik vektor üçün seçim markeri?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

İnsan hüceyrələrindəki plazmiddə seçim markerini ifadə etməliyəm (məsələn, HEK293). Bununla belə, mən transkripsiya başlanması üçün öz mexanizmi olan qeyri-insan virusundan əldə edilən sitoplazmik vektordan istifadə edirəm. Bu o deməkdir ki, hər hansı bir protein markerinin ifadə səviyyəsi olacaq əmmək: aşağı nüsxə sayı, çox zəif promouter, qeyri-sabit transkriptlər - bunlar mənim bu dəqiq bioloji kontekstdə dəyişə bilməyəcəyim şeylərdir.

Əksər seçim markerləri (məsələn, KanMX) öz qara qutu promouterləri ilə gəlir və buna görə də onların istehsal olunan çox sayda zülaldan asılı olub olmadığını bilmirəm.

Çox aşağı ifadə səviyyəsinə baxmayaraq seçilə bilən marker hansı ola bilər? Klassik markerlərin zülal nüsxə nömrələrini müqayisə edən heç bir mənbə tapa bilmədim.

Əmin olmalıyam ki, selektiv təzyiqə dözə bilməyən hüceyrələr markerə malik olmadığı üçün ölür, nəinki marker markerə malik olan hüceyrələri qorumaq üçün çox zəif ifadə olunduğu üçün. Standart yanaşma müntəzəm antibiotik seçimindən istifadə etmək və daha az konsentrasiyalı antibiotiklərlə işləmək olardı, lakin yanlış müsbətlərin sayı çox güman ki, çox yüksək olacaqdır.

Mən ev sahibi hüceyrəni müəyyən dərəcədə manipulyasiya edə bilirəm, ona görə də antibiotik seçimindən istifadə edə bilərəm, eyni zamanda əsas genin (auksotrofik marker və ya qeyri-metabolik genlər) şərti silinməsini tamamlaya bilərəm.


Plazmidinizi axtarır axın sitometriyası.

Bu insanlar plazmidlərini xüsusi bir flüoresan markerlə etiketlədilər, sonra plazmidi götürmüş hüceyrələri aşkar etmək üçün axın sitometriyasından istifadə etdilər.

Hüceyrələrdə transfeksiya səmərəliliyinin optimallaşdırılması üçün yeni sürətli və təkrarlana bilən axın sitometrik metodu

Floresan reportyor genlərindən istifadə etmək üçün alternativ və daha birbaşa üsul, hüceyrədaxili çatdırılmasını izləmək üçün flüoresan boyalarla nuklein turşularını birbaşa etiketləməkdir [16]... Qeyri-enzimatik Label IT® Tracker TM Kitlərindən istifadə edərək, istənilən plazmid sadə şəkildə xüsusi olaraq etiketlənə bilər. məməli hüceyrələrinə daxil edilməzdən əvvəl bir addımlı kimyəvi reaksiya [18]. Beləliklə, etiketli plazmidin məməli hüceyrələrinə daxil edilməsindən sonra həm etiketlənmiş DNT-nin hüceyrəaltı lokalizasiyası, həm də ifadə reportyoru transgeni eyni vaxtda izlənilə bilər [16, 18]...

Burada biz reportyor plazmidini Label IT® TrackerTM ilə etiketləməklə transfeksiyanın effektivliyini müəyyən etmək üçün axın-sitometrik analizin işlənib hazırlanmasını nümayiş etdiririk. Bu üsul iki müxtəlif plazmidin birgə transfeksiyasından asılı deyil və eyni zamanda hüceyrə ölümünü, keçici transfeksiya zamanı etiketlənmiş plazmidin tutulmasını və hədəf zülalın ifadəsini kəmiyyətlə müəyyən edir.

Hüceyrələrinizin yalnız kiçik bir hissəsi parıldayan plazmidinizi tutsa belə, siz onları axınla digərlərindən ayıracaqsınız.


İfadə vektoru

An ifadə vektoru, başqa cür tanınır ifadə konstruksiyası, adətən hüceyrələrdə gen ifadəsi üçün nəzərdə tutulmuş plazmid və ya virusdur. Vektor müəyyən bir geni hədəf hüceyrəyə daxil etmək üçün istifadə olunur və gen tərəfindən kodlanmış zülal istehsal etmək üçün hüceyrənin protein sintezi mexanizmini idarə edə bilər. İfadə vektorları zülalların istehsalı üçün biotexnologiyada əsas vasitələrdir.

Vektor gücləndirici və promotor bölgələri kimi çıxış edən və ifadə vektorunda daşınan genin səmərəli transkripsiyasına səbəb olan tənzimləyici ardıcıllıqları ehtiva etmək üçün hazırlanmışdır. [1] Yaxşı dizayn edilmiş ifadə vektorunun məqsədi zülalın səmərəli istehsalıdır və buna əhəmiyyətli miqdarda sabit messencer RNT istehsalı ilə nail olmaq olar, sonra zülala çevrilə bilər. Zülalın ifadəsi ciddi şəkildə idarə oluna bilər və zülal yalnız induktorun istifadəsi ilə lazım olduqda əhəmiyyətli miqdarda istehsal olunur, bəzi sistemlərdə zülal konstruktiv şəkildə ifadə oluna bilər. Escherichia coli adətən protein istehsalı üçün ev sahibi kimi istifadə olunur, lakin digər hüceyrə növləri də istifadə edilə bilər. İfadə vektorunun istifadəsinə misal olaraq diabetin tibbi müalicəsində istifadə olunan insulinin istehsalı göstərilir.


Fon

Qadınlarda ən çox diaqnoz qoyulan bədxassəli şiş olan süd vəzi xərçəngi (BC) eyni zamanda bütün dünyada xərçəngdən ölüm hallarının ən çox görülən səbəbidir [1] və əhəmiyyətli qlobal ictimai sağlamlıq problemidir. BC patoloji xüsusiyyətlərinə görə çox heterojendir, bu da müalicə seçimi üçün böyük problem yaratdı [2]. İndiyədək invaziv süd vəzi karsinomalarında, o cümlədən estrogen reseptoru (ER) və progesteron reseptoru (PR), daha yaxşı nəticə ilə əlaqəli olan və endokrin həssaslığı proqnozlaşdıran bir neçə biomarker yaxşı tanınıb. İnsan epidermal böyümə faktoru reseptoru 2 (HER2) həddindən artıq ifadəsi residivsiz sağ qalma (RFS) və ümumi sağ qalma (OS) ilə əlaqədardır [3, 4]. Tamoksifen və trastuzumab kimi ER və HER2-ni hədəf alan agentlər BC terapevtikləri kimi çox uğurlu olmuşdur. Bununla belə, şişlərdə tək və ya kombinasiyalı müalicələrdə endokrin müalicəyə rezistentliyə səbəb olan çoxşaxəli mexanizmlər meydana çıxdı [5]. Beləliklə, daha çox biomarkerlərin və molekulyar hədəflərin hərtərəfli müəyyən edilməsi BC-nin optimal və fərdiləşdirilmiş klinik idarə olunması üçün vacibdir.

Peroksizom proliferatoru ilə aktivləşdirilmiş reseptorlar (PPAR) nüvə reseptorları (NR) super ailəsinə aiddir [6] və liqandla aktivləşdirilmiş transkripsiya faktorları kimi fəaliyyət göstərir [7]. Liqandlar tərəfindən aktivləşdirildikdən sonra (məsələn, 15d-PGJ2 və ya sintetik liqand tiazolidindion), PPAR-lar retinoid X reseptoru (RXR) ilə heterodimerləşir və hədəf gen promotorlarında mövcud olan proliferatorla aktivləşdirilmiş reseptor cavab elementləri (PPRE) ilə qarşılıqlı əlaqədə olur [8]. NR superfamilyası nüvə lokalizasiyasını tələb edən reseptorların genomik hərəkətlərinə görə müəyyən edilsə də, PPAR-ların ilk növbədə spesifik əlaqəli funksiyaları ilə sitoplazmada lokalizasiyası təklif edilmişdir [9].

Üç PPAR izoforması (α, β/δ və γ) arasında PPARγ adipogenez və lipid mübadiləsində mühüm rol oynayır [10] və həmçinin BC [11] daxil olmaqla bir çox insan xərçəngində ifadə edilir. PPARγ iltihabi proseslərə, hüceyrə proliferasiyasına, differensasiyasına, apoptoza və şişin angiogenezinə təsir göstərir [10, 12]. Qaraciyər [13], xərçəng [14] və ya kolon xərçəngi [15] kimi bəzi şişlərdə PPARγ-nın şiş təşviq edən təsiri bildirilmişdir. Bundan əlavə, əvvəlki tədqiqatların əksəriyyəti PPARγ-nın BC-də şiş bastırıcı rolunu oynadığını, hüceyrə proliferasiyasını maneə törətdiyini və müxtəlif in vivo və in vitro modellərdə apoptozu induksiya etdiyini ortaya qoydu [16,17,18]. Bundan əlavə, PPARγ-nın TNBC-nin kemoterapiya müqavimətində iştirak etdiyi irəli sürülür [19].

Maraqlıdır ki, bəzi PPARγ liqandları, prostaglandinlər (PG) Cox-1 və Cox-2 siklooksigenazları tərəfindən araxidon turşusunun çevrilməsindən istehsal olunur. Cox-1 konstitutiv olaraq bir çox normal hüceyrələrdə ifadə edilir, halbuki Cox-2 ümumiyyətlə iltihablı sitokinlər və böyümə faktorları tərəfindən induksiya edilir və kanserogenezdə əhəmiyyətli rol oynayır [20, 21]. Şişin inkişafı və invazyonunda Koksun əhəmiyyəti ilə bağlı tədqiqatlar əsasən Cox-2-nin təsirinə yönəldilmişdir [22]. Bununla birlikdə, Cox-1-in yüksək ifadə edildiyi və yumurtalıq [23] və döş xərçəngi [24] kimi bəzi karsinomalarda əsas rol oynadığı nümayiş etdirildi. Bu yaxınlarda Cox-1 mRNT və zülal səviyyələrinin bədxassəli döş şişlərində normal toxumalara nisbətən daha yüksək olduğu, Cox-2 mRNA səviyyəsinin bədxassəli şişlərdə daha aşağı olduğu göstərilmişdir. Buna baxmayaraq, stromal və glandular Cox-2 immuno-boyanması bədxassəli döş şişlərində daha yüksək səviyyələr göstərdi [25].

Buna görə də aydın görünür ki, BC-də PPARγ və Koksun (xüsusilə Cox-1) birləşmiş ifadəsinin aktuallığını təhlil etmək üçün daha çox diqqət tələb olunur. Bu araşdırmada, birinin müstəqil olaraq, yoxsa digərləri ilə əlaqədar olaraq BC irəliləməsi ilə əlaqəli ola biləcəyini müəyyən etmək üçün 308 əsas BC nümunəsində PPARγ və iki Cox zülalının ifadəsini sağ qalma ilə bağlı təhlil etdik.


CHO hüceyrələrində rekombinant monoklonal antikor istehsalı üçün ifadə vektorlarının inkişafı üçün tikinti strategiyaları

Son illərdə müxtəlif xəstəliklərin müalicəsində rekombinant zülalların istifadəsi müşahidə edilmişdir. Onların arasında monoklonal antikorlar (mAbs) hazırda bioterapevtik rekombinant zülalların ən sürətlə böyüyən sinfidir. Çin hamster yumurtalıq (CHO) hüceyrələri bu rekombinant mAb-lərin istehsalı üçün ən çox istifadə edilən ana hüceyrələrdir. İfadə vektorları rekombinant mAb-lərin ifadə səviyyəsini və keyfiyyətini müəyyən edir. Hal-hazırda, CHO hüceyrələrində rekombinant mAbs ifadə vektorları üçün bir neçə tikinti strategiyası hazırlanmışdır, o cümlədən monosistronik vektor, çoxsaylı promoter ifadə vektoru və daxili ribosoma giriş yeri (IRES) və ya Furin-2A elementi ilə vasitəçilik edilən trisistronik vektor. Onların arasında Furin-2A vasitəçiliyi ilə işləyən vektor yüksək “öz-özünə parçalanma” səmərəliliyinin üstünlükləri və tək açıq oxu çərçivəsindən yüngül və ağır zəncirlərin bərabər şəkildə ifadə edilməsinə görə effektiv yanaşmadır. Burada CHO hüceyrələrində rekombinant mAb ifadə vektorlarının qurulması üçün müxtəlif strategiyaların inkişafındakı irəliləyişləri və onun potensial üstünlükləri və mənfi cəhətlərini nəzərdən keçirdik.


Nəticələr

MAP17 Hela İnsan Servikal Şiş Hüceyrələrində Həddindən artıq İfadə ROS tənzimləyən Genlərin RNT İfadə Səviyyələrini Dəyişdirir

Əvvəlcə servikal hüceyrələrin MAP17 ifadəsi ilə ROS tənzimləməsini dəyişdirib-dəyişdirmədiyini araşdırmaq üçün biz MAP17 cDNA-nı Hela servikal şiş hüceyrələrinə ektopik şəkildə ifadə etdik (Şəkil 1A və 1B). Seçimdən sonra ROS-u tənzimləyən 84 genin transkripsiyasını təhlil etdik (Sabioscience-dən RT 2 Profiler™ PCR Array). Biz tapdıq ki, genlərin təxminən 30%-də RNT səviyyələri 4 dəfədən çox dəyişir (Şəkil 1C). PTGS1 (39 qat artım) və ya SIRT2 (10 qat artım) kimi bəzi genlər açıq şəkildə yuxarı tənzimləndi, BNIP3 və ya MSRA (18 qat azalma) isə aşağı salındı ​​(Cədvəl 1). Bu məlumatlar açıq şəkildə göstərir ki, Hela hüceyrələrində MAP17 həddindən artıq ifadəsi oksidləşdirici stressi tənzimləyən genlərin RNT səviyyələrini dəyişdirdi və bu, Hela hüceyrələrində istehsal olunan ROS səviyyələrini dəyişdirdi (Şəkil S1). Daha sonra, MAP17-nin oksidləşdirici stressi aktivləşdirdiyi bilinən kemoterapevtik dərmanlara reaksiyanı dəyişdirib-dəyişmədiyini müəyyən etməyə çalışdıq. MAP17 cDNA və ya boş vektoru daşıyan Hela hüceyrələri 11 müxtəlif konsentrasiyada sisplatin, oksaliplatin və ya gemsitabin ilə standart sitotoksik analizlərə [26], [27] məruz qalmışdır. MAP17 olan hüceyrələrin nəzarət hüceyrələrindən daha həssas olduğunu (2 dəfədən çox) tapdıq (Şəkil 1D və Şəkil S2). Buna görə də, məlumatlarımız göstərir ki, MAP17 servikal şiş hüceyrələrində ROS metabolizmasında iştirak edən genlərin transkripsiya balansını dəyişdirdi və bu balanssızlıq ROS-u induksiya edən kemoterapevtik dərmanlara hüceyrə həssaslığını artıra bilər.

Ektopik MAP17 cDNA-nı ifadə edən Hela xərçəngi hüceyrələri seçilmiş və MAP17 zülal ifadəsi üçün təhlil edilmişdir A) Hela hüceyrələrində ektopik olaraq ifadə edilən MAP17 mRNA-nın kəmiyyət ölçülməsi və B) slaydlarda sitospin sentrifuqasından sonra immunodeteksiya. C) Map17 oksidləşdirici stressdə iştirak edən genlərin transkripsiyasını dəyişir. Hela hüceyrələrində MAP17 tərəfindən törədilən gen transkripsiya dəyişikliklərinin paylanmasını təsvir edən qrafik göstərilir. D) IC50 dəyərləri MAP17 ifadə edən Hela hüceyrələrində və ya yalnız vektorla müxtəlif kimyaterapevtik preparatlar üçün göstərilmişdir.

Cədvəl 1

Genlər Ϥ-qat yuxarı tənzimlənirGenlər Ϥ dəfə aşağı tənzimlənir
Gen SimvolQatla DəyişiklikGen simvoluQatla Dəyişiklik
CCL57,3958ALB𢄤,3486
GPX36,9993ATOX1𢄧,0806
KRT15,5198BNIP3�,7871
MGST35,1573CAT𢄦,293
PRDX28,0437DHCR24𢄥,3102
PRDX54,054DUOX1𢄥,2595
PRG37,0221GPX1𢄤,3298
PTGS139,1571MSRA�,4663
PXDNL5,2399NCF2𢄧,5352
SCARA34,9336OXR1𢄤,2456
SIRT29,8365OXSR1𢄥,6898
SOD24,1722PRDX3𢄨,1426
SOD35,5476PRDX4�,334
SRXN14,9745SELS𢄤,7526
TXNRD14,4648STK25𢄥,165
TXNRD25,0278HPRT1�,7514

MAP17 İnsan servikal şişlərində həddindən artıq ifadə, inkişaf etmiş mərhələ xəstəliyi ilə əlaqələndirilir

MAP17 karsinomalarda, xüsusilə yumurtalıq, prostat və döş xərçəngində həddindən artıq ifadə edilir və onun həddindən artıq ifadəsi inkişaf etmiş mərhələlərlə əlaqələndirilir [6]. Buna görə də, MAP17 ifadəsinin insan servikal şişi üçün bir marker olub olmadığını təsdiqləmək istədik. Bu şişlərdə MAP17 protein ifadəsini qiymətləndirmək üçün immunohistokimyadan istifadə edərək 239 uşaqlıq boynu şiş nümunəsini təhlil etdik. Bütün hallarda nümunə müalicədən əvvəl biopsiyadan alınmışdır və bütün hallarda müalicə homojen olmuşdur (Cədvəl 2), radio və brakiterapiyadan ibarət 6 dövr cisplatin ilə birləşdirilmişdir. Şişlərin əksəriyyəti TNM mərhələləri IB, IIA və IIB idi, lakin bir neçə şiş növü təmsil olunurdu. Müxtəlif şişlərə 97 skuamöz karsinoma, 32 selikli karsinoma, 12 endometroid karsinoma, 10 şəffaf hüceyrəli karsinoma, 8 seroz tip, 7 keçid tipli, 9 differensiallaşmamış, 7 adenoskuamöz karsinoma və 3 adenoma daxildir. Bundan əlavə, kohortda naməlum tipli 54 şiş var idi.

Cədvəl 2

Seks Qadın 100%
Yaş 26�Orta 55,67
Sinif113,6%(n =�)
236,3%(n =�)
332,2%(n =�)
Nd17,8%(n =�)
MərhələİA1%
IB60%
IIA20%
IIB18%
III1%
MüalicəRadioterapiya (50 Gy) + braxiterapiya (15 Gy) + sisplatin (6 dövr: 40 mq/m2)

Şişlər dəstində MAP17 səviyyələrinin təhlili göstərdi ki, bütün şişlərin yalnız 18%-i MAP17 boyanması üçün mənfi, qalan 82%-i isə müxtəlif dərəcələrdə müsbət olub. Şəkil 2A bəzi servikal şiş növlərinin MAP17 boyanmasının nümayəndəsi şəkillərini göstərir.

A) Müxtəlif şiş növləri üçün MAP17 immunoqramasının reprezentativ şəkilləri göstərilir. B) Müxtəlif MAP17 səviyyələri olan uşaqlıq boynu şişlərinin faizini əks etdirən qrafik göstərilir. C) İmmun boyama MAP17-nin yalnız membran paylanmasını göstərərək aparıldı. D) Müxtəlif boyun şişləri növləri arasında MAP17 ifadə səviyyələrinin paylanması göstərilir. Maksimum səviyyələr qrafiki şişin hər hansı bir hissəsində müşahidə olunan maksimum boyanma intensivliyinə aiddir (0-dan 3-ə qədər). Normallaşdırılmış səviyyələr (bal) qrafiki xanaların faizi (0�) ilə toplanan maksimum səviyyələrə (0𠄳) aiddir. Normallaşdırılmış səviyyələr hüceyrələrin faizini müşahidə olunan intensivlik səviyyəsinə vurmaqla əldə edilmişdir. E) MAP17-müsbət şişlərin şiş alt tipinə görə faizini əks etdirən qrafik göstərilir.

Boyanma nəticələri mikroskopik səviyyədə vizual meyarlara uyğun olaraq qiymətləndirilmiş və aşağıdakı kimi təyin edilmişdir: 0 = no boyanma 0,5 =Ȁorta zəif boyama 1 = pozitiv, aydın boyanma zəif 1,5 = pozitiv boyanma 2 =Ȁmüsbət, güclü boyanma və 3 = =Ȁpozitiv, çox güclü boyanma. Müşahidə olunan MAP17-nin ümumi səviyyələrini qiymətləndirmək üçün MAP17 üçün müsbət olan şiş hüceyrələrinin faizini də qeyd etdik. 239 şişdən yalnız 43-ü (18%) MAP17-ni ifadə etməmişdir. Cəmi 146 (61%) orta səviyyəni göstərdi və 50 şiş (21%) çox yüksək MAP17 ifadə səviyyələrini göstərdi (Şəkil 2B).

MAP17-nin iki fərqli subcellular paylanmasını müşahidə etdik. İlk paylanma nümunəsi, xüsusilə perinuklear bölgədə geniş sitoplazmik paylanma ilə sitoplazmik və membranöz boyanma ilə əlaqəli idi (Şəkil 2A). İkinci paylama nümunəsi yalnız membranda MAP17 boyanmasını göstərdi (Şəkil 2C). MAP17-müsbət şişlərin əksəriyyəti sitoplazmik və membranal paylanma göstərdi, lakin nümunələrin təqribən 5%-i aydın yalnız membran paylanması göstərdi. Maraqlıdır ki, bir neçə şişdə MAP17 üçün hər iki hüceyrəaltı lokalizasiyanı göstərən müxtəlif populyasiyalar var idi, biz bu cür diferensial paylanmanın səbəbini hazırda bilmirik. Mədəni hüceyrələrdə MAP17 plazma membranının bəzi lokalizasiyası ilə ilk növbədə perinuklear sitoplazmatik boyanma göstərir. Mümkündür ki, MAP17-nin hüceyrədaxili membran bölmələrinə, məsələn, Qoljiyə güclü bağlanması bu hüceyrədaxili lokalizasiyaya səbəb olur. Buna görə də ola bilər ki, bəzi şişlər hüceyrədaxili membran bölmələrini toplayır və sitozolda MAP17-nin artan səviyyəsini toplayır, digər şişlərdə isə daxili membranların səviyyəsi minimaldır və hüceyrələr hüceyrə membranında MAP17 toplayır. O, həmçinin xüsusi şişin və ya hüceyrə klonunun molekulyar kontekstindən asılı ola bilər. Bununla belə, bu paylanma dəyişkənliyini anlamaq üçün daha çox araşdırma tələb olunur.

Sonra, müxtəlif şiş növləri üçün MAP17 paylama səviyyələrini təhlil etdik. Bu tapşırıq üçün biz MAP17 səviyyələrini iki fərqli şəkildə qiymətləndirdik: şişdə tapılan MAP17-nin maksimum səviyyəsini təyin etdik və ya hesabı hesablamaq üçün MAP17 siqnal intensivliyini müsbət hüceyrələrin faizinə vuraraq səviyyələri normallaşdırdıq (Şəkil 2D). Biz aşkar etdik ki, əksər şiş növləri 1 medianı ilə geniş səviyyələr göstərir: MAP17-nin aşağı, lakin aydın səviyyələri. Bununla belə, selikli tipli şişlərin çox aşağı MAP17 səviyyələrini ifadə etdiyi ortaya çıxdı. Maraqlıdır ki, adenomanın xoşxassəli şişləri MAP17-ni ifadə etməmişdir. Şəkil 2E MAP17 üçün pozitivlik (istənilən səviyyədə) göstərən hər bir şiş növünün faizini göstərir.

MAP17 Hela şiş hüceyrələrində həddindən artıq ifadə qlükoza qəbulunu və SGLT1 tərkibini artırır

Əvvəlki nəticələr göstərmişdir ki, SGLT1 aktivləşdirilməsi PI3K [12] aktivləşdirərək enterositləri hüceyrə apoptozundan xilas edir və bu membran nəqlinin inhibəsi MAP17-dən asılı ROS artımını və yayılmasını maneə törədir [8]. Bu genin serviksdəki MAP17 ilə əlaqəsini araşdırmaq üçün əvvəlcə MAP17-ni ifadə edən Hela hüceyrələrində qlükoza qəbulunu ölçdük (Şəkil 3A). Məlum olub ki, qlükoza qəbulu orta hesabla 4 dəfə artıb və SGLT inhibitoru ploridzin ilə müalicə zamanı inhibə edilib. Bundan əlavə, biz tapdıq ki, SGLT1 protein səviyyələri MAP17-ni ifadə edən Hela hüceyrələrində orta hesabla 2 dəfə artıb (Şəkil 3B).

A) Hela hüceyrələrində MAP17 ifadəsi SGLT inhibitoru floridzin tərəfindən bloklanan qlükoza qəbulunu artırır. B) MAP17 və ya vektoru tək (V) ifadə edən Hela hüceyrələrində SGLT1 üçün Western blot analizi aparılmışdır. C) Reprezentativ şəkillər müxtəlif uşaqlıq boynu şişinin alt tiplərinin SGLT1 immunoqramasının göstərilir. D) Müxtəlif SGLT1 səviyyələri olan uşaqlıq boynu şişlərinin faizini əks etdirən qrafik göstərilir. E) SGLT1-müsbət şişlərin şiş alt növü üzrə faizini əks etdirən qrafik göstərilmişdir.

İnsan servikal şişlərində SGLT1 həddindən artıq ifadəsi MAP17 səviyyələri ilə əlaqələndirilir

Bu və digər, əvvəlki nəticələr göstərir ki, MAP17-dən asılı olan şişogen xüsusiyyətləri SGLT1 nəqli ilə ROS-un dolayı aktivləşdirilməsindən asılıdır. Buna görə də, biz servikal şiş nümunələrinin eyni kohortunda SGLT1 ifadə səviyyələrini ölçdük.

Biz aşkar etdik ki, şişlər müsbət SLGT1 boyanması göstərdi (Şəkil 3C), şişlərin təxminən 40%-i SLGT1 üçün müsbətdir (Şəkil 3D). Bununla belə, yalnız bir neçə nümunə çox yüksək boyanma səviyyəsini göstərdi. SLGT1-müsbət şişlərin müxtəlif servikal şiş növləri arasında paylanması MAP17 adenomasının xoşxassəli şişlərinin açıq şəkildə SLGT1 mənfi olduğunu göstərdi (Şəkil 3E).

MAP17 və SLGT1 arasındakı funksional əlaqəni nəzərə alaraq, hər iki zülalın ifadə səviyyələri arasında korrelyasiya olub-olmadığını təhlil etdik. SGLT1 ifadə səviyyələrini aşağı (0𠄰,5), orta (0,5<xρ,5) və ya yüksək (ϡ,5) olaraq qruplaşdırdıq və qrupları MAP17 ifadə səviyyələrinə görə müqayisə etdik (Anova, Krustell-Wallis testi). Qruplar daxilində MAP17 və SGLT1 səviyyələri arasında birbaşa, əhəmiyyətli korrelyasiya tapdıq (pπ,001 Şəkil 4A). Sonra, eyni şiş nümunələrində hər iki zülalın səviyyələrini müqayisə etdik və eyni şiş nümunəsindəki hər iki zülalın səviyyələri arasında əhəmiyyətli korrelyasiya (Spearman testi, pπ,001) tapdıq.

A) Təhlil edilən bütün nümunələrdə MAP17-SGLT1 korrelyasiyalarını təsvir edən qrafik göstərilir. Statistik təhlillər 1-yollu ANOVA istifadə edərək aparılmışdır. B) Müsbət korrelyasiyanın üç təmsilçi nümunəsi göstərilir (P1, P2 və P3 3 müxtəlif şiş nümunəsidir). Hər bir şişdən iki nümunə MAP17 və SGLT1 üçün boyandı. C) B-də göstərilən P3 rəqəmlərinin böyüdülməsi göstərilir. Şəkillər nümunə toxuma nümunəsində MAP17 və SGLT1-in plazma membran paylanmasını göstərir.

Yenə də SGLT1 üçün 2 fərqli subhüceyrəvi paylanma müşahidə etdik: sitoplazmik və membranöz və yalnız membran. Aydındır ki, SGLT1 paylama nümunələri eyni şişdə MAP17 paylama nümunələrinə uyğun gəlir (Şəkil 4B).

MAP17 və SGLT1 İfadə Səviyyələri Servikal Şişli Xəstələrdə Sağqalma ilə Əlaqədardır

MAP17 ifadəsi xərçəng hüceyrələrinin şiş törədən xüsusiyyətlərini artırmaq üçün ikinci bir xəbərçi rolunu oynaya bilən ROS-u artırdığı üçün [8], ROS-un daha da artmasının ROS səviyyələrini həddən artıq artıra və hüceyrələrin fiziologiyasını apoptoza çevirə biləcəyini fərz etdik. . Biz müşahidə etdik (Şəkil 1D), MAP17-ni həddindən artıq ifadə edən Hela hüceyrələrinin ROS-a səbəb olduğu bilinən bir neçə kemoterapevtik dərmana qarşı həssaslığını 2 dəfə artırdı. Buna görə də, MAP17 oksidləşdirici stressin sisplatin və ya radioterapiya kimi cavabda əsas rol oynadığı müalicələrin fəaliyyəti üçün marker ola bilər.

Nümunələr toplandıqdan sonra kohortumuzun xəstələri bu tip şiş üçün standart müalicə, radioterapiya (50 Gy) + braxiterapiya (15 Gy) + sisplatin (6 dövr: 40 mq/m2) ilə müalicə olundu. MAP17 səviyyələrinin terapiyaya reaksiyaya təsir edib-etmədiyini təhlil etdik. Bu məqsədlə fərqli MAP17 səviyyələrinin xəstənin sağ qalması ilə əlaqəli olub olmadığını araşdırdıq. Kaplan-Meier əyriləri göstərdi ki, MAP17 ifadə səviyyələrinin orta və ya yüksək səviyyədə olan şişləri olan xəstələrdə (normallaşdırılmış xal) MAP17-nin aşağı və ya sıfır səviyyələri olan şişləri olan xəstələrlə müqayisədə sağ qalma yaxşılaşmışdır (Şəkil 5A). MAP17-nin həddindən artıq ifadəsi xəstənin sağ qalmasına aydın təsir göstərdi (Şəkil 5B).

A) MAP17-nin sisplatin və radioterapiya ilə müalicə olunan uşaqlıq boynu şişi olan xəstələrdə sağ qalmaq üçün yaxşı proqnostik marker ola biləcəyini göstərən Kaplan-Meier əyrisi göstərilir. B) Təsir funksiyası sisplatin və radioterapiya ilə müalicə olunan uşaqlıq boynu şişi xəstələrinin sağ qalmasında yüksək MAP17 səviyyələrinə malik olmanın yığılmış təsirini göstərir. C) Sisplatin və radioterapiya ilə müalicə olunan uşaqlıq boynu şişi olan xəstələrdə SGLT1 səviyyələrinin sağ qalma üçün yaxşı proqnostik marker ola biləcəyini göstərən Kaplan-Meier əyrisi göstərilir. D) MAP17 və SGLT1 səviyyələrinin yüksək səviyyələrinin sisplatin və radioterapiya ilə müalicə olunan uşaqlıq boynu şişi olan xəstələrdə sağ qalmaq üçün yaxşı proqnostik markerlər olduğunu göstərən Kaplan-Meier əyrisi göstərilir.

Buna görə də, MAP17-nin yüksək səviyyəsi yaxşılaşmış sağ qalma ilə əlaqələndirilir və radioterapiya və sisplatin ilə müalicə olunan uşaqlıq boynu xərçəngində yaxşı proqnostik faktordur.

Digər tərəfdən, əvvəlki tədqiqatlar göstərmişdir ki, SGLT1 membran nəqlinin inhibəsi də MAP17-dən asılı ROS artımını və yayılmasını maneə törədir [5]. SGLT1 ifadəsi MAP17 ilə əlaqəli olduğundan, eyni şiş kohortunda SGLT1 varlığının müstəqil olaraq və MAP17 ilə əlaqəli proqnozla əlaqəli olub olmadığını öyrəndik.

MAP17 kimi, SGLT1 səviyyələri xəstənin sağ qalması ilə aydın korrelyasiya göstərdi. Şişləri orta və ya yüksək səviyyələrdə SGLT1 (normallaşdırılmış səviyyələr) ifadə edən xəstələr, aşağı SGLT1 səviyyələri olan xəstələrə nisbətən sağ qalma müddətini yaxşılaşdırdılar (Şəkil 5C). Bununla belə, hər iki markerin birləşməsi xəstənin sağ qalmasına aydın təsir göstərdi. Yüksək MAP17 səviyyələri (𾄀) və yüksək SGLT1 səviyyələrinin (�) birləşməsini nümayiş etdirərkən, xəstələr tam sağ qalma (pπ.001 Şəkil 5D), aşağı MAP17 və ya aşağı SGLT1 səviyyələri və ya hər ikisi olan xəstələrdə göstərdilər. , ən pis proqnoza malik idi (Şəkil 5D).


Metodlar

Hüceyrə mədəniyyəti

TIG-3 hüceyrələri 5,20,30 Yapon Xərçəng Tədqiqat Resursları Bankından (JCRB) əldə edilmişdir və siçan əsas HSCs əvvəllər 11 təsvir edildiyi kimi siçan qaraciyərindən təcrid edilmişdir. Bu hüceyrələr 10% fetal iribuynuzlu zərdab (FBS) ilə əlavə edilmiş Dulbecco's Modified Eagle's (DME) mühitində becərildi. HRPE hüceyrələri (Lonza Inc.) və HEK hüceyrələri (Cell Applications Inc.) istehsalçının təlimatlarına uyğun olaraq becərildi. Erkən keçid TIG-3 hüceyrələrindən (40-dan az populyasiyanın ikiqat artması) böyüyən hüceyrələr kimi və gec keçid TIG-3 hüceyrələrindən (70-dən çox populyasiyanın ikiqat artması) replikativ qocalma hüceyrələri kimi istifadə edildi. Retrovirus infeksiyası üçün TIG-3 hüceyrələri ekotropik retroviruslar 5 tərəfindən infeksiyaya həssas olmuşdur. Daha sonra hüceyrələr Ras V12 və ya TREX1 (pBabe-puro-da), DNase2 (pMarX-puro-da) cDNA və ya shRNA-nı kodlayan rekombinant retroviruslarla yoluxmuşdur. DP1 (pRetrosuper-puro ilə) 39 . Puromisin seçimi ilə yoluxmuş hüceyrələri seçdikdən sonra, infeksiyadan 7 gün sonra dərmana davamlı hüceyrələrin hovuzları təhlil edildi. Bəzi təcrübələrdə hüceyrələr 12 saat ərzində MG132 (Calbiochem) və ya rekombinant IFN-β (PBL Assay Science) ilə müalicə olundu. BrdU birləşmə analizində hüceyrələr 16 saat 39 üçün 20μM BrdU (BD Pharmingen) ilə müalicə edildi. HSC-lər hüceyrə qocalmasına səbəb olmaq üçün 6 gün ərzində deoksixolik turşu (Wako) ilə inkubasiya edildi və sonra məhsul yığımından 6 saat əvvəl LTA (InvivoGen) 43. Biz toxuma mədəniyyəti hüceyrələrimizdə mikoplazma ilə çirklənmənin olmadığını təsdiq etdik.

Sitozol DNT fraksiyalarının izolyasiyası

Sitoplazmik DNT əvvəllər bildirildiyi kimi bir metodun dəyişdirilməsi ilə hazırlanmışdır 64 . Qısaca olaraq, hüceyrələr mikrosentrifuqada 1 dəqiqə sentrifuqa edildi, sonra 0,3 M saxaroza tamponunda dayandırıldı və pipetləmə ilə homojenləşdirildi. Homogenat eyni miqdarda 1,5 M saxaroza tamponunun üzərinə örtülmüş və 18,506 × temperaturda sentrifuqa edilmişdir.g 10 dəq. Sitoplazmik DNT 0,4 mq/ml Proteinaz K (Wako) müalicəsi, fenol/xloroformun çıxarılması və daşıyıcı (Dr. GenTLE® Precipitation Carrier, Takara Bio Inc.) ilə etanol çöküntüsü ilə təmizləndi. Nüvə DNT-nin miqdarı müxtəlif xromosomlar (insan xromosomu 3, 10 və 13 və ya siçan xromosomu 1, 2 və 5) üçün nəzərdə tutulmuş üç müxtəlif primer dəstindən istifadə edərək kəmiyyət Real-Time PCR ilə müəyyən edilmişdir 30 .

Flüoresan mikroskopik analiz

Lamin B1 (Abcam, ab16048, 1:1000 seyreltmə), dsDNA marker (Santa Cruz, sc-58749, 1:250 seyreltmə), γ-H2AX (Millipore, 05-636, 1:20) qarşı antikorlardan istifadə etməklə immunofluoressensiya analizi aparılıb. ), fosfor-(Ser/Thr) ATM/ATR substratı (Cell Signaling Technology, 2851, 1:500 seyreltmə), p16 (Santa Cruz, sc-468, 1:500 qatılma), p21 (Abcam, ab2961, 1:50 seyreltmə), 53BP1 (Santa Cruz, sc-22760 Abcam, ab36823, 1:500 seyreltmə), IL-1β (Proteintech, 16806-1-AP, 1:300 seyreltmə), IL-6 (Abcam, ab6672, 1:400 seyreltmə), STING (Abcam, ab92605, 1:200 seyreltmə), fosfo-TBK1 (Bioss antikorları, bs-3440R, 1:100 qatılma), IFN-β (Abcam, ab140211, 1:100 seyreltmə), DNase2 (B) antikorları , bs-7652, 1:100 seyreltmə), TREX1 (Novus Biologicals, NBP1-76977, 1:100 seyreltmə) və Desmin (Thermo Fisher Scientific, MA5-13259, 1:100 seyreltmə). DNT DAPI (Dojindo) ilə boyandı. Flüoressensiya şəkilləri immunofluoressensiya mikroskopundan (Carl Zeiss AG) istifadə edilərək müşahidə edildi və fotoşəkili çəkildi 11,43 .

RNAi istehsalçının təlimatlarına uyğun olaraq Lipofectamine™ RNAiMAX transfeksiya reagentindən (Thermo Fisher Scientific) istifadə edərək siRNA oliqoslarının transfeksiyası ilə həyata keçirilib. siRNA oliqoslarının ardıcıllığı aşağıdakı kimi idi. cQAZ: GGAAGGAAAAUGGUUUCCAA 35 . DNaz2: CAAGAACCCUGGAACAGCAGCAUCA 36 . TREX1: CCAAGACCAUCUGCUGUCA 37 . Sting mRNA ardıcıllığını hədəfləmək üçün ON-TARGETplus siRNAs və qeyri-hədəf nəzarət siRNA istifadə edilmişdir (Dharmacon) 30 . Knockdown effektivliyi kəmiyyət real vaxt PCR ilə təsdiq edilmişdir.

Plazmidlər

DNase2-nin cDNA-ları ilə işarələnmiş epitop pMarX-a klonlaşdırıldı - puro retrovirus vektoru 5,20,30 və ya TREX1 pBabe-puro retrovirus vektoruna klonlaşdırıldı. Bayraq etiketli cDNA-nı sadələşdirmək üçün aşağıdakı primerlərdən istifadə edilmişdir: DNaz2, 5′-ACCGGATCCACCGCCATGGACTACAAAGACGATGACGACAAGATCCCGCTGCTGCTGCTGGC-3′ (irəli) və 5′-ACCCTCGAGTTAGATCTTATAAGCTCTGCTG-3′ (geri) və TREX1, 5′- ACCGGATCCACCGCCATGGACTACAAAGACGATGACGACAAGCAGACCCTCATCTTTTTC-3′ (irəli) və 5′-ACCGAATTCCTACTCCCCAGGTGTGGCCAG-3′ (geri). Bütün cDNA-lar BigDye Terminator v3.1 Cycle Sequencing Kit (Tətbiqi Biosistemlər) istifadə edilməklə Genetic Analyzer 3130 (Tətbiqi Biosistemlər) üzərində ardıcıllıqla sıralanıb.

Kəmiyyət real vaxt PCR

Ümumi RNT mədəni hüceyrələrdən mirVana dəsti (Thermo Fisher Scientific) istifadə edərək çıxarıldı və sonra PrimeScript RT reagent dəsti (Takara Bio Inc.) istifadə edərək tərs transkripsiyaya məruz qaldı. Kəmiyyət real vaxt rejimində RT-PCR SYBR Premix Ex Taq (Takara Bio Inc.) 20,30 istifadə edərək StepOnePlus PCR sistemində (Applied Biosystems) həyata keçirildi. PCR primer ardıcıllıqları Əlavə Cədvəl 1-də verilmişdir. Vasitələr ± s.d. üç müstəqil təcrübə göstərilir.

Qərb ləkəsi

Vestern blot analizi üçün hüceyrələr və ya siçan qaraciyəri toxumaları lizis tamponunda (50 mM Hepes, pH 7.5, 150 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 10% qliserin, 0.1% Tween20, β-sg-li) parçalandı. 1% Proteaz inhibitor kokteyli (Nacalai Tesque) 5,20,30 . Zülal konsentrasiyası DC Protein Təhlili (Bio-Rad) istifadə edərək müəyyən edildi və zülallar SDS-PAGE ilə ayrıldı və PVDF membranına (EMD Millipore) köçürüldü. 5% südlə bloklandıqdan sonra membranlar aşağıdakı kimi əsas antikorlarla yoxlandı: anti-H-Ras (Santa Cruz, sc-29, 1:500 seyreltmə), c-Fos (Santa Cruz, sc-52, 1:500 seyreltmə). ), p16 (IBL, 11104, 1:250 qatılma), fosfo-RB (Cell Signaling Technology, 9308, 1:500 seyreltmə), RB (Santa Cruz, sc-102, 1:500 seyreltmə), STING (Cell Signaling Technology) , 13647, 1:250 qatılma), cGAS (Cell Signaling Technology, 15102, 1:250 qatılma), DNase2 (ProSci, 2059, 1:500 qatılma), TREX1 (Cell Signaling Technology, 12215, 1:250 qatılma), La B1 (Santa Cruz, sc-6217, 1:500 seyreltmə), fosfo-TBK1 (Ser172) (Cell Signaling Technology, 5483, 1:250 qatılma), TBK1 (Cell Signaling Technology, 3013, 1:250 seyreltmə), fosfo- IRF3 (Ser396) (Cell Signaling Technology, 4947, 1:250 seyreltmə), IRF3 (Cell Signaling Technology, 11904, 1:250 qatılma), phospho-Erk1/2 (Ser396) (Cell Signaling Technology, 4376, 1:100 qatılma) ), Erk1/2 (Cell Signaling Technology, 4695, 1:1000 qatılma), fosfo-NFκB p65 (Ser536) (Hüceyrə Siqnal Texnologiyası, 3031, 1:250 qatılma), G9a (Cell Signaling Technology, 3306, 1:200 qatılma), NFκB p65 (Santa Cruz, sc-8008, 1:500 qatılma), DP1 (ICRF), p62 (MBL, PM045, 1:500 seyreltmə), LC3 (MBL, M152-3, 1:500 seyreltmə) və α-tubulin (SIGMA, T9026, 1:2000 seyreltmə). Membranlar ikincil antikorlarla (GE Healthcare) inkubasiya edilib və SuperSignal West Femto Maksimum Həssaslıq Substratı (Thermo Fisher Scientific) ilə vizuallaşdırılıb.

Hüceyrədaxili ROS səviyyələrinin ölçülməsi

Hüceyrədaxili ROS generasiya səviyyələrini qiymətləndirmək üçün hüceyrələr 20 dəqiqə ərzində 37 °C-də 20 μM DCF-DA (Calbiochem) ilə inkubasiya edilmişdir. Oksidləşmiş DCF (488 nm) və emissiya (525 nm) üçün pik həyəcan dalğası Wallac ARVO 1420 Multilabel sayğacından (PerkinElmer Co., Ltd.) 5,65 istifadə edərək ölçüldü.

Xromatin immunoprecipitation (ChIP) analizi

CHIP analizi istehsalçının göstərişinə uyğun olaraq Dynabeads® Protein G (Thermo Fisher Scientific, 10004D) istifadə edərək aparılmışdır. Briefly, chromatin was extracted from TIG-3 cells, cross-linked with formaldehyde (final concentration 1%), and sonicated (Bioruptor, Cosmo Bio Co. Ltd.: 10 cycles of 30 s on/30 s off, on the highest setting) to generate DNA fragments 20 . The immunoprecipitation of cross-linked chromatin was conducted with anti-human E2F1 (Santa Cruz, sc-193X, 1:1000 dilution), anti-human E2F3 (Santa Cruz, sc-878X, 1:1000 dilution) and rabbit IgG (Cell Signaling Technology, 2729, 1:1000 dilution) as a negative control 66 . After immunoprecipitation, DNA was extracted using the QIAquick PCR purification kit (Qiagen) and an aliquot was amplified by real time qPCR using following primers flanking the putative human E2F-binding site position at –184 to −178 bp of human DNase2 gene promoter: 5′-CAGACTCAGCGTTGCCTTTT-3′ and 5′-CGAGGGTACAGACTCCTCCC-3′ or primers flanking the putative human E2F-binding site position at −128 to −120 of human DNase2 gene promoter: 5′-GAGGAGTCTGTACCCTCGTG-3′ and 5′-TGGCGCCTTTCACTTCCCTA-3′ or primers flanking the putative human E2F-binding site position at −573 to −566 of human TREX1 gene promoter: 5′-CAGGCCTAAACCAGGAAAGC-3′ and 5′-TCTTACACACTGCTGGGAGC-3′ or primers flanking the putative human E2F-binding site position at −260 to −252 and −232 to −224 of human TREX1 gene promoter: 5′-ATGGTGGTGAGAGGGACAGAC-3′ and 5′-AGTAGTGACTCGGCTGCACA-3′ 66 .

Animal experiments

C57/BL6 mice were purchased from CLEA Japan Inc. The sting −/− mice (C57/BL6) were kindly provided by Dr. Keiyo Takubo (National Center for Global Health and Medicine) 34 . 7,12-dimethylbenz [a]anthracene (SIGMA) treatments were performed as described previously 11,43 . In brief, 50 μl of a solution of 0.5% DMBA in acetone was applied to the dorsal surface of mice on postnatal days 4, 5. After this application, mother mice with pups were fed ND (NOSAN, Labo MR) or high-fat diet (Research Diet Inc., D12492). At the age of 4 weeks old, pups were weaned and continuously fed either ND or HFD until euthanized. Male mice with more than 45 g weight at the age of 30 weeks old were used as obese mice for all the experiments. Evaluation of tumor number and size was determined by counting the number of visible tumors and measuring the size of the tumor. The sample size used in this study was determined based on the expense of data collection, and the requirement for sufficient statistical significance. Randomisation and blinding were not used in this study. All animal care was performed according to the protocols approved by the Committee for the Use and Care of Experimental Animals of the Japanese Foundation for Cancer Research.

Statistik təhlil

Statistical significance was determined using a Student’s t-test and one-way ANOVA. P-values less than 0.05 were considered significant.

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.


Molecular Imaging of Gene Therapy for Neurogenetic Diseases

John H. Wolfe , . Charles H. Vite , in Gene Therapy of the Central Nervous System , 2006

IV. GENE TRANSFER IN THE CNS

Reporter genes , such as β-galactosidase and luciferase, have played vital roles in the understanding of the molecular mechanisms of gene expression. The concept of a reporter gene provides a much simpler method for genetic analysis than the conventional hybridization techniques. A defined nucleotide sequence is introduced into a cell, whose expression results in a well-defined protein, which can be measured using the reporter probe. These reporter genes also have provided important information in the design of delivery systems in gene transfer into somatic tissue. However, monitoring these reporter systems in living animals requires either highly invasive tissue biopsy or post-mortem analysis of the animal under study. Optical imaging techniques, using GFP and luciferase, have been developed to provide non-invasive monitoring of gene expression in vivo, although these techniques are limited to either organisms which are transparent to light, or, in larger animals, to detection of gene expression near the surface of the skin ( Bhaumik and Gambhir, 2002 ). In addition, accurate quantification of the emitted light is difficult due to absorption of the light by the animal. Detection in the CNS is further compromised by the inability of light to penetrate the skull. Therefore, techniques are required which enable repetitive, non-invasive, quantitative imaging of reporter genes in living animals, which should be equally applicable to human studies.


Cell free expression systems

In cell-free expression systems, proteins are assembled in vitro using purified components of the transcription and translation machinery. These include ribosomes, RNA polymerase, tRNAs, ribonucleotides and amino acids. Cell-free expression systems are ideal for fast assembly of more than one protein in one reaction. A major advantage of these systems system is their ability to assemble proteins with labelled or modified amino acids that are useful in different downstream applications. Cell-free expression systems however, are expensive and very technically challenging to use.

Alyssa D. Cecchetelli is a Scientist at Addgene. She received her PhD from Northeastern University and is particularly interested in cell signaling and communication. She loves being able to help the scientific community share plasmids.


Engineering new vector for Metagenomics

The term ‘metagenome’ was introduced in 1998 by Handelsman etਊl. (1998), and since its first use, this methodology became a powerful tool for analysing composite genomes of microbial communities and their potential products for novel biotechnological and pharmaceutical applications. In addition, the use of functional metagenomics has been shown to be effective for identifying new enzymes, antibiotics and other molecules derived from a variety of environments without the need for isolating and cultivating microorganisms in the laboratory (Courtois etਊl., 2003 Ferrer etਊl., 2012 Pozo etਊl., 2012 Thompson etਊl., 2013 Yang etਊl., 2016).

Despite the great potential of metagenomic approaches, some barriers have limited the discovery of new genes. The probability of identifying a particular gene depends on multiple factors that are intrinsically linked: the host‐vector system, the size of the gene, the recovered metagenomic DNA abundance, the screening method and the efficiency of heterologous expression of the gene in a substitute host (the most frequently used is E.਌oli Gabor etਊl., 2004 Villegas and Kropinski, 2008 Uchiyama and Miyazaki, 2009). According to Gabor etਊl. (2004), only 40% of enzymatic activities can be recovered from random cloning in E.਌oli. This might be due to a number of factors that exist in heterologous genes that differ from those used by E.਌oli, preventing the host cell expression machinery from recognizing these signals, such as differences in translation initiation codons in E.਌oli, the preferred translation initiation codon is AUG, whereas in some organisms, GUG and UUG are preferred (Villegas and Kropinski, 2008). In addition, differences in codon usage, promoters for transcription and ribosomal binding sites may lead to no detectable expression of the target genes. Furthermore, incorrect protein folding, toxicity of the gene product and an inability to secrete the gene product may be obstacles to identifying new genes in functional screenings (Ekkers etਊl., 2012). Choosing an appropriate vector for constructing a metagenomic library depends on various factors, such as the DNA size of the expected target compound of interest, whether a small‐ or large‐insert library is considered, the hosts that will be used in the screenings, as well as the screening tests (Ekkers etਊl., 2012).

Plasmid vectors are usually chosen to generate small‐insert metagenomic libraries (<ꀐ kb average insert size), becoming an appropriate tool to identify single gene products encoded by small DNA sequences, such as enzymes and antibiotic resistance genes (Guazzaroni etਊl., 2010). Regulating the expression level of cloned genes is possible by using inducible promoters upstream of the DNA insertion site or by choosing a suitable plasmid copy number, avoiding high expression rates of toxic genes or inclusion body formation of target proteins, and low expression rates that could prevent detection in functional screenings (Hudson, 2001). Large‐insert metagenomic libraries are usually generated using cosmid or fosmid vectors and provide a more efficient method to identify complete operons and biosynthetic clusters of genes. Cosmids are vectors capable of carrying DNA inserts of about 30� kb in size that contain the cos site of λ phage for packing inserted metagenomic DNA in λ phages (Hohn and Collins, 1980). This type of vector can replicate in suitable hosts since it carries a proper origin of replication, but the lack of a copy number control mechanism usually decreases cosmid stability (Haley, 1988 Cheng etਊl., 2017). Fosmid vectors are similar to cosmids, but they use an E.਌oli F�tor origin of replication, making the fosmid copy number highly regulated to 1 or 2 copies in the cell and replication is restricted to E.਌oli (Kim etਊl., 1992 Fig.  6 ). This fact could avoid gene toxicity interference in metagenomic tests also, fosmids are capable of carrying large‐insert DNA sizes of about 40� kb (Santana‐pereira and Liles, 2017). One example of a regularly used fosmid is the pCC1FOS (Epicentre, Madison, Wisconsin), a commercial cloning vector that allows copy number to be controlled through the CopyControl Cloning System. The pCC1FOS fosmid was first introduced in metagenomic studies in 2004 in a proof‐of𠄌oncept report using a (meta)genomic library from Collimonas fungivorans (Leveau etਊl., 2004). Yet, for even larger fragments, bacterial artificial chromosomes (BACs) are used. These vectors are modified plasmids that contain an origin of replication derived from the E.਌oli F�tor and can stably maintain and replicate inserts ranging from 100 kb to 220 kb, as well as inserts of more than 300 kb, and are usually used in E.਌oli (Shizuya etਊl., 1992 Beja etਊl., 2000).

Tools based on minimal fosmids for cloning large DNA fragments. Fosmids are plasmid vectors based on the mini𠄏 origin of replication that harbour, in addition to MCS and Ab R , a cos site for DNA packing in lambda phages. This allows the cloning of very long DNA fragments (up to 50 kb) by ligation and packing into empty lambda phages. The packed DNA is then used to infect E.਌oli host strains, resulting in the construction of genomic or metagenomic DNA libraries.

Functional metagenomics: using broad‐host‐range vectors to enhance the probability of identifying target genes

An alternative to overcoming the limitations of metagenomic approaches and to enhance the discovery of new biocatalysts and molecules of interest is the use of alternative host organisms (besides E.਌oli) to perform the functional screening tests. For this, shuttle vectors and broad‐host‐range vectors have been mostly used. This type of vector (see Fig.  2 ) has been largely used in functional metagenomics, increasing the efficacy of identifying target activities (Table  2 ). Vectors used in metagenomic screening in alternative hosts contain a single broad‐host origin oriV or a multiple oriV, which permit its replication in E.਌oli and other hosts, or integrative�sed systems that allow integration of the metagenomic DNA into the chromosome of the screening host (Cheng etਊl., 2017).

Table 2

Multiple host‐vector systems for metagenomic DNA cloning and functional screening

A variety of studies have found that using diverse hosts when screening metagenomics libraries can increase the discovery rate of active clones (Table  2 ). Metagenomic libraries are often directly constructed in E.਌oli due to the higher number of transformants obtained when compared with the low rate of transformants achieved in other alternative hosts. Thus, to perform screenings in alternative hosts, a common method is to use shuttle or broad‐host‐range vectors for library construction in E.਌oli and then to transfer and screening these libraries in other host organisms. For instance, Damon etਊl. (2011) used the pFL61 yeast‐E.਌oli plasmid shuttle vector to construct a small‐insert library from soil eukaryote DNA using a metatranscriptomic approach. Performing functional complementation of a yeast mutant defective in a di/tripeptide, they identified a novel family of oligopeptide transporters expressed by fungi. Also, the pMycoFos fosmid shuttle vector has been used to allow transfer of a butane‐oxidizing strain Nocardioides CF8 DNA from E.਌oli EPI300 to Mycobacterium spp (Ly etਊl., 2011). In addition, McMahon etਊl. (2012) developed a shuttle cosmid vector for E.਌oliStreptomyces lividans and used an optimized S. lividans strain for screening. In another study, Martinez etਊl. (2004) used a pSrps14 shuttle BAC vector and showed different functions among E.਌oli, P. putidaS. lividans expressing heterologous metagenomic genes.

On the other hand, several studies using broad‐host‐range vectors also have been reported in metagenomics screenings. For instance, Craig etਊl. (2010) described the construction of a cosmid library from soil samples in a broad‐host‐range vector (pJWC1), which was screened for antibacterial activity, altered pigmentation and altered colony morphology in six different Proteobacteria: A. tumefaciens, Burkholderia graminis, Caulobacter vibrioides, E.਌oli, P. putidaRalstonia metallidurans. The screenings in E.਌oli identified two clones displaying antibiosis activity, but no clones displayed either pigmentation or morphology alterations, and the screenings in other hosts identifying a number of other target characteristics. This indicates that the same metagenomic library can yield different results depending on the expression host used (Craig etਊl., 2010).

Moreover, Nagayama etਊl. (2015) constructed a metagenomic library from artificially polluted soil samples using a broad‐host‐range vector (pKS13S) based on the RK2 origin of replication, showing different success rate when analysed the library in P. putida, E.਌oliB. multivorans. Leis etਊl. (2015) used a T. thermophilus/E.਌oli shuttle fosmid vector (pCT3FK Angelov etਊl., 2009) to generate a large‐insert metagenomic library and performed screenings for lipolytic activities in E.਌oliT. thermophilus HB2 (using a multiple clean deletion mutant T. thermophilus) which lacks several characterized extracellular and putative esterase𠄎ncoding genes. They found two thermostableਊ/b𠄏old hydrolase enzymes with high amino acid sequence similarity to already characterized enzymes in E.਌oli screening. In contrast, they found six fosmids that conferred lipolytic activities to T. thermophilus.

Additionally, in the last years, diverse efforts have been made to produce new vectors displaying relevant characteristics, and synthetic biology has become a powerful tool for this (Guazzaroni etਊl., 2015 Alves etਊl., 2017b). For instance, Bryksin and Matsumura (2010) described an engineered broad‐host‐range origin of replication (pWV01 RCR) used to create the high copy number vector pBAV1K‐T5, which can replicate in different Gram‐negative and Gram‐positive bacterial species. In another study, Terrón‐González etਊl. (2013) developed vectors and specialized E.਌oli strains as improved metagenomic DNA heterologous expression systems, which was based on the T7 RNA‐polymerase and the lambda phage transcription anti‐termination protein N (Terrón‐González etਊl., 2013). However, the approaches developed are limited to E.਌oli as a host. Another alternative to overcome the low expression of heterologous genes in functional metagenomics was proposed by Gaida etਊl. (2015). Authors created E.਌oli strains expressing heterologous sigma factors that are able to recognize heterologous promoters from metagenomic and genomic DNA libraries. The study showed that RpoD from Lactobacillus plantarum can initiate transcription from all sources of tested DNA. Moreover, the use of modular vectors, such as the pSEVA vectors listed above (Silva‐Rocha etਊl., 2013), confers diverse benefits for constructing metagenomic libraries. Yet, besides all the advantageous characteristics already mentioned, these vectors only allow the cloning of small metagenomic DNA fragments (up to 10 kb) and are not suitable for constructing large‐insert DNA libraries, which are essential for functional recovery of complete biosynthetic pathways involved in producing bioactive compounds (as in the case of non‐ribosomal peptide synthetases, polyketide synthases and terpene synthases genes, among others). Therefore, since metagenomics is a rising field, innovations in tools to facilitate manipulation and promote the discovery of functional genes in environmental samples are still needed.


Nəticələr

Creation of mammalian cell lines that express high levels of recombinant protein and maintain stable production levels over several months of cultivation is still a very time-consuming and labour-intensive process. Introduction of EEF1A-based vectors superseding CMV-based types has enabled smaller numbers of cell clones to be screened and evaluated by increasing the mean level of target protein expression. We have modified existing EEF1A-based vectors by linking the DHFR selection marker and target gene in the bicistronic RNA, shortening the overall plasmid size, and adding an EBVTR element. The presence of an EBVTR element in the resulting p1.1 vector increased the stable transfection rate by a factor of 24, and increased the target protein expression level by eight-fold using a single round of MTX-driven target gene amplification. Two consecutive rounds of MTX-driven amplification, performed for suspension culture, resulted in the polyclonal cell population with the eGFP expression level comprising 9.0% of the total cytoplasmic protein. Compatible vectors bearing antibiotic resistance markers instead of the DHFR gene were created and found to be approximately equal to the DHFR-based vector for generation of highly productive cell populations. We found that the EEF1A-based vector, p1.2-Hygro, containing the hygromycin selection marker, allowed direct generation of a polyclonal cell population that was nearly devoid of eGFP-negative cells, while eGFP expression comprised up to 8.9% of the total cytoplasmic protein. This level of eGFP expression corresponds to only 30 copies of the target gene per single haploid genome, in contrast to CMV-based vectors that have thousands of copies per genome in highly productive lines [19]. The set of vectors developed herein allows generation of highly productive and stable cell clones with limited effort and such vectors may be employed to create cell lines for production of biosimilar pharmaceuticals. p1.1 or p1.2-based plasmids, stably transfected into polyclonal cell populations expressing large quantities of target proteins at a scale of 4–6*10 7 cells, can be generated in less than one month by simple periodic passage of a culture from a shaking flask. This technique may be useful for obtaining milligram quantities of mutants of a protein of interest or for evaluation of several mAb clones. Cells from these polyclonal populations may be also used for direct development of industrially applicable clonal cell lines by limiting dilution.


Videoya baxın: الجمال مهم يرجى الانضمام إلينا 5278 (Iyul 2022).


Şərhlər:

  1. Meldrik

    Çox maraqlı mövzumda. Bunu burada və ya axşam saatlarında müzakirə etməyinizi təklif edirəm.

  2. Daire

    Üzr istəyirəm, amma bu mənim yoluma gəlmir. Başqa variantlar varmı?

  3. Carolus

    Tez belə bir uyğunsuz cavabla gəldiniz?

  4. Darrance

    Yazının uğurlu olması ilə razıyam. Yaxşı iş!

  5. Cadwallon

    This sentence is simply incomparable :), I really like)))

  6. Yoktilar

    cavab)))

  7. Faenris

    Sayt sadəcə gözəldir, onu tanıdığım hər kəsə tövsiyə edirəm!



Mesaj yazmaq