Məlumat

Bərk siçan (C57BL/6) WT primerləri

Bərk siçan (C57BL/6) WT primerləri


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mən WT siçanlarında (C57BL/6) mənə bir zolaq verən yaxşı bir cüt (yaxud daha yaxşısı, cütlüklər kitabxanası) əldə etməyə çalışıram. Belə bir şeyi haradan tapa biləcəyimi bilirsinizmi?

Alternativ olaraq, yüksək dərəcədə qorunan bölgələr üçün özüm bir neçə primer dəsti hazırlamağı düşündüm. Ancaq bu, bir az təxmin işidir (hansı bölgələr, hansı cütlərdənprimer3mənim üçün hesablayacaq və s.).

Belə ki:

  • Belə bir verilənlər bazasını haradan tapa biləcəyinizi bilirsinizmi?
  • Yoxdursa, onu özüm yaratmağa başlamağa kömək edə bilərsinizmi? Sizcə, bu məqsəd üçün hansı konkret bölgələr xüsusilə yaxşı olardı?

Qısa amplikonlu (~ 50bp) iki GAPDH primerinə qərar verdim:

>gapdh_rv3  GAGACCTGAATGCTGCTTCC >gapdh_fw3  CTCCATTTCCCCTGTTCTCC

Onlar burada göründüyü kimi ardıcıl və yaxşı nəzarət təmin edir (aşağı zolaqlar):


Giriş seçimləri

1 il ərzində jurnala tam giriş əldə edin

Bütün qiymətlər NET qiymətləridir.
ƏDV daha sonra ödəniş zamanı əlavə olunacaq.
Vergi hesablanması yoxlama zamanı yekunlaşacaq.

ReadCube-da vaxt məhdud və ya tam məqaləyə giriş əldə edin.

Bütün qiymətlər NET qiymətləridir.


Akinsete JA, Ion G, Witte TR, Hardman WE (2012) C3(1) Tag siçanlarında yüksək omeqa-3 yağ turşusu pəhrizinin istehlakı prostat şişlərinin əmələ gəlməsini basdırmışdır. Kanserogenez 33(1):140-148. https://doi.org/10.1093/carcin/bgr238

Akram M, İqbal M, Daniyal M, Khan AU (2017) Döş xərçəngi haqqında məlumatlılıq və cari bilik. Biol Res 50(1):33. https://doi.org/10.1186/s40659-017-0140-9

Almind K, Kulkarni RN, Lannon SM, Kahn CR (2003) Genetik insulin müqaviməti olan siçanlarda insulin və leptinə bağlı interaktiv lokusların müəyyən edilməsi. Diabet 52(6):1535-1543. https://doi.org/10.2337/diabetes.52.6.1535

Aprelikova O, Tomlinson CC, Hoenerhoff M, Hixon JA, Durum SK, Qiu TH, He S, Burkett S, Liu ZY, Swanson SM, Green JE (2016) Ağciyərlə bazal döş xərçənginin immunokompetent transplantasiya modelinin inkişafı və preklinik tətbiqi , qaraciyər və beyin metastazları. PLoS ONE 11(5):e0155262. https://doi.org/10.1371/journal.pone.0155262

Araujo MR, Campos LC, Damasceno KA, Gamba CO, Ferreira E, Cassali GD (2016) HER-2, EGFR, Cox-2 və Ki67 itlərin süd vəzi karsinomalarının limfa düyünlərinin metastazında ifadəsi: klinik-patoloji parametrlər və ümumi sağ qalma ilə əlaqə . Res Vet Sci 106:121–130. https://doi.org/10.1016/j.rvsc.2016.03.020

Armstrong NJ, Brodnicki TC, Speed ​​TP (2006) Boşluğa diqqət yetirin: inbred siçan suşları üçün marker yardımlı yetişdirmə strategiyalarının təhlili. Mamm Genom 17(4):273-287. https://doi.org/10.1007/s00335-005-0123-y

Asada N, Kunisaki Y, Pierce H, Wang Z, Fernandez NF, Birbrair A, Ma'ayan A, Frenette PS (2017) Perivascular hematopoietik kök hüceyrə yuvalarının diferensial sitokin töhfələri. Nat Cell Biol. https://doi.org/10.1038/ncb3475

Baak JP, van Diest PJ, Voorhorst FJ, van der Wall E, Beex LV, Vermorken JB, Janssen EA (2005) 55 yaşdan kiçik limfa node-mənfi döş xərçəngi xəstələrində mitotik aktivlik indeksinin müstəqil proqnostik dəyərinin perspektivli çoxmərkəzli təsdiqi. illər. J Clin Oncol 23(25):5993–6001. https://doi.org/10.1200/JCO.2005.05.511

Balkwill FR, Capasso M, Hagemann T (2012) Bir baxışda şiş mikromühiti. J Cell Sci 125(Pt 23):5591–5596. https://doi.org/10.1242/jcs.116392

Birbrair A, Wang ZM, Messi ML, Enikolopov GN, Delbono O (2011) Nestin-GFP transgeni yetkin skelet əzələsində sinir prekursor hüceyrələrini aşkar edir. PLoS ONE 6(2):e16816. https://doi.org/10.1371/journal.pone.0016816

Birbrair A, Zhang T, Wang ZM, Messi ML, Enikolopov GN, Mintz A, Delbono O (2013a) Skelet əzələlərinin bərpasında və yağ yığılmasında perisitlərin rolu. Kök Hüceyrələr İnkişaf edir 22(16):2298–2314. https://doi.org/10.1089/scd.2012.0647

Birbrair A, Zhang T, Wang ZM, Messi ML, Enikolopov GN, Mintz A, Delbono O (2013b) Skelet əzələsi sinir progenitor hüceyrələri NG2-glia xüsusiyyətlərini nümayiş etdirir. Exp Cell Res 319(1):45-63

Birbrair A, Zhang T, Wang ZM, Messi ML, Enikolopov GN, Mintz A, Delbono O (2013c) Skelet əzələsinin perisit alt tipləri diferensiasiya potensialına görə fərqlənir. Kök Hüceyrə Res 10(1):67-84

Birbrair A, Zhang T, Wang ZM, Messi ML, Mintz A, Delbono O (2013d) Tip-1 perisitlər yaşlı skelet əzələsində lifli toxuma çökməsində iştirak edirlər. Am J Physiol Cell Physiol 305(11):C1098-1113. https://doi.org/10.1152/ajpcell.00171.2013

Birbrair A, Zhang T, Files DC, Mannava S, Smith T, Wang ZM, Messi ML, Mintz A, Delbono O (2014a) Tip-1 perisitlər toxuma zədələndikdən sonra yığılır və orqandan asılı olaraq kollagen istehsal edir. Kök Hüceyrə Res Ther 5(6):122. https://doi.org/10.1186/scrt512

Birbrair A, Zhang T, Wang ZM, Messi ML, Olson JD, Mintz A, Delbono O (2014b) Tip-2 perisitlər normal və şiş angiogenezində iştirak edirlər. Am J Physiol Cell Physiol 307(1):C25-38. https://doi.org/10.1152/ajpcell.00084.2014

Birbrair A, Sattiraju A, Zhu D, Zulato G, Batista I, Nguyen VT, Messi ML, Solingapuram Sai KK, Marini FC, Delbono O, Mintz A (2017) Qlioblastomların müalicəsi üçün terapevtik daşıyıcı kimi yeni periferik törəmə sinir kimi kök hüceyrələr . Kök Hüceyrələr Transl Med 6(2):471-481. https://doi.org/10.5966/sctm.2016-0007

Boyd NF, Martin LJ, Bronskill M, Yaffe MJ, Duric N, Minkin S (2010) Döş toxumasının tərkibi və döş xərçənginə qarşı həssaslıq. J Natl Xərçəng İnstitutu 102 (16): 1224-1237. https://doi.org/10.1093/jnci/djq239

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A (2018) Qlobal xərçəng statistikası 2018: 185 ölkədə 36 xərçəng üçün dünya üzrə GLOBOCAN insidansı və ölüm göstəriciləri. CA Xərçəng J Clin 68(6):394–424. https://doi.org/10.3322/caac.21492

Bridges AE, Ramachandran S, Pathania R, Parwal U, Lester A, Rajpurohit P, Morera DS, Patel N, Singh N, Korkaya H, Manicassamy S, Prasad PD, Lokeshwar VB, Lokeshwar BL, Ganapathy V, Thangaraju M (2020) RAD51AP1 çatışmazlığı kök hüceyrələrin özünü yeniləməsini hədəf alaraq şiş böyüməsini azaldır. Xərçəng Res 80(18):3855–3866. https://doi.org/10.1158/0008-5472.CAN-19-3713

Brock A, Krause S, Li H, Kowalski M, Goldberg MS, Collins JJ, Ingber DE (2014) siRNA lipidoid nanohissəciklərinin intraduktal inyeksiya yolu ilə HoxA1-in susdurulması siçanlarda məmə şişinin inkişafının qarşısını alır. Sci Transl Med 6(217):217ra212

Bryant CD (2011) Siçan genetik tədqiqatlarında C57BL/6 alt suşlarının xeyir-duaları və lənətləri. Ann NY Acad Sci 1245:31-33. https://doi.org/10.1111/j.1749-6632.2011.06325.x

Burd CE, Sorrentino JA, Clark KS, Darr DB, Krishnamurthy J, Deal AM, Bardeesy N, Castrillon DH, Beach DH, Sharpless NE (2013) P16(INK4a)-lusiferaza modeli ilə in vivo şişlərin və qocalmanın monitorinqi. Hüceyrə 152(1-2):340-351. https://doi.org/10.1016/j.cell.2012.12.010

Xərçəng IAfRo (2019) ÜST-nin şişlərin təsnifatları Redaksiya Şurası, cild 2. ÜST-nin şiş seriyalarının təsnifatı, 5-ci nəşr

Caruso JA, Akli S, Pageon L, Hunt KK, Keyomarsi K (2015) Serin proteaz inhibitoru elafin neytrofil elastazanın mitogen təsirlərinə qarşı duraraq normal böyümə nəzarətini saxlayır. Onkogen 34(27):3556–3567. https://doi.org/10.1038/onc.2014.284

Cheung KJ, Gabrielson E, Werb Z, Ewald AJ (2013) Döş xərçəngində kollektiv invaziya konservləşdirilmiş bazal epiteliya proqramı tələb edir. Hüceyrə 155(7):1639–1651. https://doi.org/10.1016/j.cell.2013.11.029

Christenson JL, Butterfield KT, Spoelstra NS, Norris JD, Josan JS, Pollock JA, McDonnell DP, Katzenellenbogen BS, Katzenellenbogen JA, Richer JK (2017) MMTV-PyMT və əldə edilmiş Met-1 siçan süd vəzi şiş hüceyrələrinin öyrənilməsi üçün rol modelləri kimi üçlü mənfi döş xərçəngi inkişafında androgen reseptorunun. Horm Xərçəngi 8(2):69-77. https://doi.org/10.1007/s12672-017-0285-6

Coimbra-Campos LMC, Silva WN, Baltazar LM, Costa PAC, Prazeres PHDM, Picoli CC, Costa AC, Rocha BGS, Santos GSP, Oliveira FMS, Pinto MCX, Amorim JH, Azevedo VAC, Souza DG, Russo RC, Resende RR, Mintz A, Birbrair A (2021) Dolaşan Nestin-GFP+ hüceyrələri ağciyərlərdə Paracoccidioides brasiliensis patogenezində iştirak edir. Kök hüceyrə rəyləri və hesabatları. https://doi.org/10.1007/s12015-021-10181-3

Colpaert C, Vermeulen P, Jeuris W, van Beest P, Goovaerts G, Weyler J, Van Dam P, Dirix L, Van Marck E (2001) "Düyün mənfi" döş xərçəngi xəstələrində erkən uzaq residiv gizli aksiller tərəfindən proqnozlaşdırılmır. limfa düyünlərinin metastazları, lakin ilkin şişin xüsusiyyətləri ilə. J Pathol 193(4):442–449. https://doi.org/10.1002/path.829

Colpaert CG, Vermeulen PB, Fox SB, Harris AL, Dirix LY, Van Marck EA (2003) İnvaziv döş karsinomasında fibrotik fokusun olması karbonik anhidraz IX ifadəsi ilə əlaqələndirilir və hipoksiyanın və pis proqnozun göstəricisidir. Döş Xərçənginin Müalicəsi 81(2):137-147. https://doi.org/10.1023/A:1025702330207

Cox TR, Erler JT (2011) Hüceyrədənkənar matrisin yenidən qurulması və homeostazı: fibrotik xəstəliklər və xərçəng üçün təsirlər. Dis Model Mech 4(2):165–178. https://doi.org/10.1242/dmm.004077

Daniels SR, Liyasova M, Kales SC, Nau MM, Ryan PE, Green JE, Lipkowitz S (2019) Bərk şişlərdə funksiyanın itirilməsi Cbl-c mutasiyaları. PLoS ONE 14(7):e0219143. https://doi.org/10.1371/journal.pone.0219143

Davie SA, Maglione JE, Manner CK, Young D, Cardiff RD, MacLeod CL, Ellies LG (2007) FVB/NJ və C57Bl/6J gərginlik fonlarının induksiya olunan nitrik oksid sintaza çatışmazlığı olan siçanlarda məmə şişi fenotipinə təsiri. Transgen Res 16(2):193–201. https://doi.org/10.1007/s11248-006-9056-9

de Mingo PA, Gardner A, Hiebler S, Soliman H, Rugo HS, Krummel MF, Coussens LM, Ruffell B (2018) TIM-3 CD103 (+) dendritik hüceyrə funksiyasını və döş xərçəngində kemoterapiya cavabını tənzimləyir. Xərçəng Hüceyrəsi 33(1):60-74 e66. https://doi.org/10.1016/j.ccell.2017.11.019

de Visser KE, Eichten A, Coussens LM (2006) Xərçəngin inkişafı zamanı immun sisteminin paradoksal rolları. Nat Rev Xərçəng 6(1):24-37. https://doi.org/10.1038/nrc1782

Deeb KK, Michalowska AM, Yoon CY, Krummey SM, Hoenerhoff MJ, Kavanaugh C, Li MC, Demayo FJ, Linnoila I, Deng CX, Lee EY, Medina D, Shih JH, Green JE (2007) İnteqrasiya edilmiş SV40 T-nin identifikasiyası /t-antigen xərçəngi aqressiv insan döş, prostat və ağciyər karsinomalarında pis proqnozu. Xərçəng Res 67(17):8065–8080. https://doi.org/10.1158/0008-5472.CAN-07-1515

Dehdashti F, Wu N, Ma CX, Naughton MJ, Katzenellenbogen JA, Siegel BA (2021) Endokrin terapiyaya cavab verən döş xərçəngi progesteron reseptorları üçün PET-əsaslı estradiol sınaq testi Assosiasiyası. Nat Commun 12(1):733. https://doi.org/10.1038/s41467-020-20814-9

DeNardo DG, Coussens LM (2007) İltihab və döş xərçəngi. İmmunitet reaksiyasının balanslaşdırılması: döş xərçənginin inkişafı zamanı adaptiv və anadangəlmə immun hüceyrələri arasında qarşılıqlı əlaqə. Döş Xərçəngi Res 9(4):212. https://doi.org/10.1186/bcr1746

DeNardo DG, Barreto JB, Andreu P, Vasquez L, Tawfik D, Kolhatkar N, Coussens LM (2009) CD4 (+) T hüceyrələri makrofaqların protümor xüsusiyyətlərini artırmaqla məmə xərçənginin ağciyər metastazını tənzimləyir. Xərçəng Hüceyrəsi 16(2):91-102. https://doi.org/10.1016/j.ccr.2009.06.018

Dirat B, Bochet L, Dabek M, Daviaud D, Dauvillier S, Majed B, Wang YY, Meulle A, Salles B, Le Gonidec S, Garrido I, Escourrou G, Valet P, Muller C (2011) Xərçənglə əlaqəli adipositlər nümayiş etdirilir aktivləşdirilmiş bir fenotipdir və döş xərçəngi işğalına kömək edir. Xərçəng Res 71(7):2455–2465. https://doi.org/10.1158/0008-5472.CAN-10-3323

dos Santos CO, Rebbeck C, Rozhkova E, Valentine A, Samuels A, Kadiri LR, Osten P, Harris EY, Uren PJ, Smith AD, Hannon GJ (2013) Mammary differensiasiyasının molekulyar iyerarxiyası süd kök hüceyrələrinin zərif markerlərini verir. Proc Natl Acad Sci U S A 110(18):7123–7130. https://doi.org/10.1073/pnas.1303919110

Dravis C, Chung CY, Lytle NK, Herrera-Valdez J, Luna G, Trejo CL, Reya T, Wahl GM (2018) Süd vəzilərinin inkişafının epigenetik və transkriptomik profili və şiş modelləri hüceyrə vəziyyətinin plastisiyasının tənzimləyicilərini açıqlayır. Xərçəng Hüceyrəsi 34(3):466-482 e466. https://doi.org/10.1016/j.ccell.2018.08.001

Duncan JS, Whittle MC, Nakamura K, Abell AN, Midland AA, Zawistowski JS, Johnson NL, Granger DA, Jordan NV, Darr DB, Usary J, Kuan PF, Smalley DM, Major B, He X, Hoadley KA, Zhou B , Sharpless NE, Perou CM, Kim WY, Gomez SM, Chen X, Jin J, Frye SV, Earp HS, Graves LM, Johnson GL (2012) Üçlü-mənfi döş xərçəngində məqsədyönlü MEK inhibisyonuna cavab olaraq kinomenin dinamik yenidən proqramlaşdırılması . Hüceyrə 149(2):307–321. https://doi.org/10.1016/j.cell.2012.02.053

Duong MN, Geneste A, Fallone F, Li X, Dumontet C, Muller C (2017) Yağ və pis: yetkin adipositlər, şişin inkişafı və müqavimətində əsas aktorlar. Oncotarget 8(34):57622–57641. https://doi.org/10.18632/oncotarget.18038

Edechi CA, Ikeogu N, Uzonna JE, Myal Y (2019) Döş xərçəngində toxunulmazlığın tənzimlənməsi. Xərçənglər (Bazel). https://doi.org/10.3390/cancers11081080

Egeblad M, Rasch MG, Weaver VM (2010) Kollagen iskele və şiş təkamülü arasında dinamik qarşılıqlı əlaqə. Curr Opin Cell Biol 22(5):697–706. https://doi.org/10.1016/j.ceb.2010.08.015

Fang F, Turcan S, Rimner A, Kaufman A, Giri D, Morris LG, Shen R, Seshan V, Mo Q, Heguy A, Baylin SB, Ahuja N, Viale A, Massague J, Norton L, Vahdat LT, Moynahan ME , Chan TA (2011) Döş xərçəngi metilomları metastaz üçün epigenomik əsas yaradır. Sci Transl Med 3(75):75ra25

Fantozzi A, Christofori G (2006) Döş xərçəngi metastazının siçan modelləri. Döş xərçəngi Res 8(4):212. https://doi.org/10.1186/bcr1530

Feeley LP, Mulligan AM, Pinnaduwage D, Bull SB, Andrulis IL (2014) Ki67, progesteron reseptoru və ya TP53 statusu ilə luminal döş xərçəngi alt tiplərinin fərqləndirilməsi proqnostik məlumat verir. Mod Pathol 27(4):554–561. https://doi.org/10.1038/modpathol.2013.153

Fitzgibbons PL, Page DL, Weaver D, Thor AD, Allred DC, Clark GM, Ruby SG, O'Malley F, Simpson JF, Connolly JL, Hayes DF, Edge SB, Lichter A, Schnitt SJ (2000) Döşdə proqnostik amillər xərçəng. Amerika Patoloqlar Kolleci Konsensus Bəyanatı 1999. Arch Pathol Lab Med 124(7):966–978

Forouzanfar MH, Foreman KJ, Delossantos AM, Lozano R, Lopez AD, Murray CJ, Naghavi M (2011) 1980-2010-cu illər arasında 187 ölkədə döş və uşaqlıq boynu xərçəngi: sistematik təhlil. Lancet 378(9801):1461–1484. https://doi.org/10.1016/S0140-6736(11)61351-2

Fuseler JW, Robichaux JP, Atiyah HI, Ramsdell AF (2014) Morfometrik və fraktal ölçü analizi MMTV-cNeu siçanlarının məmə epitelində erkən neoplastik dəyişiklikləri müəyyən edir. Anticancer Res 34(3):1171-1177

Gamba CO, Damasceno KA, Ferreira IC, Rodrigues MA, Gomes DA, Alves MR, Rocha RM, Lima AE, Ferreira E, Cassali GD (2019) Süd vəzində köpək invaziv mikropapilyar karsinomada ZEB2 vasitəçiliyi ilə transkripsiya repressiyasının tədqiqi. PLoS ONE 14(1):e0209497. https://doi.org/10.1371/journal.pone.0209497

Garrido-Castro AC, Lin NU, Polyak K (2019) Üçlü mənfi döş xərçənginin molekulyar təsnifatlarına dair fikirlər: müalicə üçün xəstə seçiminin təkmilləşdirilməsi. Xərçəng Discov 9(2):176–198. https://doi.org/10.1158/2159-8290.CD-18-1177

Gasco M, Shami S, Crook T (2002) Döş xərçəngində p53 yolu. Döş Xərçəngi Res 4(2):70-76. https://doi.org/10.1186/bcr426

Georgess D, Padmanaban V, Sirka OK, Coutinho K, Choi A, Frid G, Neumann NM, Inoue T, Ewald AJ (2020) Twist1-induksiya etdiyi epiteliya yayılması Prkd1 siqnalını tələb edir. Xərçəng Res 80(2):204–218. https://doi.org/10.1158/0008-5472.CAN-18-3241

Gil Del Alcazar CR, Huh SJ, Ekram MB, Trinh A, Liu LL, Beca F, Zi X, Kwak M, Bergholtz H, Su Y, Ding L, Russnes HG, Richardson AL, Babski K, Min Hui Kim E, McDonnell CH 3rd, Wagner J, Rowberry R, ​​Freeman GJ, Dillon D, Sorlie T, Coussens LM, Garber JE, Fan R, Bobolis K, Allred DC, Jeong J, Park SY, Michor F, Polyak K (2017) Immune escape in in situ invaziv karsinoma keçid zamanı döş xərçəngi. Xərçəng Discov 7(10):1098–1115. https://doi.org/10.1158/2159-8290.CD-17-0222

Giles ED, Wellberg EA (2020) Qadınlarda piylənmə və döş xərçəngini öyrənmək üçün preklinik modellər: mülahizələr, xəbərdarlıqlar və alətlər. J Mammary Gland Biol Neoplasia 25(4):237-253. https://doi.org/10.1007/s10911-020-09463-2

Goonewardene TI, Sowter HM, Harris AL (2002) Döş xərçəngində hipoksiyaya səbəb olan yollar. Microsc Res Tech 59(1):41–48. https://doi.org/10.1002/jemt.10175

Grove E, Eckardt S, McLaughlin KJ (2016) Dişi mikrob xətti ilə yüksək sürətli siçan keçidi. PLoS ONE 11(12):e0166822. https://doi.org/10.1371/journal.pone.0166822

Guerrini L, Costanzo A, Merlo GR (2011) Ektodermadan əldə edilən strukturların inkişafına nəzarət etmək üçün p63-də mərkəzləşdirilmiş qaydalar simfoniyası. J Biomed Biotechnol 2011: 864904. https://doi.org/10.1155/2011/864904

Hammond ME, Hayes DF, Dowsett M, Allred DC, Hagerty KL, Badve S, Fitzgibbons PL, Francis G, Goldstein NS, Hayes M, Hicks DG, Lester S, Love R, Mangu PB, McShane L, Miller K, Osborne CK , Paik S, Perlmutter J, Rodos A, Sasano H, Schwartz JN, Sweep FC, Taube S, Torlakovic EE, Valenstein P, Viale G, Visscher D, Wheeler T, Williams RB, Wittliff JL, Wolff AC (2010) Amerika Cəmiyyəti Klinik Onkologiya / Amerika Patoloqlar Kollecinin döş xərçəngində estrogen və progesteron reseptorlarının immunohistokimyəvi testləri üçün təlimat tövsiyələri. J Clin Oncol 28(16):2784–2795. https://doi.org/10.1200/JCO.2009.25.6529

Hanahan D, Weinberg RA (2011) Xərçəng əlamətləri: gələcək nəsil. Hüceyrə 144(5):646–674. https://doi.org/10.1016/j.cell.2011.02.013

Harbeck N, Penault-Llorca F, Cortes J, Gnant M, Houssami N, Poortmans P, Ruddy K, Tsang J, Cardoso F (2019) Döş Xərçəngi. Nat Rev Dis Primers 5(1):66. https://doi.org/10.1038/s41572-019-0111-2

Hasebe T, Tsuda H, Hirohashi S, Shimosato Y, Iwai M, Imoto S, Mukai K (1996) İnvaziv duktal karsinomada fibrotik diqqət: yüksək şiş aqressivliyinin göstəricisi. Jpn J Cancer Res 87(4):385–394. https://doi.org/10.1111/j.1349-7006.1996.tb00234.x

Hasebe T, Tsuda H, Hirohashi S, Shimosato Y, Tsubono Y, Yamamoto H, Mukai K (1998) Döşün infiltrasiya edən duktal karsinomasında fibrotik diqqət: xəstələrin uzunmüddətli sağ qalmasını proqnozlaşdırmaq üçün əhəmiyyətli histopatoloji proqnostik parametr. Döş Xərçənginin Müalicəsi 49(3):195-208. https://doi.org/10.1023/a:1006067513634

He D, Mustafi D, Fan X, Fernandez S, Markiewicz E, Zamora M, Mueller J, Sachleben JR, Brady MJ, Conzen SD, Karczmar GS (2018) Maqnit rezonans spektroskopiyası az yağlı, yüksək yağlı süd vəzilərində diferensial lipid tərkibini aşkar edir. yüksək fruktoza pəhrizlərinə qarşı heyvan yağı. PLoS ONE 13(1):e0190929. https://doi.org/10.1371/journal.pone.0190929

Heilmann K, Toth R, Bossmann C, Klimo K, Plass C, Gerhauser C (2017) Diferensial şəkildə metilləşdirilmiş uzun kodlaşdırmayan RNT-lər üçün geniş genom ekranı Esrp2 və lncRNA Esrp2-ni insan döş xərçəngi üçün proqnoza uyğunluğu ilə gücləndirici DNT metilasiyası ilə tənzimlənən kimi müəyyən edir. Onkogen 36(46):6446–6461. https://doi.org/10.1038/onc.2017.246

Holen I, Speirs V, Morrissey B, Blyth K (2017) Döş xərçəngi tədqiqatında in vivo modellər: tərəqqi, problemlər və gələcək istiqamətlər. Dis Model Mech 10(4):359–371. https://doi.org/10.1242/dmm.028274

Hollern DP, Andrechek ER (2014) Döş xərçənginin siçan modellərinin genomik təhlili siçan modellərinin molekulyar xüsusiyyətlərini və insan döş xərçəngi ilə əlaqələrini ortaya qoyur. Döş Xərçəngi Res 16(3):R59. https://doi.org/10.1186/bcr3672

Hou Z, Zhang Y (2019) CRISPR ilə DNT-nin daxil edilməsi. Elm 365(6448):25–26. https://doi.org/10.1126/science.aay2056

Huang Y, Ma C, Zhang Q, Ye J, Wang F, Zhang Y, Hunborg P, Varvares MA, Hoft DF, Hsueh EC, Peng G (2015) CD4+ və CD8+ T hüceyrələri döş xərçənginin inkişafında və nəticəsində əks rola malikdir. Oncotarget 6(19):17462–17478. https://doi.org/10.18632/oncotarget.3958

Khan JA, Mendelson A, Kunisaki Y, Birbrair A, Kou Y, Arnal-Estape A, Pinho S, Ciero P, Nakahara F, Ma'ayan A, Bergman A, Merad M, Frenette PS (2016) Fetal qaraciyər hematopoetik kök hüceyrəsi taxçalar portal damarlarla assosiasiya olunur. Elm 351(6269):176–180. https://doi.org/10.1126/science.aad0084

Korinek V (2020) Xüsusi buraxılış: xərçəngdə heyvan modelləşdirməsi. Genlər (Bazel) https://doi.org/10.3390/genes11091009

Koyama T, Hasebe T, Tsuda H, Hirohashi S, Sasaki S, Fukutomi T, Imoto S, Umeda T, Mukai K (1999) Döşün invaziv duktal karsinomasının ilkin sümük metastazı ilə əlaqəli histoloji amillər. Jpn J Xərçəng Res 90(3):294-300. https://doi.org/10.1111/j.1349-7006.1999.tb00747.x

Kriegsmann M, Endris V, Wolf T, Pfarr N, Stenzinger A, Loibl S, Denkert C, Schneeweiss A, Budczies J, Sinn P, Weichert W (2014) Ultradərin multigen ardıcıllığı ilə müəyyən edilmiş üçlü mənfi döş xərçəngində mutasiya profilləri yüksək göstərir. PI3K yolu dəyişikliklərinin dərəcələri və klinik cəhətdən müvafiq subyekt alt qruplarına xas fərqlər. Oncotarget 5(20):9952–9965. https://doi.org/10.18632/oncotarget.2481

Lengyel E, Makowski L, DiGiovanni J, Kolonin MG (2018) Xərçəng yağ məsələsi kimi: yağ toxuması və şişlər arasında qarşılıqlı əlaqə. Trendlər Xərçəng 4(5):374–384. https://doi.org/10.1016/j.trecan.2018.03.004

Lester SC, Bose S, Chen YY, Connolly JL, de Baca ME, Fitzgibbons PL, Hayes DF, Kleer C, O'Malley FP, Page DL, Smith BL, Tan LK, Weaver DL, Winer E, Xərçəng Komitəsinin üzvləri CoAP (2009) Döş vəzinin invaziv karsinoması olan xəstələrdən nümunələrin müayinəsi üçün Protokol. Arch Pathol Lab Med 133(10):1515–1538. https://doi.org/10.1043/1543-2165-133.10.1515

Liao D, Luo Y, Markowitz D, Xiang R, Reisfeld RA (2009) Xərçənglə əlaqəli fibroblastlar 4T1 siçan döş xərçəngi modelində şiş immun mikro mühitini modulyasiya etməklə şiş böyüməsini və metastazını təşviq edir. PLoS ONE 4(11):e7965. https://doi.org/10.1371/journal.pone.0007965

Linder CC (2006) Fenotipə təsir edən genetik dəyişənlər. ILAR J 47(2):132–140. https://doi.org/10.1093/ilar.47.2.132

Liu ML, Von Lintig FC, Liyanage M, Shibata MA, Jorcyk CL, Ried T, Boss GR, Green JE (1998) C3(1)/SV40 Tag-də məmə şişinin inkişafı zamanı Ki-rasın gücləndirilməsi və MAP kinaz aktivliyinin yüksəldilməsi transgen siçanlar. Onkogen 17(18):2403–2411. https://doi.org/10.1038/sj.onc.1202456

Liu R, Varghese S, Rabkin SD (2005) C3(1)/SV40 T-antigen transgenik siçanlarda döş xərçənginin onkolitik herpes simplex virus vektor terapiyası. Xərçəng Res 65(4):1532-1540. https://doi.org/10.1158/0008-5472.CAN-04-3353

Lonning PE (2007) Döş xərçənginin proqnozu və proqnozu: irəliləyiş əldə edirikmi? Ann Oncol 18(Əlavə 8):viii3-7. https://doi.org/10.1093/annonc/mdm260

MacLennan MB, Anderson BM, Ma DW (2011) FVB və C57Bl/6 siçanlarında süd vəzilərinin diferensial inkişafı: döş xərçəngi tədqiqatı üçün təsirlər. Qida maddələri 3(11):929–936. https://doi.org/10.3390/nu3110929

Markel P, Shu P, Ebeling C, Carlson GA, Nagle DL, Smutko JS, Moore KJ (1997) Anadangəlmə siçan suşlarının marker yardımlı yetişdirilməsi üçün nəzəri və empirik məsələlər. Nat Genet 17(3):280–284. https://doi.org/10.1038/ng1197-280

Maroulakou IG, Anver M, Garrett L, Green JE (1994) Siçovul C3(1) simian virusu 40 böyük şiş antigeninin birləşmə genini daşıyan transgen siçanlarda prostat və məmə adenokarsinoması. Proc Natl Acad Sci U S A 91(23):11236–11240

Martin-Pardillos A, Valls Chiva A, Bande Vargas G, Hurtado Blanco P, Pineiro Cid R, Guijarro PJ, Hummer S, Bejar Serrano E, Rodriguez-Casanova A, Diaz-Lagares A, Castellvi J, Miravet-Verde S, Serrano L, Lluch-Senar M, Sebastian V, Bribian A, Lopez-Mascaraque L, Lopez-Lopez R, Ramon YCS (2019) Döş xərçəngində klonal ünsiyyət və heterojenliyin rolu. BMC Xərçəng 19(1):666. https://doi.org/10.1186/s12885-019-5883-y

Maughan KL, Lutterbie MA, Ham PS (2010) Döş xərçənginin müalicəsi. Am Fam Həkimi 81(11):1339-1346

McPhail LD, Robinson SP (2010) Kimyəvi səbəbli siçovul məmə şişlərinin daxili həssaslıq MR görüntüsü: hipoksiya və fibrozun histoloji qiymətləndirilməsi ilə əlaqə. Radiologiya 254(1):110–118. https://doi.org/10.1148/radiol.2541090395

Medri L, Volpi A, Nanni O, Vecci AM, Mangia A, Schittulli F, Padovani F, Giunchi DC, Zito A, Amadori D, Paradiso A, Silvestrini R (2003) Düyün-mənfi döşü olan xəstələrdə mitotik fəaliyyətin proqnostik əhəmiyyəti xərçəng. Mod Pathol 16(11):1067–1075. https://doi.org/10.1097/01.MP.0000093625.20366.9D

Meyer-Losic F, Newman SP, Day JM, Reed MJ, Kasprzyk PG, Purohit A, Foster PA (2013) STX140, lakin paklitaksel deyil, C3(1)/SV40 T/t-antigen transgenində məmə şişinin başlamasını və inkişafını maneə törədir. siçan. PLoS ONE 8(12):e80305. https://doi.org/10.1371/journal.pone.0080305

Nissen NI, Karsdal M, Willumsen N (2019) Reaktiv stromada kollagenlər və xərçənglə əlaqəli fibroblastlar və onun xərçəng biologiyası ilə əlaqəsi. J Exp Clin Cancer Res 38(1):115. https://doi.org/10.1186/s13046-019-1110-6

Nobre AR, Risson E, Singh DK, Martino JD, Cheung JF, Wang J, Johnson J, Russnes HG, Bravo-Codero JJ, Birbrair A, Naume B, Azhar M, Frenette PS, Aguirre-Ghiso J (2021) Sümük iliyi NG2+/Nestin+ mezenximal kök hüceyrələri TGFβ2 vasitəsilə DTC yuxusuzluğunu idarə edir. Təbiət Xərçəngi 2:327–339

Ognjenovic NB, Bagheri M, Mohamed GA, Xu K, Chen Y, Mohamed Saleem MA, Brown MS, Nagaraj SH, Muller KE, Gerber SA, Christensen BC, Pattabiraman DR (2020) PKA ilə bazal bölmənin özünü yeniləməsini məhdudlaşdırmaq differensiasiyaya səbəb olur və məmə şişlərinin təkamülünü dəyişdirir. Dev Cell 55(5):544-557 e546. https://doi.org/10.1016/j.devcel.2020.10.004

O'Toole SA, Machalek DA, Shearer RF, Millar EK, Nair R, Schofield P, McLeod D, Cooper CL, McNeil CM, McFarland A, Nguyen A, Ormandy CJ, Qiu MR, Rabinoviç B, Martelotto LG, Vu D, Hannigan GE, Musgrove EA, Christ D, Sutherland RL, Watkins DN, Swarbrick A (2011) Kirpi həddindən artıq ifadəsi stromal qarşılıqlı əlaqə ilə əlaqələndirilir və döş xərçəngində pis nəticəni proqnozlaşdırır. Xərçəng Res 71(11):4002–4014. https://doi.org/10.1158/0008-5472.CAN-10-3738

Padmanaban V, Krol I, Suhail Y, Szczerba BM, Aceto N, Bader JS, Ewald AJ (2019) E-kaderin döş xərçənginin çoxsaylı modellərində metastaz üçün tələb olunur. Təbiət 573(7774):439–444. https://doi.org/10.1038/s41586-019-1526-3

Park J, Wysocki RW, Amoozgar Z, Maiorino L, Fein MR, Jorns J, Schott AF, Kinugasa-Katayama Y, Lee Y, Won NH, Nakasone ES, Hearn SA, Kuttner V, Qiu J, Almeida AS, Perurena N, Kessenbrock K, Goldberg MS, Egeblad M (2016) Xərçəng hüceyrələri metastazı dəstəkləyən neytrofil hüceyrədənkənar DNT tələlərinə səbəb olur. Sci Transl Med 8(361):361ra138. https://doi.org/10.1126/scitranslmed.aag1711

Park MK, Lee CH, Lee H (2018) Preklinik tədqiqatda döş xərçənginin siçan modelləri. Lab Anim Res 34(4):160–165. https://doi.org/10.5625/lar.2018.34.4.160

Pathania R, Ramachandran S, Elangovan S, Padia R, Yang P, Cinghu S, Veeranan-Karmegam R, Arjunan P, Gnana-Prakasam JP, Sadanand F, Pei L, Chang CS, Choi JH, Shi H, Manicassamy S, Prasad PD, Sharma S, Ganapathy V, Jothi R, Thangaraju M (2015) DNMT1 məmə və xərçəng kök hüceyrələrinin saxlanması və şişlərin yaranması üçün vacibdir. Nat Commun 6:6910. https://doi.org/10.1038/ncomms7910

Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnsen H, Akslen LA, Fluge O, Pergamenschikov A, Williams C, Zhu SX, Lonning PE, Borresen-Dale AL, Brown PO, Botstein D (2000) İnsan döş şişlərinin molekulyar portretləri. Təbiət 406(6797):747–752. https://doi.org/10.1038/35021093

Petruzzelli M, Schweiger M, Schreiber R, Campos-Olivas R, Tsoli M, Allen J, Swarbrick M, Rose-John S, Rincon M, Robertson G, Zechner R, Wagner EF (2014) Ağdan qəhvəyi yağa keçid artır xərçənglə əlaqəli kaxeksiyada enerji xərcləri. Cell Metab 20(3):433–447. https://doi.org/10.1016/j.cmet.2014.06.011

Pfefferle AD, Herschkowitz JI, Usary J, Harrell JC, Spike BT, Adams JR, Torres-Arzayus MI, Brown M, Egan SE, Wahl GM, Rosen JM, Perou CM (2013) Döş xərçənginin genetik olaraq dəyişdirilmiş siçan modellərinin transkriptomik təsnifatı insan alt tipli analoqlarını müəyyən edir. Genom Biol 14(11):R125. https://doi.org/10.1186/gb-2013-14-11-r125

Pietilainen T, Lipponen P, Aaltomaa S, Eskelinen M, Kosma VM, Syrjanen K (1996) Döş xərçəngində görüntü analizi ilə müəyyən edilən Ki-67 ifadəsinin mühüm proqnostik dəyəri. J Cancer Res Clin Oncol 122(11):687-692. https://doi.org/10.1007/BF01209033

Prazeres P, Leonel C, Silva WN, Rocha BGS, Santos GSP, Costa AC, Picoli CC, Sena IFG, Goncalves WA, Vieira MS, Costa PAC, Campos L, Lopes MTP, Costa MR, Resende RR, Cunha TM, Mintz A , Birbrair A (2020a) Həssas sinirlərin ablasiyası melanoma irəliləməsinə kömək edir. J Cell Mol Med. https://doi.org/10.1111/jcm.15381

Prazeres P, Leonel C, Silva WN, Rocha BGS, Santos GSP, Costa AC, Picoli CC, Sena IFG, Goncalves WA, Vieira MS, Costa PAC, Campos L, Lopes MTP, Costa MR, Resende RR, Cunha TM, Mintz A , Birbrair A (2020b) Həssas sinirlərin ablasiyası melanoma irəliləməsinə kömək edir. J Cell Mol Med 24(17):9574–9589. https://doi.org/10.1111/jcm.15381

Quail DF, Dannenberg AJ (2019) Xərçəngin inkişafı və inkişafında obez yağ toxumasının mikromühiti. Nat Rev Endocrinol 15(3):139-154. https://doi.org/10.1038/s41574-018-0126-x

Rivera J, Tessarollo L (2008) Genetik fon və siçan tədqiqatlarının insanlara tərcüməsi dilemması. İmmunitet 28(1):1-4. https://doi.org/10.1016/j.immuni.2007.12.008

Roberts PJ, Usary JE, Darr DB, Dillon PM, Pfefferle AD, Whittle MC, Duncan JS, Johnson SM, Combest AJ, Jin J, Zamboni WC, Johnson GL, Perou CM, Sharpless NE (2012) Kombinə edilmiş PI3K/mTOR və MEK inhibe sadiq fare xərçəngi modellərində geniş antitümör fəaliyyəti təmin edir. Clin Cancer Res 18(19):5290–5303. https://doi.org/10.1158/1078-0432.CCR-12-0563

Ronnov-Jessen L, Petersen OW, Bissell MJ (1996) Normal döşün bədxassəlinə çevrilməsində iştirak edən hüceyrə dəyişiklikləri: stromal reaksiyanın əhəmiyyəti. Physiol Rev 76(1):69–125. https://doi.org/10.1152/physrev.1996.76.1.69

Ross C, Szczepanek K, Lee M, Yang H, Peer CJ, Kindrick J, Shankarappa P, Lin ZW, Sanford JD, Figg WD, Hunter KW (2020) Avtokton və alloqreft siçan süd vəzinin şişi modellərində metastaz-spesifik gen ifadəsi: strat və hədəflənən imzaların müəyyən edilməsi. Mol Xərçəng Res 18(9):1278–1289. https://doi.org/10.1158/1541-7786.MCR-20-0046

Rowse GJ, Ritland SR, Gendler SJ (1998) Neu proto-onkogenlə induksiya olunan süd vəzi şişinin genetik modulyasiyası. Xərçəng Res 58(12):2675–2679

Ruffell B, Chang-Strachan D, Chan V, Rosenbusch A, Ho CM, Pryer N, Daniel D, Hwang ES, Rugo HS, Coussens LM (2014) IL-10 makrofaqı IL-ni basdıraraq kemoterapiyaya CD8+ T hüceyrəsindən asılı cavabları bloklayır. -12 intratumoral dendritik hüceyrələrdə ifadə. Xərçəng Hüceyrəsi 26(5):623-637. https://doi.org/10.1016/j.ccell.2014.09.006

Sakamoto K, Schmidt JW, Wagner KU (2015) Döş xərçənginin siçan modelləri. Metodlar Mol Biol 1267:47–71. https://doi.org/10.1007/978-1-4939-2297-0_3

Salqado R, Denkert C, Demaria S, Sirtaine N, Klauschen F, Pruneri G, Wienert S, Van den Eynden G, Baehner FL, Penault-Llorca F, Perez EA, Thompson EA, Symmans WF, Richardson AL, Brock J, Criscitiello C, Bailey H, Ignatiadis M, Floris G, Sparano J, Kos Z, Nielsen T, Rimm DL, Allison KH, Reis-Filho JS, Loibl S, Sotiriou C, Viale G, Badve S, Adams S, Willard-Gallo K , Loi S, Beynəlxalq TWG (2015) Döş xərçəngində şiş infiltrasiya edən limfositlərin (TILs) qiymətləndirilməsi: Beynəlxalq TILs İşçi Qrupu tərəfindən tövsiyələr 2014. Ann Oncol 26(2):259-271. https://doi.org/10.1093/annonc/mdu450

Satıcılar RS, Clifford CB, Treuting PM, Brayton C (2012) Inbred laboratoriya siçan suşları arasında immunoloji variasiya: genetik cəhətdən immunomodifikasiya olunmuş siçanların fenotipləşdirilməsində nəzərə alınmalı məqamlar. Vet Pathol 49(1):32-43. https://doi.org/10.1177/0300985811429314

Shay T, Jojic V, Zuk O, Rothamel K, Puyraimond-Zemmour D, Feng T, Wakamatsu E, Benoist C, Koller D, Regev A, ImmGen C (2013) İnsan və siçan immunitetinin transkripsiya proqramlarında konservasiya və fərqlilik sistemləri. Proc Natl Acad Sci U S A 110(8):2946–2951. https://doi.org/10.1073/pnas.1222738110

Shibata MA, Maroulakou IG, Jorcyk CL, Gold LG, Ward JM, Green JE (1996) C3(1)/SV40 böyük T antigen transgenik siçanlarda məmə şişinin inkişafı zamanı p53-müstəqil apoptoz: preneoplaziyadan keçid zamanı apoptozun bastırılması. karsinoma. Xərçəng Res 56(13):2998–3003

Shibata MA, Jorcyk CL, Liu ML, Yoshidome K, Gold LG, Green JE (1998) Prostat və süd vəzi xərçənginin C3(1)/SV40 T antigen transgenik siçan modeli. Toxicol Pathol 26(1):177-182. https://doi.org/10.1177/019262339802600121

Singh P, Schimenti JC, Bolcun-Filas E (2015) Siçan genetikinin CRISPR tətbiqləri üçün praktiki bələdçisi. Genetika 199(1):1-15. https://doi.org/10.1534/genetics.114.169771

Sohail A, Khan A, Wahab N, Zameer A, Khan S (2021) Döş xərçəngi histopatoloji şəkilləri üçün çox fazalı dərin CNN əsaslı mitoz aşkarlama çərçivəsi. Sci Rep 11(1):6215. https://doi.org/10.1038/s41598-021-85652-1

Song HK, Hwang DY (2017) C57BL/6N siçanlarının müxtəlif immunoloji tədqiqatlarda istifadəsi. Lab Anim Res 33(2):119–123. https://doi.org/10.5625/lar.2017.33.2.119

Song W, Hwang Y, Youngblood VM, Cook RS, Balko JM, Chen J, Brantley-Sieders DM (2017) EphA2-nin hədəflənməsi hüceyrə dövrünün irəliləməsini və bazal/üçlü mənfi döş xərçənginin böyüməsini pozur. Onkogen 36(40):5620–5630. https://doi.org/10.1038/onc.2017.170

Souza CM, Gamba Cde O, Campos CB, Lopes MT, Ferreira MA, Andrade SP, Cassali GD (2013) Karboplatin siçanlarda məmə xərçəngi 4T1 böyüməsini gecikdirir. Pathol Res Pract 209(1):24–29. https://doi.org/10.1016/j.prp.2012.10.003

Sundaram S, Freemerman AJ, Galanko JA, McNaughton KK, Bendt KM, Darr DB, Troester MA, Makowski L (2014) HGF/c-Met-in piylənmə vasitəçiliyi ilə tənzimlənməsi parous siçanlarda bazal məmə xərçənginin gecikməsinin azalması ilə əlaqələndirilir. PLoS ONE 9(10):e111394. https://doi.org/10.1371/journal.pone.0111394

Takao K, Miyakawa T (2015) Siçan modellərindəki genomik cavablar insan iltihabi xəstəliklərini çox təqlid edir. Proc Natl Acad Sci U S A 112(4):1167–1172. https://doi.org/10.1073/pnas.1401965111

Taketo M, Schroeder AC, Mobraaten LE, Gunning KB, Hanten G, Fox RR, Roderick TH, Stewart CL, Lilly F, Hansen CT et al (1991) FVB/N: transgenik analizlər üçün üstünlük verilən doğma siçan ştammı. Proc Natl Acad Sci U S A 88(6):2065–2069. https://doi.org/10.1073/pnas.88.6.2065

Tatum JL, Kelloff GJ, Gillies RJ, Arbeit JM, Brown JM, Chao KS, Chapman JD, Eckelman WC, Fyles AW, Giaccia AJ, Hill RP, Koch CJ, Krishna MC, Krohn KA, Lewis JS, Mason RP, Melillo G , Padhani AR, Powis G, Rajendran JG, Reba R, Robinson SP, Semenza GL, Swartz HM, Vaupel P, Yang D, Croft B, Hoffman J, Liu G, Stone H, Sullivan D (2006) Hipoksiya: şişdə əhəmiyyəti biologiya, görüntüləmə ilə qeyri-invaziv ölçmə və xərçəng müalicəsinin idarə edilməsində onun ölçülməsinin dəyəri. Int J Radiat Biol 82(10):699–757. https://doi.org/10.1080/09553000601002324

Teixido J, Hidalgo A, Fagerholm S (2019) Redaksiya: homeostaz və xəstəlikdə leykosit alveri. Front Immunol 10:2560. https://doi.org/10.3389/fimmu.2019.02560

Tiwari P, Blank A, Cui C, Schoenfelt KQ, Zhou G, Xu Y, Xramtsova G, Olopade F, Shah AM, Khan SA, Rosner MR, Becker L (2019) Metabolik olaraq aktivləşdirilmiş piy toxuması makrofaqları piylənməni üçqat mənfi döşlə əlaqələndirir. xərçəng. J Exp Med 216(6):1345–1358. https://doi.org/10.1084/jem.20181616

Van den Eynden GG, Colpaert CG, Couvelard A, Pezzella F, Dirix LY, Vermeulen PB, Van Marck EA, Hasebe T (2007) Fibrotik fokus süd vəzi xərçəngində hipoksiya və (limfa) angiogenez üçün proqnostik amil və surroqat markerdir. : ədəbiyyatın nəzərdən keçirilməsi və qiymətləndirmə meyarlarına dair təklif. Histopatologiya 51(4):440-451. https://doi.org/10.1111/j.1365-2559.2007.02761.x

van Diest PJ, Baak JP, Matze-Cok P, Wisse-Brekelmans EC, van Galen CM, Kurver PH, Bellot SM, Fijnheer J, van Gorp LH, Kwee WS et al (1992) 2469 döş xərçəngi nümunəsində mitozun təkrarlanma qabiliyyəti : Çoxmərkəzli Morfometrik Mammary Karsinoma Layihəsinin nəticələri. Hum Pathol 23(6):603-607. https://doi.org/10.1016/0046-8177(92)90313-r

van Diest PJ, Brugal G, Baak JP (1998) Şişlərdə proliferasiya markerləri: şərh və klinik dəyər. J Clin Pathol 51(10):716-724. https://doi.org/10.1136/jcp.51.10.716

Vandeweyer E, Hertens D (2002) Döş toxumasında bezlərin və yağların miqdarı: eksperimental təyinat. Ann Anat 184(2):181-184. https://doi.org/10.1016/S0940-9602(02)80016-4

Vitosevic K, Todorovic M, Varljen T, Slovic Z, Matic S, Todorovic D (2018) Formalin fiksasiyasının sağlam yarılma toxumalarından təcrid olunmuş DNT-nin PCR gücləndirilməsinə təsiri. Acta Histochem 120(8):780–788. https://doi.org/10.1016/j.acthis.2018.09.005

Wagner KU (2004) Döş xərçəngi modelləri: quo vadis, heyvan modelləşdirmə? Döş Xərçəngi Res 6(1):31-38. https://doi.org/10.1186/bcr723

Weinstock A, Moura Silva H, Moore KJ, Schmidt AM, Fisher EA (2020) Piylənmə də daxil olmaqla yağ toxumasında leykosit heterojenliyi. Circ Res 126(11):1590–1612. https://doi.org/10.1161/CIRCRESAHA.120.316203

Wetsel RA, Fleischer DT, Haviland DL (1990) Sıçanın beşinci tamamlayıcı komponentinin çatışmazlığı (C5). 5'-eksonda 2 əsaslı cüt gen silinməsi. J Biol Chem 265(5):2435–2440

Wild R, Yokoyama Y, Dings RP, Ramakrishnan S (2004) VEGF-DT385 toksin konjugatı spontan şişin transgenik siçan modelində məmə adenokarsinomasının inkişafına mane olur. Döş Xərçənginin Müalicəsi 85(2):161-171. https://doi.org/10.1023/B:BREA.0000025407.02896.ec

Wiseman BS, Werb Z (2002) Süd vəzilərinin inkişafına və döş xərçənginə stromal təsirlər. Elm 296(5570):1046–1049. https://doi.org/10.1126/science.1067431

Wolff AC, Hammond ME, Hicks DG, Dowsett M, McShane LM, Allison KH, Allred DC, Bartlett JM, Bilous M, Fitzgibbons P, Hanna W, Jenkins RB, Mangu PB, Paik S, Perez EA, Press MF, Spears PA , Vance GH, Viale G, Hayes DF, American Society of Clinical O, College of American P (2013) Döş xərçəngində insan epidermal böyümə faktoru reseptor 2 testi üçün tövsiyələr: Amerika Klinik Onkologiya Cəmiyyəti/Amerika Patoloqları Kolleci klinik praktika təlimatının yenilənməsi . J Clin Oncol 31(31):3997–4013. https://doi.org/10.1200/JCO.2013.50.9984

Yoshidome K, Shibata MA, Couldrey C, Korach KS, Green JE (2000) Estrogen C3(1)/SV40 böyük T-antigen transgenik siçanlarda məmə şişinin inkişafına kömək edir: şişin inkişafı zamanı estrogen reseptor alfa ifadəsinin paradoksal itkisi. Xərçəng Res 60(24):6901–6910

Yoshiki A, Moriwaki K (2006) Siçan fenomeninin tədqiqatı: genetik fonun təsiri. ILAR J 47(2):94–102. https://doi.org/10.1093/ilar.47.2.94

Zhu M, Yi M, Kim CH, Deng C, Li Y, Medina D, Stephens RM, Green JE (2011) Siçan məmə şişi modellərinin inteqrasiya olunmuş miRNT və mRNA ifadə profili süd vəzi şişinin nəsli ilə əlaqəli miRNA imzalarını müəyyən edir. Genom Biol 12(8):R77. https://doi.org/10.1186/gb-2011-12-8-r77

Zhu X, Chen L, Huang B, Wang Y, Ji L, Wu J, Di G, Liu G, Yu K, Shao Z, Wang Z (2020) Üçlü mənfi döş xərçəngində Ki-67-nin proqnostik və proqnozlaşdırıcı potensialı . Sci Rep 10(1):225. https://doi.org/10.1038/s41598-019-57094-3


Materiallar və metodlar

Siçanlar, BM-dən əldə edilən hüceyrələr və hüceyrə xətləri

Sıçan mononükleer hüceyrələri (MNC) patogensiz, 4-6 həftəlik dişi BALB/c-C3aR – / – 21 və C57B1/6 C3 –/ siçanlarının PB-dən və ya BM-dən (bud sümüyündən yuyulmuş) təcrid edilmişdir. – siçanlar (Cekson Laboratoriyasından alınmış çoxalma koloniyası, Bar Harbor, ME). 17 C3 –/– koloniyasında zərdab C3 zülal səviyyəsinin yoxlanılması ilə müəyyən edilmiş vəhşi tip (ağırlıq) C57Bl/6 C3 +/+ yaşa və cinsə uyğun gələn balalardan C3 –/– siçanlarını araşdıran təcrübələr üçün nəzarət elementləri kimi istifadə edilmişdir. BALB/c-C3aR –/– siçanları, 12 nəsil boyu BALB/c çəkisi siçanları ilə ters çaprazlaşdırılaraq, Milli Xərçəng İnstitutundan (NCI) – Frederikdən (NCI) əldə edilmiş yaşa və cinsə uyğun gələn ağırlığa malik BALB/c siçanları ilə qoşalaşmışdır. Frederik, MD). Əlavə wt C57Bl/6 və BALB/c siçanları da Cekson Laboratoriyasından alınıb. Təcrübədən əvvəl, C3 –/– koloniyasından olan bütün siçanlar serum C3 üçün (radial immunodiffuziyadan istifadə etməklə) analiz yolu ilə fenotiplənmişdir və eynilə C3aR –/– genotipini təsdiqləmək üçün polimeraza zəncirvari reaksiyadan (PZR) istifadə edilmişdir. MNC-lər yapışan hüceyrələrdən (A - ) tükəndi və sonra təsvir edildiyi kimi Ficoll-Paque sentrifuqa üsulu ilə işıq sıxlığı MNC-lər üçün zənginləşdirildi. 22 Sca-1 + hüceyrəsi istehsalçının protokoluna uyğun olaraq paramaqnit minibeads (Miltenyi Biotec, Auburn, CA) istifadə edərək təcrid edilmişdir. İzolyasiya edilmiş BM Sca-1+ hüceyrələrinin təmizliyi FACscan (BD Biosciences Immunocytometry Systems, San Jose, CA) istifadə edərək flüoresanla aktivləşdirilmiş hüceyrə çeşidləyicisi (FACS) analizi ilə müəyyən edildiyi kimi 95%-dən çox olmuşdur. Tədqiqat üçün təsdiq Louisville Universitetinin Heyvanlara Qulluq və İstifadə Komitəsinin institusional baxış şurasından alındı. Helsinki Bəyannaməsinə uyğun olaraq məlumatlandırılmış razılıq verilmişdir.

İnsan işıq sıxlığına malik BM hüceyrələri, istifadə olunan protokolların Louisville Universiteti və Jagiellonian Universitetinin institusional araşdırma şuraları tərəfindən təsdiqləndiyi barədə məlumatlı razılıq vermiş sağlam könüllü donorlardan əldə edilmişdir. İşıq sıxlığı olan hüceyrələr daha əvvəl təsvir olunduğu kimi MiniMACS paramaqnit muncuqları (Miltenyi Biotec) ilə immunoaffinlik seçimi ilə CD34+ hüceyrələri üçün zənginləşdirilmədən əvvəl yapışan hüceyrələrdən və T limfositlərdən (A – T – MNCs) tükənmişdir. 23 İzolyasiya edilmiş BM CD34+ hüceyrələrinin təmizliyi FACscan ilə axın sitometriyasından istifadə etməklə müəyyən edildiyi kimi 98%-dən çox olmuşdur.

Bu tədqiqatda istifadə edilən hüceyrə xətləri Amerika Tipi Mədəniyyət Kolleksiyasından (Manassas, VA) əldə edilmiş və təsvir edildiyi kimi yetişdirilmiş insan K-562, HL-60 və Jurkat hematopoetik hüceyrə xətlərini əhatə edirdi. 24

Siçanların səfərbər edilməsi

Siçanlar 1, 3 və ya 6 gün ərzində hər gün 250 μg/kq insan G-CSF (Amgen, Thousand Oaks, CA) subkutan inyeksiya ilə səfərbər edildi. Təsvir edildiyi kimi Unopette Microcollection (Becton Dickinson, Rutherford, NJ) istifadə edərək leykositlərin sayını əldə etmək üçün siçanlar retro-orbital pleksusdan qan aldılar. 9,22 Son G-CSF inyeksiyasından 6 saat sonra PB vena kavasından (25 kalibrli iynə və 250 U heparin olan 1 ml şpris ilə) əldə edildi və təsvir olunduğu kimi işıq sıxlığı MNC-lər üçün zənginləşdirildi. 22 Bəzi səfərbərlik protokollarında xüsusi C3aR antaqonisti SB 290157 şəkil əfsanələrində göstərildiyi kimi intraperitoneal (0,01-1 μg/heyvan) yeridildi. SB 290157 Calbiochem-dən (San Dieqo, CA) alınmış və təsvir edildiyi kimi fosfat tamponlu salin (PBS)/dimetil sulfoksid (DMSO) içində yenidən dayandırılmışdır. 20

Axın sitometriyası

c-Kit/Sca-1 + hüceyrələrinin miqdarını müəyyən etmək üçün iki rəngli axın sitometriyası analizi aparılmışdır. Qısaca olaraq, 50 μL tam qan həm siçovul əleyhinə c-Kit fluorescein isothiocyanate (FITC) – konjugasiya edilmiş, həm də siçan antimouse Sca-1 – fikoeritrin (PE) – konyuqasiya edilmiş monoklonal anticisimlərlə (son konsentrasiya 1 μg/mL, hər ikisi BDharmingen, Pharmingen) ilə boyandı. San Dieqo, Kaliforniya). Müvafiq izotip nəzarətləri (BD Biosciences Pharmingen) ilə boyanmış nümunələr paralel olaraq tədqiq edilmişdir. Buz üzərində 20 dəqiqəlik inkubasiyadan sonra eritrositləri parçalamaq üçün 2 mL FACS Lysing məhlulu (BD Biosciences Immunocytometry Systems) əlavə edildi. Bundan sonra hüceyrələr iki dəfə PBS-də yuyuldu, 0.3 mL PBS-də yenidən dayandırıldı və CellQuest v.3.1 proqramından (BD Biosciences Immunocytometry Systems) istifadə edərək FACScan tərəfindən təhlil edildi. Tipik olaraq, 20 000 hadisə əldə edildi və c-Kit/Sca-1 + hüceyrələrinin faizi bütün leykosit populyasiyası üçün müəyyən edildi.

Sıçan BM-də C3 çöküntülərinin aşkarlanması

C3 –/– siçanlarından və onların ağırlıqda tullantılarından alınan siçan BM hüceyrələri peridinin xlorofil-alfa zülalı (PerCP) – siyanin 5 (Cy5) siçan əleyhinə CD45 (BD Biosciences Pharmingen) və yaxınlıq baxımından təmizlənmiş poliklonal keçi immunoqlobulinin qarışığı ilə boyandı. IgG) antimouse C3–Oregon Green (aşağıda) 1 × 106 hüceyrəni Ab-nin buz üzərində optimallaşdırılmış seyreltməsində 20 dəqiqə inkubasiya etməklə, ardınca PBS-də 2 yuyulma və 0,3 mL PBS-də suspenziya ilə. Məlumatlar FACscan və CellQuest v3.1 proqram təminatından (Becton Dickinson, San Jose, CA) istifadə edərək axın sitometriyası ilə əldə edilmiş və təhlil edilmişdir. C3 –/– siçanlarından BM hüceyrələrinin boyanması, yaxınlığı ilə təmizlənmiş poliklonal siçan C3 reagenti ilə əldə edilə bilən hər hansı qeyri-spesifik boyanma üçün nəzarət kimi istifadə edilmişdir (məsələn, ölü hüceyrənin qeyri-spesifik boyanması). Yaxınlığı ilə təmizlənmiş antikor (Ab) keçi antiserumunun IgG fraksiyasından siçan C3-ə (İmmunologiya Məsləhətçiləri, Newberg, OR) yaradılmışdır ki, bu da Mono-Q anion mübadiləsi sürətli zülal maye xromatoqrafiyası (FPLC) ilə təcrid olunmuş, ardınca udma və elüsyona məruz qalmışdır. siçan C3-zimozan. Qısaca olaraq, C3 ilə örtülmüş zimosan 11 ml təzə siçan zərdabında dayandırılmış 500 mq zimosandan (Sigma Chemical, St Louis, MO) istifadə edilərək təsvir edildiyi kimi hazırlanmış və 0,1% natrium deoksixolat (Sigma Chemical) ehtiva edən 1 M NaCl ilə 3 dəfə yuyulmuşdur. qeyri-spesifik olaraq bağlanmış siçan serum zülalları. Veronal tamponlu şoran ilə 2 dəfə yuyulduqdan sonra C3-zimosan sentrifuqa üsulu ilə qranullara salındı, qısa ultrasonikasiya istifadə edərək 6 mL keçi IgG anti-C3 (5 mq/mL) içində bərabər şəkildə dayandırıldı və əvvəlcə 37°C-də 30 dəqiqə, sonra isə inkubasiya edildi. C3-zimosanı suspenziyada saxlamaq üçün 10 dəqiqəlik fasilələrlə burulğanla qarışdırmaqla 30 dəqiqə 0°C. Qeyri-spesifik olaraq bağlanmış IgG-ni çıxarmaq üçün C3-zimozan 37°C-yə qədər qızdırılmış PBS ilə 3 dəfə, sonra isə 37°C-yə qədər qızdırılmış 0,1% natrium deoksixolat olan 1 M NaCl ilə 3 dəfə yuyuldu. Siçan əleyhinə C3 IgG, 2 ml 4-M guanidin hidroxloriddə dayandırılaraq və 22°C-də 30 dəqiqə inkubasiya edilməklə C3-zimozandan çıxarıldı. C3-zimosan sentrifuqa ilə qranullandıqdan sonra, afinite ilə təmizlənmiş siçan əleyhinə C3 olan supernatant 4°C-də 1 L PBS-yə qarşı 3 dəfə dializ edildi. C3-zimosan 3 dəfə PBS ilə yuyuldu və gələcəkdə təkrar istifadə üçün -85°C-də dondurulmuş halda saxlandı. Dializ edilmiş siçan əleyhinə C3 istehsalçının protokoluna (Molecular Probes, Eugene, OR) uyğun olaraq spin sütun etiketləmə dəstindən istifadə edərək Oregon Green ilə birləşdirildi. C3 ilə örtülmüş hüceyrələrin rənglənməsi üçün optimal seyreltmə siçan C3-opsonlaşdırılmış şiş hüceyrələri və axın sitometriyasından istifadə etməklə müəyyən edilmişdir və bu seyreltmə BM hüceyrələrinin rənglənməsi üçün istifadə edilmişdir.

SB 290157 toksiklik tədqiqatları

Hüceyrə proliferasiyası/sağ qalma analizləri üçün fare və ya insan BM MNC-ləri, insan CD34+ hüceyrələri, həmçinin insan K-562, HL-60 və Jurkat hematopoetik hüceyrə xətləri SB 290157 (0-5 μg/mL) ilə 6 inkubasiya edilmişdir. saat 37 ° C-də. BM MNC-ləri daha sonra koloniya əmələ gətirən vahid-qranulosit makrofaq (CFU-GM) koloniyaları üçün qranulosit-makrofaq koloniya stimullaşdırıcı amil (GM-CSF) + interleykin-3 (IL-3) iştirakı ilə serumsuz metilselüloz kulturalarına döşəndi. , eritropoietin (EPO) + kök hüceyrə faktoru (SCF) partlayan vahid eritroid (BFU-E) koloniyaları üçün və təsvir edildiyi kimi CFU-meqakaryositik (Meg) koloniyaları üçün trombopoietin (TPO). 23 Ters çevrilmiş mikroskopdan istifadə edərək, siçanın hematopoetik koloniyaları 7-ci gündə, insan hematopoetik koloniyaları isə 12-ci gündə hesablandı. Hüceyrə xətləri 7 gün ardıcıl olaraq kulturalandı. Hüceyrə xətlərinin çoxalması metil tiazolil tetrazolium (MTT) analizi, 26 və Annexin V boyanması (R&D Systems, Minneapolis, MN) və tripan mavisi xaric edilməsi ilə təsvir edildiyi kimi təhlil edilib. 26

CFU-dalaq (CFU-S) analizləri üçün dişi BALB/c siçanları (4-6 həftəlik) öldürücü γ-şüalanma dozası (900 cGy) ilə şüalanmışdır. 24 saatdan sonra siçanlar SB 290157 (6 saatda 5 μg/mL) ilə müalicə olunan və ya müalicə olunmayan wt siçanlarından əldə edilən 5 × 10 5 BM MNC ilə quyruq damarı inyeksiyası ilə transplantasiya edildi. 12-ci gündə onların dalaqları çıxarılaraq Tellysyniczky fiksatorunda fiksasiya olundu və CFU-S koloniyaları daha əvvəl təsvir edildiyi kimi böyüdücü şüşədən istifadə edərək dalağın səthində sayıldı. 9,22

Kalsium axınının analizi

Qısaca, hüceyrələr 1-2 μM Fura-2/AM (Molekulyar Problar) ilə 30°C-də 30 dəqiqə inkubasiya edildi. İnkubasiyadan sonra hüceyrələr bir dəfə yuyuldu, iribuynuzlu dana serumu (BCS) olmadan yükləmə tamponunda yenidən dayandırıldı, 5 μg/mL SB 290157 varlığında və ya olmamasında SDF-1β (500 ng/mL) ilə stimullaşdırıldı və bir saat ərzində təhlil edildi. əvvəl təsvir edildiyi kimi. 9

Hüceyrədaxili yol zülallarının fosforilasiyası

Hüceyrələri sakitləşdirmək üçün aşağı səviyyəli iribuynuzlu zərdab albumini (BSA, 0,5%) olan RPMI mühitində saxlanılan CD34 + hüceyrələrindən hazırlanmış ekstraktlarda Western blot analizi aparıldı. Hüceyrələr daha sonra SB 290157 (250 μM) varlığında və ya olmamasında 37°C-də 10 dəqiqə ərzində SDF-1 (300 ng/mL) və ya C3a (1 μg/mL) ilə stimullaşdırılıb və 10 dəqiqə ərzində lizinq edilib. proteaz və fosfataz inhibitorlarını (Sigma Chemical) ehtiva edən M-Per lizinq tamponunda (Pierce, Rockford, IL) buz. Çıxarılan zülallar 10% natrium dodesil sulfat-poliakrilamid gel elektroforezi (SDS-PAGE) gelində ayrıldı və nitroselüloz membranına köçürüldü (Hybond electrochemiluminescence [ECL] Amersham Life Science, Little Chalfont, Birləşmiş Krallıq). AKT və 44/42 mitogenlə aktivləşdirilmiş protein kinaz (MAPK) zülallarının fosforilasiyası siçan monoklonal 44/42 fosfo-spesifik MAPK anticisimindən və dovşan fosfo-spesifik poliklonal anticisimdən (hamısı New England, Biolab, MA-dan) istifadə edərək protein immunoblotinqi ilə aşkar edilmişdir. ) qalan zülalların hər biri üçün, təsvir edildiyi kimi, xren peroksidazı ilə birləşmiş keçi anti-siçan IgG və ya keçi anti-dovşan IgG (Santa Cruz Biotechnology, Santa Cruz, CA) ilə. 26-29 Zolaqlarda bərabər yüklənmə ləkələrin soyulması və müvafiq monoklonal və ya poliklonal antikorlarla reprobasiyası ilə qiymətləndirilib: p42/44 anti-MAPK antikor klonu 9102 və anti-AKT antikor klonu 9272 (New England Biolabs). Membranlar ECL reagenti (Amersham Life Science) ilə hazırlanmış, qurudulmuş və filmə məruz qalmışdır (HyperFilm Amersham Life Science).

Radiasiya kimeralarının mobilizasiyası

Normal (wt) və ya C3aR nokautlu (KO) heyvanlar öldürücü şüalanmaya məruz qaldılar (850 cGy) və 24 saat sonra retro-orbital pleksus vasitəsilə ya wt, ya da KO heyvanlarından 5,5 × 10 6 BM MNC ilə transplantasiya edildi. Transplantasiya edilən heyvanların 5 həftə ərzində sağalmasına icazə verildi, bundan sonra onlar 3 gün ardıcıl olaraq G-CSF (250 μg/kq) ilə səfərbər olundular. Onların PB təsvir edildiyi kimi dövriyyədə olan CFU-GMs/100 μL sayına görə qiymətləndirilib. 5 Transplantasiya edilən heyvanların kimerizmi ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) istifadə edərək real vaxtda PCR ilə təsdiq edilmişdir. QIAamp DNT mini dəsti (Qiagen, Valencia, CA) istifadə edərək həm PB, həm də BM MNC-lərdən DNT təcrid edilmişdir. Ağırlıq və ya KO DNT-nin xüsusi aşkarlanması wt DNT-də (A201-5′-GAG AAT CAG GTG AGC CAA GGA GAA-3′) və ya Neo kasetdə (NeoA-5′-TGG GCT) ekson 2 üçün spesifik primerlərdən istifadə etməklə həyata keçirilmişdir. KO DNT-də CTA TGG CTT CTG AGG CGG AAA G-3′) və kodlaşdırılmayan bölgədə ümumi primer (C1-5′-TAC AAT ATA GTC AGT TGG AAG TCA GCC-3′). Ümumi DNT hər 3 primerdən istifadə etməklə hesablanıb. Reaksiyalar ümumi DNT-yə normallaşdırıldı və ΔCT dəyərləri 2-ΔCT tənliyindən istifadə edərək qat dəyişikliklərinə çevrildi. DNT-nin ümumi miqdarına nisbətdə faiz fərqi hesablanmışdır.

Statistik təhlil

Arifmetik vasitələr və standart kənarlaşmalar Instat 1.14 (Graphpad, San Diego, CA) proqram təminatından istifadə etməklə hesablanmışdır. Statistik əhəmiyyəti kimi müəyyən edilmişdir P .01-dən azdır. Məlumatlar Student istifadə edərək təhlil edilmişdir t cütləşməmiş nümunələr üçün sınaq.


Müzakirə

Anadangəlmə immunitet sistemi selikli qişalarda yaşayan bakteriyaları aşkar etmək və onlara cavab vermək üçün mükəmməl hazırdır (38, 39). Bununla belə, xroniki selikli qişa patogenləri immun cavabın bu aspektini alt-üst etmək üçün bir çox strategiya hazırlamışlar (40). H. pylori 100.000 ildən artıqdır ki, öz qohum insan ev sahibi ilə birlikdə inkişaf etmişdir və mədənin sərt mühitində onilliklər ərzində yaşamaq üçün unikal şəkildə uyğunlaşdırılmışdır (41). Bu, iltihabı stimullaşdırmaq üçün mexanizmlərin, eləcə də aşkarlanmadan yayınmaq və ev sahibinin immun cavabını aşağı salmaq üçün strategiyaların işlənib hazırlanmasını tələb etdi.

H. pylori digər kəskin selikli qişa patogenlərindəki müvafiq həmkarlarından fərqli olaraq fitri immun effektorları ilə qarşılıqlı təsir göstərən çoxsaylı patogenlə əlaqəli selikli qişa nümunələri ehtiva edir. Misal üçün, H. pylori FlaA TLR5-i aktivləşdirmək qabiliyyətinə görə iltihablı olmayan molekuldur (42). H. pylori LPS, zəifləmiş TLR4-vasitəçiliyi ilə cavab verən anergik lipid A nüvəsini ehtiva edir (43, 44). The cag T4SS peptidoqlikanı NOD1 (7-11) tərəfindən tanındığı ana hüceyrələrə çatdırır və NF-κB aktivləşdirilməsi NOD1 aktivləşdirilməsinə prototip cavab olsa da, biz və başqaları NOD1-in əvvəlcədən aktivləşdirilməsinin sonrakı prosesləri bastırdığını göstərmişik. H. pylori- mənfi əks əlaqə dövrəsinin aktivləşdirilməsi ilə induksiya edilmiş NF-κB siqnalı və peptidoqlikanın deasetilasiyası imkan verir H. pylori ev sahibinin rəsmiləşdirilməsindən yayınmaq (22, 45-47). Daha yeni iş NOD1-in cavab olaraq mədə iltihabını yatıra biləcəyini də göstərdi H. pylori. Tran və həmkarları. Bunu nümayiş etdirmək üçün qastritin siçan modelindən istifadə etmişdir H. pylori Nod1 siqnalı vasitəsilə Th2 immun cavablarının vasitəçisi olan IL33-ün aktivləşdirilməsini təşviq edir (48). Əhəmiyyətlisi, H. pylori cag + suşlar siçan mədə epitel hüceyrələrində xüsusi olaraq Nod1-i aktivləşdirərək mədə mukozasında və splenositlərdə IL33 səviyyəsinin artmasına gətirib çıxarır ki, bu da IFNγ cavablarının azalması ilə əlaqələndirilir (48). Hazırkı nəticələrimiz bu məlumatlara uyğundur, çünki iki müstəqil modeldə Nod1 itkisi H. pylori– iltihab və zədələnmə mədə nişində zədələnməni artırdı. Bununla belə, aşağıdakı NF-κB aktivasiyasını tənzimləyə bilən əlavə yollar var H. pylori NOD1-dən asılı olmayan infeksiyalar. Gall və həmkarları. NF-κB aktivasiyasının TNF reseptoru ilə əlaqəli faktor (TRAF) ilə çəngəl başı ilə əlaqəli domen (TIFA) ilə qarşılıqlı əlaqədə olan zülal tərəfindən induksiya edilə biləcəyini və bunun NOD1 vasitəçiliyi ilə NF-κB aktivləşdirilməsindən asılı olmayaraq baş verdiyini nümayiş etdirdi (49). Bundan əlavə, NF-κB aktivləşdirilməsi aşağıdakı H. pylori infeksiya müvəqqəti olaraq tənzimlənən şəkildə baş verir, TIFA induksiyası erkən baş verir, sonradan NOD1-dən asılı NF-κB aktivasiyası (49). Fərqli eksperimental şəraitdə bu əlavə yolların seçici aktivləşdirilməsi Viala və həmkarları (7) tərəfindən dərc edilmiş əvvəlki nəticələrlə müqayisədə cari nəticələrimizdəki fərqləri izah edə bilər. Buna görə də, gələcək tədqiqatlar həm ilkin orqanoid sistemlərdə həm NOD1, həm də TIFA anadangəlmə immun siqnal yollarının, eləcə də hər iki WT-dən istifadə edərək infeksiyanın heyvan modellərinin qiymətləndirilməsinə diqqət yetirməlidir. H. pylori cag + qüsurlu suşlar və mutant suşlar cag sekresiya sistemləri, bu komponentlərin kombinator töhfələrini dəqiq şəkildə aydınlaşdırmaq üçün H. pylori patogenezi.

Bu araşdırmada, Nod1 −/− genotiplər mikrobların fenotipini dəyişməmişdir H. pylori T4SS funksiyası baxımından çıxış törəmələri. Bununla belə, Nod1-defisitli siçanlar kolonizasiya olunduqda WT siçanları ilə müqayisədə daha şiddətli iltihab inkişaf etdirdilər H. pylori funksiyasını özündə saxlayan suşlar cag T4SS. İltihabın bu artımına kömək edə biləcək fərqli host immun effektorlarını araşdırmaq üçün multipleks sitokin massivindən istifadə edərək, gözlənildiyi kimi müşahidə etdik ki, H. pylori infeksiya Th1, Th2 və Th17 sitokinlərinin səviyyəsini geniş şəkildə artırdı və bu dəyişikliklər Nod1 çatışmazlığının mövcudluğunda artırıldı. Bununla belə, Nod1 genotipi əsasında təbəqələşən fərqlər zaman keçdikcə azaldı. Bunu daha da araşdırmaq üçün biz təsirlərinin olduğu yenilikçi reduksionist sistemdən istifadə etdik H. pylori WT və ya Nod1 −/− tək epitel hüceyrələri və ya müxtəlif makrofaqlarla birləşmiş epitel hüceyrələri Nod1 genotip müəyyən edilə bilər. Həm epitel hüceyrələrində, həm də makrofaqlarda Nod1 itkisinin proinflamatuar sitokin istehsalını artırdığını müəyyən etdik. H. pylori infeksiya, NOD1-in ilk növbədə bu patogenə anadangəlmə immun cavablarını dəyişdirdiyi müddəasını daha da dəstəkləyir.Bununla belə, bu hüceyrə komponentlərinin hər birinin müvafiq töhfələrini daha tam müəyyən etmək üçün həm fərdi, həm də kombinasiyada Nod1-dən asılı siqnalın makrofaq və mədə epitelial hüceyrə komponentinin aradan qaldırılması tələb olunur. Bu keçid yolu ilə edilə bilər Nod1-floxed siçanlar və Foxa3-Cre siçanlar (ifadəsini istiqamətləndirən Cre mədə epitelinə rekombinaz ref. 50) klodronat liposomları kimi agentlərdən istifadə edərək makrofaqların seçici tükənməsi ilə birlikdə və bizim cari nəticələrimiz bu gələcək tədqiqatlar üçün mühüm bir çərçivə təmin etmişdir.

arasında sitokin səviyyələrindəki fərqlərə əlavə olaraq Nod1 +/+ və Nod1 −/− siçanlar, biz C57BL/6-nı INS-GAS FVB/N siçanları ilə müqayisə edərkən müəyyən sitokinlərin səviyyələrində də fərqlər tapdıq. Bu nəticələr, ehtimal ki, tədqiq olunan siçanların genetik fonlarında fərqləri, eləcə də insan qastrini transgenini daşıyan INS-GAS siçanlarına xas olan hiperqastrinemiyanın mövcudluğunu əks etdirir (51). Qastrin mədə epitel hüceyrələrinə böyümə faktoruna bənzər təsir göstərir, bu da müəyyən kemokinlərin və sitokinlərin istehsalına səbəb ola bilər (51). Bundan əlavə, INS-GAS siçanları əvvəllər C57BL/6 siçanları ilə müqayisədə kanserogenez riskini artırdığı nümayiş etdirilən FVB/N genetik fonundadır. Xüsusilə, bu, daxilindəki bir polimorfizmlə əlaqədar ola bilər Ptch1 Hedgehog gen ailəsinin liqandları üçün inhibitor reseptoru kodlayan gen (52). Nəticələrimiz kontekstində, digərləri ilə yanaşı, INS-GAS-da IL9-un ifadə səviyyələrinin aşağı salınması diqqətəlayiq idi. Nod1 −/− siçanlar C57BL/6 ilə müqayisədə Nod1 −/− siçanlar. IL9 Th9 hüceyrələri tərəfindən istehsal olunan bir sitokindir, CD4 + T hüceyrələrinin bir alt populyasiyasıdır və bir sıra tədqiqatlar IL9-un şiş böyüməsini boğduğunu nümayiş etdirdi (53, 54). Beləliklə, IL9 səviyyəsi azalır H. pylori– yoluxmuş INS-QAS Nod1 −/− siçanlar bu patogenlə infeksiyadan sonra bu siçanlarda görülən inkişaf etmiş kanserogen fenotipə kömək edə bilər.

Xüsusi bir iltihablı niş daxilində funksional makrofaq fenotiplərinin tərkibindəki dəyişikliklər kanserogenez riskini əhəmiyyətli dərəcədə dəyişə bilər (55). M1 (klassik olaraq aktivləşdirilmiş) makrofaqlar hüceyrədaxili mikrobisid fəaliyyəti ilə və Th1 tipli cavabı təşviq edən iltihab vasitəçiləri ifraz etməklə patogenləri təmizləyir, eyni zamanda Th2 tipli cavabları zəiflədir (55). M2 (alternativ olaraq aktivləşdirilmiş) makrofaqlar, Th1 reaksiyalarını zəiflətməklə yanaşı, Th2-yə yönəlmiş reaksiyaları təşviq edən hüceyrədənkənar matrisin komponentlərini və iltihab əleyhinə effektorları ifraz etməklə yaraların sağalmasını təşviq edir (5). Mregs (tənzimləyici makrofaqlar) həm də antiinflamatuardır, lakin hüceyrədənkənar matrisi saxlamır (55). Epitel qastroidindən istifadə etməklə əldə etdiyimiz nəticələr: makrofaq kokulturaları ilə və ya olmayan H. pylori NOD1-in makrofaqların qütbləşməsində çox güman ki, rol oynadığını aşkar etdi, çünki epitelial hüceyrələrlə birgə kulturasiya edilən Nod1 WT makrofaqları təsirindən sonra dərin M1 fenotipi inkişaf etdirdi. H. pylori yoluxmuş tərəfindən nümayiş etdirilən qarışıq M1/M2 fenotipi ilə müqayisədə Nod1 −/− makrofaglar. Belə bir hibrid fenotip Nod1 çatışmazlığı olan makrofaqları müvafiq Th1 və ya Th2-yə yönəlmiş cavabları səmərəsiz hala gətirə bilər və bununla da qlobal iltihabın daha şiddətli nümunəsinə gətirib çıxara bilər ki, bizim hazırkı nəticələrimiz gələcək işlərdə bu cür mexanizmləri müəyyən etmək üçün mühüm çərçivə yaradır. Beləliklə, NOD1-in makrofaq fenotiplərini tənzimləmək qabiliyyəti də H. pylori ev sahibinin immun klirensindən yayınmaq.

Nəticə olaraq, bu araşdırma göstərir ki, NOD1 itkisi iltihablı reaksiyaları artırır. H. pylori mədə kanserogenezi kontekstində. NOD1 makrofaqların qütbləşməsini dəyişdirərək öz məhdudlaşdırıcı rolunu yerinə yetirə bilər və bununla da immunitetdən yayınmağa və mikrobların davamlılığına səbəb ola bilər. Bu tədqiqatlar NOD1-in rolunun daha çox araşdırılması üçün əsas yaradır.H. pylori insan ev sahibləri ilə qarşılıqlı əlaqə və NOD1 manipulyasiyasının səbəb olduğu patoloji nəticələrin qarşısını almaq və ya müalicə etmək üçün yeni bir strategiya təqdim edə biləcəyini təklif edir. H. pylori infeksiya.


Məlumat və materialların mövcudluğu

ESC və NPC-lər üçün dərc edilmiş Hi-C ardıcıllıqları NCBI GEO verilənlər bazasından GSE96107 [63] əldə edilmişdir. Bu tədqiqatda yaradılan işlənməmiş ChIP-seq, RNT-seq və 4C-seq ardıcıllıqları Avropa Nukleotid Arxivindən (EMBL-EBI ENA) PRJEB28762 [64] qoşulma nömrəsi altında əldə edilə bilər. İşlənmiş 4C-seq qarşılıqlı əlaqə nümunələri Mendeley Məlumat anbarında mövcuddur [65]. Xam mikroskopiya məlumatları Figshare repozitoriyasından əldə edilə bilər [66].


Giriş

Adenozin kritik immunosupressiv metabolitdir, iltihab və toxuma zədələnməsi zamanı həddən artıq həssas immun reaksiyadan qorunmaq üçün zəruridir (1). Hipoksiya və hüceyrədənkənar stressə cavab olaraq, adenozin ektonükleotidaz CD39 və CD73 tərəfindən ATP-dən əmələ gəlir və dörd G-proteinlə birləşmiş adenozin reseptorları (A1, A2A, A2B və A3 refer. 2 tərəfindən nəzərdən keçirilir) vasitəsilə siqnal verir. Yüksək yaxınlıqlı A2A adenozin reseptoru (A2AR) limfositlərdə yüksək şəkildə ifadə edilir və onların fəaliyyətini ləğv etdiyi sübut edilmişdir. Şiş mikromühitində (TME) A2AR vasitəsilə adenozin siqnalı CD8 + T və təbii öldürücü (NK) hüceyrələrin infiltrasiyasını və funksiyasını maneə törətməklə effektiv antitümör immun cavabın qarşısını alır (3-6). Bundan əlavə, A2AR siqnalının makrofaqların aktivləşdirilməsini maneə törətdiyi (7) və T-limfositlərin proliferasiyasına, astarlanmasına və sitokin istehsalına təsir göstərdiyi, immunosupressiv T tənzimləyici hüceyrələrin xeyrinə polarizasiyaya səbəb olduğu göstərilmişdir (8-10). Homeostazda, A2AR çatışmazlığı olan siçanlar sadəlövh CD44 və CD4 + və CD8 + T hüceyrələrinin azalması göstərir, adenozin siqnalının T-hüceyrəsinin saxlanması üçün kritik olduğunu göstərir (11). Bununla belə, A2AR siqnalının NK hüceyrələrinə təsirini başa düşmək ekzogen adenozin və adenozin analoqlarına cavab olaraq azalmış sitotoksiklik və sitokin istehsalı ilə məhdudlaşır. in vitro (4, 12, 13).

1-ci qrup anadangəlmə limfoid hüceyrələrə həm NK hüceyrələri, həm də tip 1 anadangəlmə limfoid hüceyrələri (ILC1) daxildir, sonuncular toxumalarda yaşamaq üçün daha məhduddur (14). NK hüceyrələri anormal çevrilmiş və ya yoluxmuş hüceyrələrin sürətli tanınması üçün vacib olan anadangəlmə effektor limfositlərdir. Onların funksiyası sitotoksik qranulların və iltihaba qarşı sitokinlərin sərbəst buraxılmasını diktə edən hüceyrə səthində mövcud olan aktivləşdirici və ya inhibitor reseptorların birləşməsindən asılıdır (14, 15). Funksional olaraq fərqli NK hüceyrə yetişmə alt qrupları siçanlarda (16-18) CD11b/CD27/KLRG1 və DNAM-1 və insanlarda (19) CD56/CD16 ifadəsi ilə fərqlənir. IL15 siqnalı və transkripsiya faktorları EOMES, GATA-3, AIOLOS, ZEB2 və T-BET daxil olmaqla bir sıra yollarda çatışmazlıq yetkin NK hüceyrələrinin inkişafına mane olur (20-24). Bununla belə, NK hüceyrələrinin olgunlaşmasına səbəb olan tənzimləyici yollar zəif müəyyən edilmiş qalır. Bu yaxınlarda, FOXO1 çatışmazlığı olan NK hüceyrələri olan siçanlarda funksional yetkin NK hüceyrələrinin yığılması müəyyən edilmişdir (25). Sürətli təsir göstərən, antigen-müstəqil ev sahibi immun cavabı yaratmaq qabiliyyətinə görə, NK hüceyrələri getdikcə terapevtik potensialları üçün nəzərdən keçirilir. Funksional yetkin NK hüceyrələrinin yığılmasını gücləndirən yolların müəyyən edilməsi böyük maraq doğurur.

Burada göstəririk ki, A2AR siqnalında çatışmazlıq homeostazda NK-hüceyrələrinin olgunlaşmasını artırır, terminal yetkin NK hüceyrələri artan funksiya və antitümör toxunulmazlığı nümayiş etdirir. Hal-hazırda, A2AR antaqonistləri tək və ya digər immunoterapiyalar (NCT02655822 və NCT02403193) ilə birlikdə bərk şişlərdə təhlükəsizliyi və effektivliyi üçün klinik sınaqlardan keçirilir. Nəticələrimizə əsasən, A2AR antaqonistlərinin NK hüceyrə əsaslı immunoterapiyanın effektivliyini gücləndirmək üçün köməkçi terapiya kimi istifadəsi nəzərə alınmalıdır.


Metodlar

MRNT ifadə analizi

İnsan çoxlu toxuma massivi (MTE™) Clonetech laboratoriyalarından alınıb (Kat. #775-1). Tərkibində səkkiz müxtəlif təsərrüfat geninin ifadəsi üçün normallaşdırılmış miqdarda mRNT var. Hibridləşmə üçün istifadə edilən P32 radioaktiv etiketli cDNA zondu insanın tam uzunluqlu konstruksiyasının EcoRI məhdudiyyəti ilə əldə edilən pleksin hüceyrədənkənar domenini kodlayan 4 kb divergent ardıcıllığı ehtiva edir. Hibridləşdirmə istehsalçı tərəfindən təqdim olunmuş protokola uyğun olaraq Ultrahybe ® məhlulundan (Ambion Austin, TX, ABŞ) istifadə edilməklə həyata keçirilmişdir.

İnsan Göbək Damarının Endotel Hüceyrələrində (Cambrex) plexin ifadəsi Applied Biosystem (PlexinB1 üçün Hs00182227_m1 və Ple üçün Hs00367063_m1) tərəfindən təmin edilən gen-spesifik primer cütlərindən istifadə edərək RT-PCR ilə aşkar edilmişdir.


Endogen T hüceyrələri övladlığa götürülmüş T hüceyrə terapiyasından sonra şişin immun çıxışının qarşısını alır

McMaster İmmunologiya Araşdırma Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

McMaster İmmunologiya Araşdırma Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

Simovic, B. tərəfindən məqalələr tapın: JCI | PubMed | Google Alim

McMaster İmmunologiya Araşdırma Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

McMaster İmmunologiya Araşdırma Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

McMaster İmmunologiya Araşdırma Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

McMaster İmmunologiya Tədqiqat Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

Stephenson, K. tərəfindən məqalələri tapın: JCI | PubMed | Google Alim

McMaster İmmunologiya Tədqiqat Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

McMaster İmmunologiya Tədqiqat Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

Bramson, J. tərəfindən məqalələr tapın: JCI | PubMed | Google Alim

McMaster İmmunologiya Araşdırma Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

McMaster İmmunologiya Araşdırma Mərkəzi, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Hamilton, Ontario, Kanada.

Yazışmaları ünvanlayın: Yonghong Wan, Patologiya və Molekulyar Tibb Departamenti, McMaster Universiteti, Otaq MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Kanada, L8N 3Z5. Telefon: 905.525.9140 daxili. 22461 E-poçt: [email protected]

4 noyabr 2019-cu il tarixində nəşr olundu - Ətraflı məlumat

Övladlığa götürülmüş T hüceyrə terapiyasının (ACT) nəticəsi adətən aşılanmış T hüceyrələrinin funksionallığı ilə əlaqəli olsa da, endogen T hüceyrələrinin rolu məlum deyil. Yoxlama məntəqəsinin blokadası terapiyasının müvəffəqiyyəti xərçəng müalicəsində əvvəlcədən mövcud olan şişlə hazırlanmış T hüceyrələrinin potensial müalicəvi əhəmiyyətini nümayiş etdirdi. Yoxlama məntəqəsi blokadası terapiyasının nəticələrini nəzərə alaraq, biz endogen T hüceyrələrinin ACT-dən sonra uzunmüddətli sağ qalmağa kömək etdiyini fərz etdik. Burada biz köçürülmüş və endogen T hüceyrələrinin vasitəçiliyi ilə antitümör toxunulmazlığının eyni vaxtda təhlilinə imkan verən ACT ilə onkolitik peyvəndi birləşdirən terapevtik yanaşmanı təsvir edirik. Köçürülmüş T hüceyrələrinin genişlənməsini və şiş infiltrasiyasını təşviq etməklə yanaşı, onkolitik peyvəndlərin şişlə astarlanmış host T hüceyrələrini gücləndirdiyini gördük. Köçürülmüş T hüceyrələrinin böyük şiş kütlələrinin sürətlə məhv edilməsinə töhfə verdiyini, endogen T hüceyrələrinin eyni zamanda antigen itkisi variantlarının yaranmasının qarşısını aldığını müəyyən etdik. Üstəlik, köçürülmüş T hüceyrələri şiş reqressiyasından qısa müddət sonra yoxa çıxsa da, endogen T hüceyrələri antigen spesifikliyinin geniş repertuarı ilə uzunmüddətli yaddaşı təmin etdi. Nəticələrimiz göstərir ki, bu kombinasiya strategiyası ACT və şişlə hazırlanmış host T hüceyrələrinin bütün potensialından istifadə edərək, birincil şişi aradan qaldırmaq, immun qaçışın qarşısını almaq və uzunmüddətli qoruyucu yaddaş təmin edə bilər.

Toplanan korrelyativ sübutlar göstərir ki, host T hüceyrələri şiş antigenlərinin tanınması yolu ilə böyüyən şişə cavab olaraq kortəbii şəkildə aktivləşdirilə bilər. Xüsusilə, çoxlu sayda mutasiyaları saxlayan şişlərin immun sistemi tərəfindən yad olaraq tanınan neoantigenlərin immunogenliyi səbəbindən endogen T hüceyrələrini aktivləşdirmə ehtimalı daha yüksəkdir və bununla da T hüceyrələrinə hücum üçün hədəflər təmin edilir (1). Bu tapıntıların klinik əhəmiyyəti, mutasiya yükü və şişlə hazırlanmış T hüceyrəsi populyasiyalarının mövcudluğuna əsaslanan immun nəzarət məntəqəsinin blokadası ilə müalicənin nəticəsi arasında korrelyasiya ilə vurğulanmışdır (2-5). Bununla belə, mutant antigenlərə qarşı spontan T hüceyrə reaksiyaları nisbətən səmərəsizdir və əksər hallarda şişin rədd edilməsinə vasitəçilik edə bilmir. Həqiqətən, xəstələrin yalnız bir hissəsinin immun nəzarət məntəqəsinin blokadasına davamlı reaksiyalar göstərməsi faktı göstərir ki, bütün xəstələrdə şişləri bir dəfə açdıqdan sonra aradan qaldırmaq üçün kifayət qədər şişlə hazırlanmış T hüceyrələri yoxdur.

Antigen-spesifik T hüceyrələri ilə qəbul edilmiş T hüceyrə terapiyası (ACT) bədxassəli şişlərin müalicəsi üçün nəzarət nöqtəsi inhibitor müalicələrinə əla alternativdir (6). Sağlam şiş spesifik T hüceyrələri in vitro yetişdirilə bilər və çoxlu sayda inkişaf etmiş xəstəliyi olan xəstələrə infuziya edilə bilər və bununla da xərçəng xəstələrində spontan T hüceyrə reaksiyalarının qeyri-kafiliyini aradan qaldıra bilər. Əhəmiyyətli olan odur ki, şişə xas funksional T hüceyrələrini in vitro (7-9) təbliğ etmək üçün klinik metodologiyalar işlənib hazırlanmışdır və leykemiya, melanoma, neyroblastoma və EBV ilə əlaqəli bədxassəli şişlərdə son klinik uğurlar ACT-nin həyati və effektiv strategiya olduğunu sübut etmişdir. insanlar (10-14). Bununla belə, ACT-nin müvəffəqiyyəti üçün zəruri addım T hüceyrələrini infuziya etməzdən əvvəl ev sahibinin limfodeplete edilməsidir, bu proses müəyyən xəstələr üçün yüksək toksikdir (15-17). Bundan əlavə, ilkin şərtləşdirmə övladlığa götürülmüş T hüceyrələri üçün əlverişli mühit yarada bilsə də (yəni, tənzimləyici T hüceyrələrinin və homeostatik sitokinlərin “batması”nın aradan qaldırılması), o, həm də əvvəlcədən mövcud olan şişlə hazırlanmış T hüceyrələrini aradan qaldırır və bu, mümkün olmasa da, çətinləşdirir. ACT kontekstində endogen antitümör toxunulmazlığının rolunu və faydasını müəyyənləşdirin.

Şişlə əlaqəli antigenləri ifadə etmək üçün hazırlanmış onkolitik virusların (OVs) şişi birbaşa yoluxdurmaq və parçalamaq və immunosupressiv şiş mikromühitini geri qaytarmaq qabiliyyətini qoruyarkən, şişə xas yaddaş T hüceyrələrini effektiv şəkildə birləşdirə və genişləndirə biləcəyini bildirdik (18, 19). ). Bu tədqiqatda biz rabdovirus və vaccinia virus əsaslı (VacV əsaslı) onkolitik peyvəndlərin qəbul edilmiş T hüceyrələrinin sistemli genişlənməsini və şiş infiltrasiyasını sürətləndirmək üçün istifadəsini araşdırdıq və bununla da ACT-nin terapevtik effektivliyini artırdıq. Bu rasional birləşmə, antitümör T hüceyrə reaksiyalarına dəstək verən virus tərəfindən törədilən proinflamatuar sitokinlərin ehtimal olunan nəticəsi olan əvvəlcədən şərtləşmə olmadığı halda şişin tam və davamlı reqressiyası ilə nəticələndi (20). Bu modeldən istifadə edərək, biz eyni vaxtda köçürülmüş və endogen T hüceyrələrinin terapevtik təsirə töhfəsini izlədik. Məlumatlarımız göstərir ki, əvvəlcədən mövcud olan, şişlə hazırlanmış host T hüceyrələri ACT tərəfindən davamlı reqressiyaya nail olmaq və uzunmüddətli immun yaddaş üçün antigen qaçış variantlarının qarşısını almaq və/və ya aradan qaldırmaq üçün çox vacibdir.

ACT-nin onkolitik vaksinlərlə birləşməsi şişin tam reqressiyasına və uzunmüddətli qoruyucu toxunulmazlığa səbəb olur. Rabdoviral OV peyvəndlərinin (OVVs) eyni vaxtda periferiyada mövcud olan mərkəzi yaddaş T hüceyrələrinin (Tcm) effektiv genişlənməsinə və şişə sürətli cəlb edilməsinə təkan vermək üçün unikal qabiliyyəti ilə motivasiya edilmiş (18, 19, 21), biz ACT-nin birləşməsini araşdırdıq. Yerləşmiş bərk şişləri müalicə etmək üçün onkolitik vezikulyar stomatit virusu (VSV) vaksinləri ilə in vitro-differensiallaşdırılmış şiş antigeninə spesifik Tcm. WT BALB/c siçanları dəridaxili olaraq (i.d) CMS5 hüceyrələri, ERK2 genindəki mutasiyadan (ErkM) əldə edilən müəyyən edilmiş neoepitopu ifadə edən metilxolantrenin səbəb olduğu fibrosarkoma ilə sınaqdan keçirilmişdir.136–144, QYIHSANVL) ( 22 ). ErkM136–144-DUC18 transgen siçanlarından (23) spesifik CD8 + T hüceyrələri IL-15, IL-21 və rapamisinin iştirakı ilə yetişdirildi və genişləndi, bu da tipik Tcm fenotipinin (CD62L + CD44 +) alınmasına səbəb oldu (Əlavə Şəkil 1A) əlavə materialı bu məqalə ilə onlayn əldə etmək olar https://doi.org/10.1172/JCI126199DS1). 6 günlük şiş böyüməsindən sonra siçanlar i.v. 10 6 DUC18 Tcm, 10 8 PFU VSV-ErkM və ya DUC18 Tcm kombinasiyasının 24 saat sonra VSV-ErkM tərəfindən vurulması. Biz i.v. test etməyi seçdik. yalnız VSV-nin tətbiqi, çünki əvvəllər göstərdiyimiz kimi, bu, Tcm-i artırmaq üçün periferiyada həm antigen təqdimatına nail olmaq, həm də onkoliz üçün şişin infeksiyası və VSV peyvəndi ilə T hüceyrələrinin cəlb edilməsi üçün optimal yoldur (18, 19).Həqiqətən, VSV-nin intratumoral enjeksiyonu köçürülmüş T hüceyrələrini ardıcıl olaraq effektiv səviyyəyə yüksəldə bilmədi və şişin reqressiyasına səbəb ola bilmədi (məlumatlar göstərilmir). Şəkil 1A göstərir ki, nə tək Tcm, nə də tək VSV peyvəndi şişin böyüməsinə əhəmiyyətli təsir göstərməyib, halbuki Tcm və VSV-ni gücləndirən peyvəndin birləşməsi şişin tam reqressiyasına və əhəmiyyətli dərəcədə uzun müddət sağ qalmasına səbəb olub (Şəkil 1B). Bununla belə, effektor DUC18 T hüceyrələri (Teff) (IL-2 Əlavə Şəkil 1A varlığında fərqlənir) tək və ya VSV-ErkM ilə birlikdə müalicə olunan bütün siçanlarda tam və davamlı şiş reqressiyasına səbəb ola bilmədi (Şəkil 1C) , köçürülmüş hüceyrələrin zəif davamlılığı ilə əlaqəli bir nəticə (məlumatlar göstərilmir). Baxmayaraq ki, VSV peyvəndi Teff köçürməsindən sonra sağ qalma müddətini əhəmiyyətli dərəcədə uzada bilsə də, Tcm plus VSV-ErkM tərəfindən törədilən reqressiya daha ardıcıl idi və sonrakı sağ qalma əvvəlki işimizə və mövcud anlayışımıza uyğun olaraq Teff əsaslı müalicələrə nisbətən əhəmiyyətli dərəcədə uzadıldı (Şəkil 1D) 19, 24).

Tcm və VSV-ErkM-nin birləşməsi şişin davamlı reqressiyasına gətirib çıxarır. BALB/c siçanları i.d. CMS5 hüceyrələri ilə DUC18 Tcm (10 6 hüceyrə/siçan) övladlığa götürülməsindən 7 gün əvvəl və göstərildiyi hallarda 24 saat sonra müəyyən edilmiş vaksin/virusla müalicə edilmişdir. Tək VSV-ErkM, tək Tcm və ya PBS qəbul edən siçanlar nəzarət kimi daxil edilmişdir. (A, C, və E) şiş həcmləri və (B, D, və F) CMS5 TB BALB/c siçanlarının sağ qalması müəyyən edilmiş dpt-də peyvəndin aşılama gününü təmsil edən 0 dpt ilə monitorinq edilmiş və mm 3 kimi ifadə edilmişdir. Sağ qalma təhlili üçün son nöqtə kimi 1000 mm 3 şiş həcmi istifadə edilmişdir. (G) Tcm plus VSV-ErkM ilə müalicədən sonra ilkin CMS5 şiş problemindən sağ çıxan siçanlar 60 gün sonra CMS5 hüceyrələri ilə təkrar sınaqdan keçirildi və sonrakı sağ qalma göstəricisi göstərilir. CMS5 hüceyrələri ilə mübarizə aparan bir qrup sadəlövh siçan nəzarət kimi daxil edilmişdir. Məlumatlar 4-dən reprezentativ nəticələr kimi göstərilir (AB), 3 (CF) və ya 2 (F) ilə müstəqil təcrübələr n = hər qrup üçün 5. Məlumatlar log-rank (Mantel-Cox) testindən istifadə etməklə təhlil edilmişdir (B, D, FG). *P < 0,05 **P < 0,01.

Tcm plus onkolitik peyvəndinkinə oxşar effektivliyə nail olmaq üçün tək Tcm plus OV (müəyyən bir şiş antigeni olmadan) və ya tək adi peyvəndin (onkolitik və ya şiş hədəfləmə fəaliyyəti olmadan) kifayət olub-olmadığını müəyyən etmək üçün biz VSV- də daxil olmaqla əlavə qrupları sınaqdan keçirdik. MT (ErkM transgeni yoxdur), ErkM (Ad-ErkM) ifadə edən replikasiya çatışmazlığı olan adenoviral vektor və poli I:C/CD40 antikoru ilə adjuvanlaşdırılmış ErkM peptidi (25). Şəkil 1, E və F-də göstərildiyi kimi, Tcm plus VSV-MT şişin böyüməsinə nəzarət edə bilmədi və ya sağ qalma müddətini uzatdı, bu, köçürülmüş T hüceyrələrini genişləndirmək və onları şişə cəlb etmək üçün antigenə xüsusi OV peyvəndinin tələb olunduğunu təsdiqləyir. Bu anlayışa uyğun olaraq, qeyri-kolitik peyvəndlərlə gücləndirmə VSV peyvəndi ilə müqayisədə daha az təsirli idi, müalicə olunan siçanların yalnız kiçik bir hissəsi tam şiş reqressiyası və uzun müddət sağ qalma nümayiş etdirdi (Şəkil 1, E və F).

CD8 + T hüceyrələrinin şiş infiltrasiyasını və onların şişdə lokalizasiyasını birbaşa görüntüləmək üçün biz ACT və ya ACT plus peyvəndindən sonra 5-ci gündə şiş toxumalarını ləkələdik. Şəkil 2-də göstərildiyi kimi, CD8 + T hüceyrələrinin peritumoral paylanması tək Tcm transferindən və Tcm plus peyvənddən sonra aydın oldu, lakin VSV-dən sonra şiş toxumasına dərindən nüfuz edən əhəmiyyətli dərəcədə daha çox CD8 + T hüceyrələri (Əlavə Şəkil 2) müşahidə edildi. artıraraq, OVV-lərin ACT kontekstində adi peyvəndlərə nisbətən fərqli üstünlüklər təklif etdiyini təsdiqləyir. Nəhayət, Tcm plus VSV-ErkM müalicəsindən sonra uzunmüddətli sağ qalanların 100%-i (60+ gün) terapiyanın dayandırılmasından 2 ay sonra CMS5 hüceyrələri ilə təkrar müraciəti rədd etdi və effektiv immunoloji yaddaşın formalaşmasını təklif edən əhəmiyyətli dərəcədə uzun sağ qalma göstərdi (Şəkil 1G).

OVV müalicəsi köçürülmüş CD8 + T hüceyrələrinin şiş nüvəsinə infiltrasiyasını təmin edir. Anti-CD8 antikoru ilə boyanmış CMS5 şiş toxumalarının mikroqrafikləri göstərilən müalicələrlə induksiya edilən T hüceyrələri ilə şişin nüvəsinin və periferiyasının nisbi infiltrasiyasını göstərir. Bütün şişin aşağı böyüdülən şəkilləri sol panellərdə, orta və sağ panellərdə isə şişin periferiyasının (qara qutularla təsvir edilmiş) və şiş nüvəsinin (mavi qutularla təsvir edilmiş) daha yüksək böyüdülmüş şəkilləri göstərilir. Ölçək çubuqları: 500 μm (sol panellər) 200 μm (mərkəz və sağ panellər).

Endogen ErkM-reaktiv CD8 + T hüceyrələrinin genişlənməsi və davamlılığı kombinasiya müalicəsi zamanı şiş tərəfindən müəyyən edilir. VSV peyvəndinin köçürülmüş T hüceyrələrinin taleyinə necə təsir etdiyini daha yaxşı başa düşmək üçün biz periferiyadakı T hüceyrələrinin cavablarını da izlədik. ErkM136–144-VSV peyvəndindən 2 gün sonra dövriyyədə spesifik CD8 + T hüceyrələrinin genişlənməsi aşkar edilə bilər, bu, 5-ci gündə zirvəyə çatır və sonra azalır (Şəkil 3A), CMS5 şişinin reqressiyasının kinetikası ilə üst-üstə düşür (Əlavə Şəkil 1B). Antigen-spesifik T hüceyrələrinin cavabları pikdən sonra azalsa da, onlar 2 aydan çox dövran edən CD8+T hüceyrələrinin təxminən 10%-də qaldılar (Şəkil 3A). Maraqlıdır ki, anadangəlmə markerlərdən istifadə edərək sonrakı təhlillər ErkM-in genişlənməsini göstərdi136–144– spesifik T hüceyrələri, müalicədən 5 gün sonra (dpt) qəbul edilmiş DUC18 hüceyrələri (Thy1.1 +) üstünlük təşkil edirdi, lakin 12 dpt-dən sonra endogen CD8 + T hüceyrələri (Thy1.2 +) ilə əvəz olundu (Şəkil 3B). Köçürülmüş DUC18 hüceyrələrinin dövriyyədən itkisinin diferensial lokalizasiya nəticəsində olub olmadığını müəyyən etmək üçün müalicədən sonra 60-cı gündə qan, dalaq və sümük iliyini təhlil etdik. ErkM-in əksəriyyəti136–144– spesifik T hüceyrələri, hər 3 bölmədə endogen CD8 + T hüceyrələri idi və bu, köçürülmüş DUC18 hüceyrələrinin şiş reqressiyasından sonra həqiqətən yoxa çıxdığını təsdiqləyir (Şəkil 3C). Bu müşahidə bizi ErkM-i qiymətləndirməyə sövq etdi136–144– şiş daşıyan (TB) siçanlarla müqayisədə şişsiz (TF) sadəlövh heyvanlarda VSV-ErkM tərəfindən idarə olunan spesifik T hüceyrə reaksiyaları. WT BALB/c siçanları 10 8 PFU VSV-ErkM ilə peyvənddən 1 gün əvvəl 10 6 DUC18 Tcm qəbul etdilər və VSV ilə müalicədən sonra 5, 12 və 19-cu günlərdə ErkM-ə məxsus T hüceyrə reaksiyalarına nəzarət edildi. Şəkil 3D göstərir ki, TF siçanlarında T hüceyrələrinin genişlənməsinin kinetikası vərəmli heyvanlardakı kimi idi, baxmayaraq ki, 12 dpt-də daralma sürəti əhəmiyyətli dərəcədə yavaş idi. Daha da əhəmiyyətlisi, aşkar edilmiş ErkM-nin əhəmiyyətli dərəcədə yüksək faizi136–144TF siçanlarında vərəm siçanları ilə müqayisədə (Şəkil 3E) bütün zaman nöqtələrində spesifik T hüceyrələri DUC18 mənşəlidir (Thy1.1 +), bu, (a) DUC18-in sağ qalmasında hüceyrə daxili qüsurlarının olmadığını və (b) onların ölümlərinin ehtimal ki, şiş hüceyrələri ilə qarşılıqlı əlaqənin nəticəsidir. Bu sonuncu fərziyyə, şişdəki CD8 + T hüceyrələrinin 90% -dən çoxunun VSV gücləndirilməsindən sonra 4-cü gündə Thy1.1 + olması (Şəkil 3F), lakin sonradan mütərəqqi apoptoza (4-cü gündə 32% -dən) məruz qalması faktı ilə dəstəkləndi. 6-cı gündə 95%-ə qədər) şişin reqressiya vaxtı ilə üst-üstə düşür. Bunun əksinə olaraq, ErkM-ə xas endogen T hüceyrələrinin genişlənməsi 12 dpt-ə qədər zirvəyə çatmadı (Şəkil 3B), bu, əhəmiyyətli sayda endogen T hüceyrələrinin birbaşa şişlə qarşılıqlı əlaqədə olmadığını və beləliklə yaddaş hovuzunda davam etdiyini göstərir.

ErkM-reaktiv CD8 + T hüceyrələrinin genişlənməsi və davamlılığı kombinasiya müalicəsi zamanı şişdən təsirlənir. (A) venoz qan təyin edilmiş dpt üzərində toplandı. Qarışıq terapiyanın virus komponenti və ErkM-ə xüsusi CD8 + T hüceyrə reaksiyalarının tezliyi qiymətləndirilmişdir. (B) dövriyyədə olan ErkM spesifik CD8 + T hüceyrələrinin ümumi hovuzunda övladlığa götürülmüş şəkildə köçürülmüş endogen hüceyrələrin nisbəti qapalı IFN-γ + hüceyrələrində Thy1.1 (köçürülmüş) və Thy1.2 (endogen) üçün spesifik antikorlar tərəfindən müəyyən edilmişdir. göstərilən vaxt nöqtələri. (C) Kombinasiya terapiyası nəticəsində yaranan CMS5 şişinin reqressiyasından 60 gün sonra siçanların qan, dalaq və sümük iliyindən toplanmış CD8 + T hüceyrələri ErkM spesifikliyi üçün qiymətləndirilmişdir. Qara nöqtələr ErkM-ə xüsusi CD8 + T hüceyrələrinin ümumi tezliyini, üst-üstə qoyulmuş boz qutular isə köçürülmüş ErkM-ə xüsusi CD8 + T hüceyrələrinin tezliyini təmsil edir. (D) ErkM-ə məxsus CD8 + T hüceyrə cavablarının böyüklüyü və (E) göstərilən vaxt nöqtələrində qiymətləndirildiyi kimi vərəm və TF siçanlarının dövriyyəsindəki ErkM-ə xüsusi CD8 + T hüceyrələrinin ümumi hovuzunda Thy1.1 + T hüceyrələrinin tezliyi. (F) Peyvənddən sonra 4-cü və 6-cı günlərdə Thy1.1 və anneksin V üçün kostainləşdirilmiş şiş-infiltrasiya edən CD8 + T hüceyrələrinin reprezentativ axın sitometriya profilləri göstərilir. Məlumatlar 3-ün nəticələrini əks etdirir (AB) və ya 2 (CF) ilə müstəqil təcrübələr n = hər qrup üçün 5. Məlumatlar 1-yollu ANOVA istifadə edərək təhlil edilmişdir (A), 2 quyruqlu t test (C) və ya çoxsaylı müqayisələr üçün Holm-Šidák korreksiyası ilə 2 tərəfli ANOVA-nı təkrar ölçün (B, D, və E). *P < 0,05 ***P < 0,001 ****P < 0,0001.

Qarışıq terapiya endogen lenfositlərin olmaması halında antigen itkisinə səbəb olur. CMS5 TB heyvanlarında endogen ErkM-reaktiv CD8 + T hüceyrələrinin effektiv genişlənməsinin və uzunmüddətli davamlılığının müşahidəsi bizi kombinasiya terapiyası ilə törədilən şiş reqressiyasında ev sahibi lenfositlərin rolunu qiymətləndirməyə sövq etdi. Yetkin limfositləri olmayan NRG siçanları i.d. 10 6 DUC18 Tcm üstəgəl 10 8 PFU VSV-ErkM ilə kombinasiya terapiyasından 6 gün əvvəl 10 6 CMS5 hüceyrəsi ilə aşılanmışdır. Şəkil 4, A və B, NRG siçanlarında tam şiş reqressiyasının əldə edildiyini göstərir və Tcm plus VSV-ErkM ilə müalicə olunan qrupda sağ qalma əhəmiyyətli dərəcədə uzansa da, bütün siçanlarda şişlər nəticədə residiv etdi. WT siçanlarında müşahidə olunduğu kimi, köçürülmüş T hüceyrələri şiş reqressiyasından sonra dövriyyədə aşkar olunmaz hala gəldi, lakin TF NRG siçanlarında əhəmiyyətli dərəcədə yüksək sayda Thy1.1+ hüceyrələri saxlanıldı (Şəkil 4C), bu da köçürülmüş T hüceyrələrinin taleyinin şişlə qarşılıqlı təsirindən təsirlənir. Təkrarlanan CMS5 şiş hüceyrələrinin artıq ErkM epitopunu ifadə edə bilməyəcəyini və beləliklə, DUC18 vasitəçiliyi ilə aradan qaldırıldığını fərz etdik. Bu ehtimalı yoxlamaq üçün daha 2 təcrübə keçirdik. Əvvəlcə WT BALB/c siçanlarında ya valideyn CMS5, ya da kombinasiya ilə müalicə edilmiş NRG siçanlarından (CMS5r) bərpa edilmiş residiv CMS5 hüceyrələrindən istifadə edərək şişlər qurduq, ardınca DUC18 Tcm plus VSV-ErkM ilə müalicə etdik. Şəkil 4D göstərir ki, davamlı reqressiya valideyn CMS5 hüceyrələrini daşıyan siçanlarda təkrarlanıb, lakin eyni müalicə CMS5r hüceyrələrini məhv edə bilmədi, nəticədə sağ qalma əhəmiyyətli dərəcədə azaldı (Şəkil 4E), CMS5r hüceyrələrinin ErkM-ə xüsusi CD8 + T hüceyrələri tərəfindən tanınmadığını təsdiqləyir. . İkincisi, CMS5, CMS5r və CT26-dan genomik DNT-nin PCR təhlili (aidiyyətsiz bir nəzarət hüceyrə xətti) göstərdi ki, residiv CMS5 hüceyrələri həqiqətən də ERK2 genində heterozigotluq itkisinə məruz qalıb, nəticədə mutant ERK2 allelinin aradan qaldırılması və buna görə də itki var. ErkM antigeninin (Şəkil 4, F–H). Nəhayət, gözlənildiyi kimi, CMS5r hüceyrələri DUC18 Teff hüceyrələri tərəfindən in vitro tərəfindən öldürülməyə davamlı idi, bu hüceyrələrdə ErkM peptidinin mühəndis şəkildə ifadəsi onları CMS5 hüceyrələrinə bənzər şəkildə öldürməyə həssas etdi və CMS5r-nin ErkM-ə xüsusi T hüceyrəsinə müqavimətini təsdiqlədi. lizis hədəf antigen ifadəsinin olmaması ilə bağlıdır, lakin digər dəyişikliklər deyil (Əlavə Şəkil 3). Bu nəticələr ACT zamanı antigen itkisi variantlarının immun seçimindən qaçmaqda endogen lenfositlərin mühüm rolunu vurğulayır.

Endogen limfositlər antigen-mənfi şiş hüceyrələrinin böyüməsinin qarşısını alır. NRG siçanları i.d. CMS5 hüceyrələri ilə DUC18 Tcm (10 6 hüceyrə/siçan) qəbuledici transferindən 7 gün əvvəl. Tcm transferindən bir gün sonra siçanlar i.v. VSV-ErkM (2 × 10 8 PFU/siçan) ilə. Tək VSV-ErkM, tək Tcm və ya PBS qəbul edən siçanlar nəzarət kimi daxil edilmişdir. (A) şiş həcmi və (B) müalicə olunan siçanların sağ qalması göstərilən dpt-də göstərilir. (C) Qarışıq terapiyadan sonra 3, 5, 12 və 19-cu günlərdə vərəm və TF NRG siçanlarının periferik qanında köçürülmüş (Thy1.1 + ) CD8 + T hüceyrələrinin sayı axın analizi ilə müəyyən edilmişdir. Tcm plus VSV-ErkM ilə müalicədən sonra ilkin CMS5 şiş problemindən sağ çıxan WT siçanları 60 gün sonra CMS5 residiv (CMS5r) hüceyrələri və sonrakı şiş böyüməsi ilə təkrar sınaqdan keçirildi (D) və sağ qalma (E) göstərilir. CMS5 qəbul edən sadəlövh siçanlar nəzarət kimi daxil edilmişdir. Məlumatlar 3 (AB) və ya 2 (CE) ilə müstəqil təcrübələr n = hər qrup üçün 5. Çoxsaylı müqayisələr üçün Holm-Şidak korreksiyası ilə təkrarlanan 2-yollu ANOVA ölçülərindən istifadə etməklə məlumatlar təhlil edilmişdir (C) və log-rank (Mantel-Cox) testi (BE). *P < 0,05 **P < 0,01. (F) ERK2 geninin genomik DNT amplifikasiyası nəticəsində yaranan PCR məhsulunun sxemi aşağıdakılarla göstərilmişdir. SfcErkM mutasiyası tərəfindən yaradılan I tanınma ardıcıllığı böyük hərflərlə göstərilir. Yaradılan gözlənilən fraqmentlər SfcWT ERK-dən (ErKwt üçün 356bp diapazonları) və mutant ERK allellərindən (ErKM üçün 260 və 96bp diapazonları) PCR amplikonlarının I həzmi nöqtəli mötərizədə göstərilir. (G) CT26 (mənfi nəzarət), CMS5 və CMS5r hüceyrə xətti genomik DNT-dən gücləndirilmiş PCR məhsullarının həzminin məhdudlaşdırılması, həmçinin (H) PCR məhsullarından ardıcıllığın nəticəsinin xromatoqramı.

Kombinasiya terapiyası zamanı şişin çıxmasının qarşısını almaq üçün həm endogen CD4+, həm də CD8+T hüceyrələri tələb olunur. Kombinasiya terapiyası zamanı residivin qarşısını almaq üçün tələb olunan endogen limfositlərin alt dəstini müəyyən etmək üçün biz DUC18 Tcm plus VSV-ErkM ilə müalicə olunan vərəm siçanlarında in vivo antikorların tükənməsi təcrübələri apardıq. CD4 və ya Thy1.2-yə qarşı antikorlar şiş inokulyasiyasından 1 gün əvvəl, anti-CD8 antikoru isə köçürülmüş DUC18 T hüceyrələrinə təsirinin qarşısını almaq üçün 1 həftə əvvəl verilmişdir. Müalicə olunan bütün siçanlarda endogen lenfositlərin selektiv tükənməsindən (Şəkil 5A) asılı olmayaraq şiş reqresiyası olmuşdur ki, bu da endogen lenfositlər üçün genetik cəhətdən çatışmayan müalicə olunan NRG siçanlarında (Şəkil 4A) müşahidələrə bənzəyir. Bununla belə, CD8 antikoru qəbul edən siçanların 80%-də və CD4 və ya Thy1.2 tükənməsi halında 100%-də residiv baş verib (Şəkil 5A), müalicədən sonra şişin təkrarlanmasının qarşısını almaq üçün həm endogen CD4+, həm də CD8+ T hüceyrələrinin tələb olunduğunu təsdiqləyir. ACT plus onkolitik peyvənd ilə. Biz həmçinin kombinasiya terapiyasından 1 gün əvvəl limfodeplesiya üçün tez-tez istifadə edilən kimya dərmanı olan siklofosfamid (CPX) qəbul edən bir qrupa daxil olduq (26, 27). Antikor müalicəsi ilə baş verənlər kimi, CPX ilkin şiş reqressiyasına təsir etmədi, lakin bütün heyvanlar 2 həftə ərzində residiv etdi (Şəkil 5A). Bütün antikorların tükənməsi və CPX müalicələri sağ qalmanın əhəmiyyətli dərəcədə azalması ilə nəticələndi (Şəkil 5B)

Kombinasiya terapiyası zamanı şişin çıxmasının qarşısını almaq üçün həm endogen CD4+, həm də CD8+T hüceyrələri tələb olunur. CMS5 TB BALB/c siçanları kombinasiya müalicəsi ilə müalicə ilə eyni vaxtda göstərilən antikor və ya CPX ilə müalicə yolu ilə spesifik limfosit populyasiyalarının tükənməsi və nəticədə şiş böyüməsi (A) və sağ qalma (B) monitorinq edildi. Antikorlar T hüceyrələrinin köçürülməsindən 1 gün əvvəl və 1 gün sonra və bundan sonra 3 həftə ərzində həftədə bir dəfə verildi. T hüceyrələrinin köçürülməsindən 1 gün əvvəl bir dəfə CPX enjeksiyonu verildi. (C) Periferik qanda antigen-yayıcı CD8 + T hüceyrə reaksiyalarının tezliyi əvvəllər müəyyən edilmiş CMS5 neoepitoplarına (27) uyğun gələn 4 peptid hovuzu ilə stimullaşdırma və IFN-γ istehsalı üçün boyanma yolu ilə ölçüldü. (D) Kombinasiya terapiyasından (60+ gün) sonra ilkin CMS5 şiş problemindən sağ qalan BALB/c siçanlarının periferik qanında ErkM-spesifik T hüceyrələrinin tezliyi CMS5 və ya CM5 residiv (CMS5r) hüceyrələri ilə təkrar sınaqdan əvvəl və 5 gün sonra qiymətləndirilmişdir və nəticədə sağ qalma (E) də göstərilir. CMS5 və ya CMS5r problemini qəbul edən sadəlövh siçanlar nəzarət kimi daxil edilmişdir. (F) CMS5 və ya CMS5r hüceyrələri ilə sınaqdan əvvəl öldürücü şüalanmış CMS5r hüceyrələri (irrCMS5r) ilə peyvənd edilmiş siçanların sağ qalması. (G) Göstərilən antikorlarla limfosit populyasiyalarının tükənməsindən sonra CMS5r ilə yenidən sınaqdan keçirilmiş şişlə geriləmiş siçanların sağ qalması (yuxarıda təsvir olunduğu kimi). Məlumatlar 2 müstəqil eksperimentin nümayəndəsi kimi göstərilir (AEG) və ya tək təcrübə (F) ilə n = hər qrup üçün 5. Məlumatlar çoxsaylı müqayisələr üçün Holm-Şidak korreksiyası ilə 1-yollu ANOVA istifadə edərək təhlil edilmişdir (C), qoşalaşmış 2 quyruqlu t test (D) və log-rank (Mantel-Cox) testi (BEG). *P < 0,05 **P < 0,01 ***P < 0,001.

Endogen T-limfositlərə tələbatın mümkün mexanizmlərindən biri, müxtəlif antigenlərə qarşı antitümör hücumunun ikinci dalğası ilə nəticələnən kombinə edilmiş terapiya ilə şişin məhv edilməsinin nəticəsi olan epitopun yayılması ilə bağlıdır. Bu anlayış, kombinasiya terapiyasından sonra şişin ilkin reqressiyasının heç bir endogen lenfosit tələb etməməsi faktı ilə dəstəklənmişdir (Şəkil 4A və 5A). Beləliklə, biz fərz etdik ki, ACT plus onkolitik peyvənddən sonra 6-cı gündə CD4+ və/və ya CD8+ T hüceyrələrinin in vivo tükənməsi (şişlərin hələ də reqressiya etdiyi bir vaxt nöqtəsi) residivlə nəticələnəcək. Təəccüblüdür ki, alt dəstələrdən hər hansı birinin və ya hər ikisinin tükənməsi şişin residivinə səbəb olmadı (məlumatlar göstərilmir), bu, şiş-reaktiv endogen T hüceyrələrinin kombinasiya terapiyasından əvvəl mövcud olmalı və ya son dərəcə sürətlə induksiya edilməli olduğunu göstərir. qəbul edilmiş T hüceyrələri ilə əməkdaşlıqda şiş hüceyrələrinin məhv edilməsi. Endogen ErkM spesifik CD8 + T hüceyrələrinin genişlənməsinin VSV gücləndirilməsindən 2 gün sonra müşahidə edildiyinə dair sübutlar (Şəkil 3A) erkən mərhələdə iştirak etmək üçün birləşmə terapiyası ilə sərbəst buraxıla və ya hətta gücləndirilə bilən əvvəlcədən mövcud olan şişlə hazırlanmış endogen T hüceyrələrinin mümkünlüyünə üstünlük verir. şişlərin təmizlənməsi.

Hədəfsiz antigenlərə qarşı CD8 + T hüceyrə reaksiyalarının dövriyyədə aşkar edilib-edilmədiyini müəyyən etməyə cəhd etdik. Mononuklear hüceyrələr ACT-dən 5 gün sonra peyvəndlə və ya vaksin gücləndirilmədən qandan toplandı. CD8 + T hüceyrələri tərəfindən IFN-γ istehsalı Duan və digərləri tərəfindən müəyyən edilmiş 4 immunogen neoepitopdan ibarət peptid hovuzu ilə stimullaşdırıldıqdan 4 saat sonra ölçüldü. ( 28 ). Şəkil 5C-də göstərildiyi kimi, yığılmış neoepitop peptidlərinə qarşı CD8 + T hüceyrə reaksiyalarının səviyyəsi yalnız ACT qəbul edən siçanlarda cüzi olsa da, onkolitik vaksinlə peyvənd olunmaqla onu əhəmiyyətli dərəcədə artırmaq olar. Bu nəticə, Şəkil 2A-da göstərilən məlumatlarla birlikdə, həm hədəflənmiş, həm də hədəflənməmiş antigenlərə xas olan şişlə hazırlanmış endogen T hüceyrələrinin mövcud olduğunu və onkolitik peyvəndlə sürətlə gücləndirilə biləcəyini təsdiqlədi.

Endogen T hüceyrələri kombinasiya terapiyasından sonra heyvanlarda uzunmüddətli antitümör toxunulmazlığı formalaşdırır. Endogen T hüceyrələrinin, xüsusən də hədəflənməmiş şiş antigenlərini tanıyanların davamlılığını və qoruyucu funksiyasını müəyyən etmək üçün biz sağ qalanları (ilkin CMS5 şişlərinin aradan qaldırılmasından sonra >60 gün ərzində TF) i.d. CMS5r hüceyrələrinin enjeksiyonu.Biz həmçinin analitik nəzarət kimi valideyn CMS5 hüceyrələri ilə yenidən çağırılmış bir qrupu da daxil etdik. Yenidən çağırışdan beş gün sonra biz nümunə götürülmüş PBMC-ləri ErkM peptidi ilə stimullaşdırdıq və təkrar sınaqdan əvvəl IFN-γ + CD8 + T hüceyrələrinin tezliyini eyni heyvanlardakı ilə müqayisə etdik. Gözlənildiyi kimi, CMS5 ilə təkrar müraciət edilən sağ qalanlarda ErkM-reaktiv CD8+T hüceyrələrinin təxminən 3 dəfə artması müşahidə olundu, CMS5r ilə təkrar çağırış isə ErkM-ə xas CD8+T hüceyrə reaksiyalarını artırmadı və CMS5r-in ErkM ifadəsini itirməsi faktını gücləndirdi. (Şəkil 5D). Maraqlıdır ki, heç bir hüceyrə xətti sağ qalanlarda şiş əmələ gətirə bilmədi, baxmayaraq ki, hər ikisi müalicə olunmamış siçanlarda sürətlə böyüdü və sağ qalma müddəti əhəmiyyətli dərəcədə azaldı (Şəkil 5E), ErkM-ə, eləcə də digər antigenlərə qarşı yaddaşın uğurlu kombinasiya terapiyasının nəticəsi olaraq qaldığını və kifayət qədər olduğunu göstərir. valideyn və ya ErkM-mənfi CMS5 hüceyrələri ilə təkrar çağırışdan qorunmağa vasitəçilik etmək. Bundan əlavə, ErkM istisna olmaqla, paylaşılan antigenlərin əlavə sübutu olaraq, öldürücü şüalanmış CMS5r hüceyrələri (irrCMS5r) ilə peyvənd edilmiş siçanlar CMS5 və ya CMS5r hüceyrələri ilə sonrakı sınaqlardan qorundu (Şəkil 5F).

CMS5r-dən qorunmaq üçün hansı limfosit populyasiyasının tələb olunduğunu müəyyən etmək üçün təkrar sınaqdan əvvəl kombinasiya terapiyasından sağ qalanlarda CD8+, CD4+ və ya hər iki T hüceyrə alt dəstlərinin antikor vasitəçiliyi ilə tükənməsini həyata keçirdik. CD8 + T hüceyrələrinin tükənməsi problemli heyvanların 80%-də şiş böyüməsi ilə nəticələndi, CD4 və ya hər iki CD4 və CD8 T hüceyrələrinə qarşı antikor qəbul edən bütün siçanlar şiş inkişaf etdirərək, bütün tükənmə qruplarında sağ qalma müddətini əhəmiyyətli dərəcədə azaltdı (Şəkil 5G). Bu nəticələr göstərir ki, endogen T hüceyrələrinin hər iki alt dəsti təkcə ACT zamanı mövcud olan antigen itkisi variantlarının yaranmasının qarşısını almaq və ya aradan qaldırmaq üçün deyil, həm də geniş antigen spesifikliyi ilə uzunmüddətli qoruyucu toxunulmazlığın formalaşdırılması üçün vacibdir.

Şişin residivinin qarşısını almaq üçün endogen T-limfositlərə olan tələb antigendən və/və ya modeldən asılı deyil. Nəhayət, tam və davamlı şiş reqressiyasına nail olmaqda endogen T limfositlərin rolunu müəyyən etmək üçün fərqli bir şiş modelində ACT plus OV peyvəndinin birləşmə platformasını qiymətləndirməyə çalışdıq. Bu məqsədlə biz VacV-dən surroqat neoantigen gp33-ü, limfositik xoriomeningit virusu qlikoproteindən olan immunodominant peptidi və gp36-gp31-i ifadə etmək üçün hazırlanmış siçan B16 melanoma hüceyrə xəttini kodlaşdırmaq üçün onkolitik virus onurğası kimi istifadə etməyi seçdik. C57BL/6 siçan daşıyan i.d. B16-gp33 şişləri gp33-spesifik P14 TCR transgenik T hüceyrələrindən əldə edilən Tcm ilə müalicə olundu, sonra VacV-gp33 peyvəndi aparıldı. Şəkil 6A-da göstərildiyi kimi, kombinasiya terapiyası alan siçanlarda şişin tam və davamlı reqressiyasına nail olunub, bu kombinasiya platformasının müxtəlif şiş antigenlərini hədəfləmək və/və ya müxtəlif OV onurğalarını daxil etmək üçün potensialını və çevikliyini təsdiqləyir. Maraqlıdır ki, kombinasiya terapiyasından əvvəl ya anti-Thy1.2 antikoru, ya da CPX ilə müalicə olunan siçanlar ilkin reqressiyadan sonra şişin residivinə görə sağ qalma müddətini əhəmiyyətli dərəcədə azaldıblar (Şəkil 6, A və B), bu, ehtimal ki, mövcud olan host T limfositlərinin əhəmiyyətini gücləndirir. immun hücumun müxtəlifliyini genişləndirir.

Şişin residivinin qarşısını almaq üçün endogen T-limfositlərə ehtiyac fərqli bir modeldə sübut edilmişdir. C57BL/6 siçanları 6 günlük i.d. B16-gp33 şişlərinə ACT (10 6 gp33 spesifik Tcm) verildi, ardınca 5 × 10 7 PFU VacV-gp33 (hər ikisi i.v. verildi) ilə peyvənd edildi. Antikorlar T hüceyrələrinin köçürülməsindən 1 gün əvvəl və 1 gün sonra və bundan sonra 3 həftə ərzində həftədə bir dəfə verildi. ACT-dən 1 gün əvvəl bir dəfə CPX enjeksiyonu verildi. (A) şiş həcmləri və (B) sağ qalması izlənilmiş və göstərilmişdir. Data ilə 2 müstəqil eksperimentin nümayəndəsi nəticələri kimi göstərilir n = hər qrup üçün 5. Məlumatlar log-rank (Mantel-Cox) testindən istifadə etməklə təhlil edilmişdir (B). *P < 0,05 **P < 0,01.

Genetik olaraq müəyyən edilmiş neoantigenlərə qarşı T hüceyrələrinin reaktivliyini selektiv şəkildə artırmaq strategiyaları hazırda inkişaf mərhələsindədir (29, 30). Bu araşdırmada biz ex vivo-genişlənmiş neoantigen-spesifik T hüceyrələrini (ACT) OVV ilə birləşdirən terapevtik platformanı araşdırdıq. Bu strategiya OVV-nin periferiyada həm T hüceyrələrinin aktivləşməsini, həm də genişlənməsini (push), sonra T hüceyrələrinin şiş yerinə cəlb edilməsini (çəkmə) asanlaşdırdığı “push-pull” mexanizmindən istifadə edir. Həqiqətən, biz nümayiş etdirdik ki, antigen-spesifik Tcm-nin qəbuledici ötürülməsi və ardınca onkolitik peyvənd T-hüceyrəsinin möhkəm genişlənməsini, şiş infiltrasiyasını və şişin tam reqressiyasını ortaya çıxararaq, bu 2 terapevtik yanaşma arasında güclü sinerji aşkar etdi. Daha da əhəmiyyətlisi, effektivliyə ilkin şərtləşdirmə (yəni, hüceyrə köçürülməsindən əvvəl bədənin ümumi şüalanması və ya limfodepresan kimyaterapiya) və adətən digər ACT parametrlərində istifadə olunan ekzogen IL-2, 2 köməkçi maddələr (15, 16) olmadıqda əldə edilmişdir. xəstə üçün daha az intensiv təcrübə təklif edə bilən kombinasiya terapiyamızın tərcümə təsiri. Bundan əlavə, və ən əsası, ilkin kondisionerdən yan keçməklə, ilkin şişi aradan qaldırmaq və antigen itkisi variantlarının yaranmasının qarşısını almaq üçün təkcə ACT-ı tamamlayan şişlə astarlanmış endogen T hüceyrələrini qoruyur, həm də immunitetə ​​nəzarət üçün uzunmüddətli yaddaş hovuzu təşkil edir.

B hüceyrəli bədxassəli şişlərin və melanomanın müalicəsində müvəffəqiyyətə baxmayaraq, ACT əksər bərk şişlərə yalnız məhdud təsir göstərir (31, 32). Maneələrə, digər aspektlərlə yanaşı, köçürülmüş T hüceyrələrinin şişə kifayət qədər miqdarda infiltrasiyada və bütün bədxassəli hüceyrələri öldürmək üçün kifayət qədər uzun müddət davam edən səmərəsizliyi daxildir (33, 34). Köçürülmüş hüceyrələrin dozasının artırılması onların bərk şişlərə daxil olmaq və onları öldürmək qabiliyyətini yaxşılaşdıra bilər, lakin ex vivo çoxlu sayda T hüceyrələrinin yaradılması geniş genişlənmə tələb edir ki, bu da qaçılmaz olaraq T hüceyrələrinin terminal diferensiasiyası və replikativ qocalması ilə nəticələnir (35, 36). Bundan əlavə, bərk şişlərlə əlaqəli yüksək supressiv mikromühit və heterojen antigen mənzərəsi tez-tez T hüceyrələrini təsirsiz edir və antigenin qaçmasını təşviq edir (37, 38). Beləliklə, bərk şişlərin davamlı reqressiyasına nail olmaq üçün ACT eyni vaxtda T hüceyrələrinin genişlənməsini stimullaşdıra, T hüceyrələrini şişə cəlb edə, şiş vasitəsilə immunosupressiyaya qalib gələ və T hüceyrələrinin spesifikliyinin spektrini genişləndirə bilən digər yanaşmalarla birləşdirilməlidir. Onkolitik peyvəndlərin faydalı onkolitik xassələrini saxlayaraq şişə xas Tcm-ni effektiv şəkildə genişləndirə biləcəyini daha əvvəl nümayiş etdirdik, bu da bizi OVV-lərin peyvənd və onkolitik funksiyalarına görə ACT ilə birləşmək üçün ideal platforma təmsil edə biləcəyini fərz etməyə səbəb oldu (18, 19). Həqiqətən, biz bu tədqiqatda sübut təqdim edirik ki, nə OV (şiş antigeni yoxdur), nə də adi peyvənd (nonkolitik) ACT ilə sinerji yaratmaq üçün kifayət deyildi və qurulmuş bərk şişlərin məhv edilməsi köçürülmüş T hüceyrələrinin həm gücləndirilməsini, həm də şiş infiltrasiyasını tələb edir. Bu məqsədlə, Tcm, ACT sahəsində getdikcə daha çox bəyənilən konsepsiyaya uyğun olaraq, səmərəli enraftment və proliferativ qabiliyyətinə görə Teff-dən üstün idi (35, 36).

Mövcud klinik praktikada və ACT-nin rasional dizaynında mühüm təsiri ola biləcək 2 əlavə müşahidə apardıq. Birincisi, ACT plus OV peyvəndindən sonra immun çatışmazlığı olan siçanlarda şişin reqressiyasına nail olunsa da, şişlər 2 həftə ərzində yenidən əmələ gəldi. Məlum oldu ki, təkrarlanan şiş hüceyrələri artıq köçürülmüş T hüceyrələrinin epitop hədəfini saxlamır. Bu nəticə, məhdud antigenlər dəsti üçün səciyyəvi olan T-hüceyrə populyasiyası olan şişlərin hədəflənməsinin antigen-mənfi şiş variantlarının selektiv artımına səbəb ola biləcəyi fikrini dəstəkləyir. Bununla belə, WT heyvanlarında davamlı reqressiya ardıcıl olaraq əldə edilmişdir ki, şişin heterojenliyi və/yaxud immun çıxışı ACT zamanı endogen T hüceyrələrini səfərbər etməklə, hətta tək bir antigeni hədəf alaraq həll edilə bilər. ACT plus OV müalicəsindən əvvəl CD4+ və ya CD8+ T hüceyrələrinin tükənməsinin şişin ilkin reqressiyasına təsir etmədiyi, lakin residivlə nəticələndiyinə dair müşahidəmiz köçürülmüş T hüceyrələri ilə endogen T hüceyrələri arasında əməkdaşlıq olduğunu göstərir. Görünür ki, köçürülmüş T hüceyrələri şişin boşaldılmasında (ErkM + şiş hüceyrələrinin eradikasiyası) vasitəçilikdə əsas rol oynayır, endogen T hüceyrələri isə qaçan variantları (ErkM - şiş hüceyrələri) aradan qaldırmaq üçün tələb olunur. Endogen T hüceyrələrinin aktivləşməsini izah edən mümkün mexanizmlərdən biri epitopun yayılmasıdır, müxtəlif antigenlərə qarşı antitümör T hüceyrələrinin sonrakı dövrələrini təşviq etmək üçün bir immun hücum dalğasında sərbəst buraxılan şişdən əldə edilən antigenlərin in vivo çarpaz təqdimatını əhatə edən bir fenomendir (14, 39). Bu ardıcıl hadisələr bizim vəziyyətimizdə güclü şiş lizisi və köçürülmüş T hüceyrələri və OV-lərin vasitəçilik etdiyi iltihab səbəbindən xüsusilə təsirli ola bilər. Bununla belə, başqa bir ağlabatan mexanizm ondan ibarətdir ki, əvvəlcədən mövcud olan şişlə hazırlanmış T hüceyrələri ACT plus OV terapiyası ilə sərbəst buraxılır və/yaxud genişləndirilir, beləliklə, bütün şiş hüceyrələrinin tam eradikasiyası üçün köçürülmüş T hüceyrələrini tamamlamaq üçün daha geniş repertuar təmin edilir. Bu sonuncu ehtimal bir neçə dəlil xətti ilə dəstəklənir. Birincisi, ErkM spesifik CD8 + T hüceyrələrinin mövcudluğu və gücləndirilməsi ACT plus OVV-dən 2 gün sonra aşkar edilə bilər. İkincisi, hədəflənməmiş neoepitoplara artan T hüceyrə reaksiyaları kombinasiya terapiyasından 5 gün sonra da özünü göstərmişdir. Bu müşahidələrin sadəlövh T hüceyrələrinin aktivləşdirilməsini tələb edən epitopun yayılmasının nəticəsi olması ehtimalı azdır. Bundan əlavə, müalicədən 6 gün sonra CD4 + və ya CD8 + T hüceyrələrinin tükənməsinin residivlə nəticələnməməsi faktı göstərir ki, əvvəllər mövcud olan, lakin sonradan induksiya olunmayan host T hüceyrələri köçürülmüş T hüceyrələri ilə əməkdaşlıqda şiş hüceyrələrinin erkən təmizlənməsində iştirak edir. Buna baxmayaraq, çox güman ki, ACT plus OV həm əvvəldən mövcud olan antigenə xas T hüceyrələrini canlandıra, həm də antitümör toxunulmazlığının yaranması zamanı onların nisbi əhəmiyyətini əks etdirən ardıcıl şəkildə epitopun yayılması vasitəsilə yeni T hüceyrə reaksiyalarına səbəb ola bilər (39, 40). Təbii olaraq inkişaf edən və ya terapevtik olaraq induksiya edilmiş T hüceyrələri tərəfindən tanınan naməlum antigenlərin şişə spesifik mutasiyalardan və ya öz-özünə antigenlərdən əmələ gəlib-gəlmədiyini müəyyən etmək üçün hər iki ssenaridə daha çox iş tələb olunur.

İkincisi, köçürülmüş T hüceyrələrinin uzunmüddətli davamlılığı vacib hesab edilir və şişin reqressiyası ilə övladlığa götürülmüş T hüceyrələrinin klonlarının davamlılıq dərəcəsi arasında müsbət korrelyasiya olduğu bildirilmişdir (41, 42). Maraqlıdır ki, bizim köçürülmüş anti-ErkM CD8 + T hüceyrələri şiş reqressiyasından dərhal sonra yoxa çıxdı, endogen ErkM-ə xüsusi CD8 + T hüceyrələri isə uzun müddət sağ qaldı və antigenə xüsusi qoruyucu toxunulmazlıq təmin edə bildi. Tədqiqatımızdakı müşahidənin nəinki köçürülmüş T hüceyrə reaksiyalarını sürətləndirən və onların şişlərlə qarşılıqlı əlaqəsini gücləndirən, həm də endogen antitümör T hüceyrələri cavablarını cəlb edən onkolitik peyvəndin tətbiqi ilə əlaqədar olduğunu düşünürük. Həqiqətən, köçürülmüş T hüceyrələrinin erkən genişlənmə və şiş infiltrasiyasında üstünlük təşkil etdiyini və ilkin şiş reqressiyasına vasitəçilik etmək üçün məsuliyyət daşıdığını nümayiş etdirdik. Nəticədə, köçürülmüş T hüceyrələri, əvvəlki tədqiqatlar tərəfindən sənədləşdirilmiş bir fenomen olan şişin səbəb olduğu apoptoza məruz qaldı (43, 44). Bunun əksinə olaraq, endogen T hüceyrələrinin genişlənməsi şişin reqressiyasından bir neçə gün sonra pik nöqtəsinə çatmadı, bu, gücləndirilmiş və/və ya terapevtik olaraq induksiya edilmiş endogen T hüceyrələrinin əksəriyyətinin şiş hüceyrələri ilə qarşılıqlı əlaqədə olmadığını və bununla da antitümör toxunulmazlığını qorumaq üçün sağ qaldığını göstərir. TF siçanlarında köçürülmüş T hüceyrələrinin uzun müddət sağ qalması faktı təsdiqləyir ki, vərəmli siçanlarda köçürülmüş T hüceyrələrinin qısa müddətli taleyi çox güman ki, onların şiş hüceyrələri ilə qarşılıqlı təsirinin nəticəsidir. Nəticələrimiz iddia edir ki, ACT zamanı endogen şiş-reaktiv T hüceyrələrinin qorunması xəstəliyin aradan qaldırılması və uzunmüddətli antitümör yaddaşın təmin edilməsi üçün həyati əhəmiyyət kəsb edir ki, bu da övladlığa götürülərək köçürülmüş hüceyrələrin sağ qalmasını artırmaq cəhdində ilkin şərtləndirmə ilə pozula bilər (16).

Kollektiv olaraq, məlumatlarımız ACT zamanı şişlə hazırlanmış host T limfositlərini cəlb etməklə T hüceyrə repertuarından istifadə imkanını dəstəkləyir və beləliklə, tək selektiv təzyiqin tətbiqi nəticəsində yaranan antigen-mənfi artım riskini minimuma endirir və ya hətta aradan qaldırır. Bir çox xəstələrdə xəstələrin öz şişlərindən əldə edilən müxtəlif neoepitopları tanıyan CD4 + və/və ya CD8 + T hüceyrələrinin olması bizim tapıntılarımızın aktuallığını vurğulayır (45, 46). Nəticələrimizin siçan modellərindən klinikaya nə qədər yaxşı tərcümə oluna biləcəyini görmək hələ də davam etsə də, klinikada ACT ilə paralel olaraq OV-induksiya edilmiş antigenin yayılmasının və endogen T hüceyrə reaksiyalarının inkişafının aktuallığına dair artan sübutlar mövcuddur (47). , 48). Üstəlik, bizim kombinasiya terapiyamızın klinik cəhətdən yüksək dərəcədə tərcümə edilə bilən olması fikrini dəstəkləyən müxtəlif OV-lərin müəyyən edilmiş təhlükəsizlik profilləri ilə birlikdə xərçəng xəstələrindən şişə spesifik Tcm yaratmaq üçün klinik metodologiyalar hazırlanmışdır (7 – 9, 49, 50).

Heyvanlar. BALB/c və ya C57BL/6 siçanları Charles River Laboratories-dən alınmış və McMaster Universitetinin Mərkəzi Heyvan Təsərrüfatında xüsusi patogen olmayan otaqda yerləşdirilmişdir. NRG (NOD.Cg-Rag1 tm1Ana Il2rg tm1Wjl /SzJ) yetişdiriciləri Cekson Laboratoriyasından alınmış, siçanlar isə son dərəcə təmiz şəraitdə yetişdirilmişdir. DUC18 siçanları Lyse Norian (Ayova Universiteti, Ayova Siti, Ayova, ABŞ) tərəfindən təmin edilmişdir (22). B6.Cg-Tcratm1Mom Tg (TcrLCMV)327Sdz (P14) siçanları Taconic Breeding Laboratories-dən alınmışdır.

Viral vektorlar. Rekombinant VSV mutasiyaya uğramış ERK2 zülalının (ErkM) 136-144 amin turşularına uyğun olan H-2K d-məhdud epitopu ifadə etmək üçün hazırlanmışdır.136–144) və nəticədə VSV peyvəndi vektoru VSV-ErkM adlandırıldı. VSV-MT transgenə malik olmayan nəzarət vektorudur. Ad-ErkM replikasiya çatışmazlığı olan, ErkM epitopunu ehtiva edən E1/E3 ilə silinmiş adenoviral vektordur. VacV-gp33, lenfositik xoreomeningit virusu qlikoproteindən əldə edilən H-2D b-məhdud epitop olan gp33-ü ifadə edən TK ilə silinmiş rekombinant VacV (Qərb Ehtiyat ştammı)dır (51).

Peptidlər. ErkM (QYIHSANVL), gp33 (KAVYNFATM), Alkbh6.2 (DVPMEQPR), Slit3 (GFHGCIHEVI), Atxn10.1 (QVFPGLMEI) və Ccdc136 (ELQGLLEDEI) üçün peptidlər Biomer Techn-dən alınmış və Biomer Techn%5 ilə həll edilmişdir. .

Hüceyrə xətləri və şiş problemi. Bütün hüceyrələr 5% CO ilə nəmləndirilmiş atmosferdə 37 ° C-də saxlanıldı2. CMS5 (Lyse Norian'dan hədiyyə) (22), CMS5r və CMS5r-LVERkM hüceyrələri 10% FBS, penisilin/streptomisin (müvafiq olaraq 100 U/mL və 100 ng/mL) və 2 mM l ilə əlavə edilmiş DMEM-də becərildi. -qlutamin (Thermo Fisher Scientific). B16-gp33 hüceyrələri (gp33 peptidinə uyğun minigenlə stabil şəkildə transfeksiya edilmiş B16F10 hüceyrələri) (52) tərkibində 10% FBS, 2 mM l-qlutamin, 5 ml natrium piruvat, 5 mL amin turşusu, ml vitamin məhlulu (Thermo Fisher Scientific), 55 μM 2-merkaptoetanol (Sigma-Aldrich), 100 U/mL penisilin və 100 ng/ml streptomisin.

Şiş hüceyrələri iki dəfə PBS ilə yuyuldu və CMS5 hüceyrələri üçün 10 6 hüceyrə/30 μL və ya B16-gp33 hüceyrələri üçün 10 5 hüceyrə/30 μL konsentrasiyasında PBS-də yenidən dayandırıldı. Siçanlara i.d. vasitəsilə etiraz edildi. inyeksiya və şişlərin müalicəyə başlamazdan əvvəl təxminən 150 mm 3 orta həcmə qədər böyüməsinə icazə verildi. Təkrarlanan CMS5 hüceyrələri (CMS5r adlanır) son nöqtə NRG siçanlarından əldə edilmişdir. CMS5r-LVERkM, 5′ fosforlanmış primerləri (ErkM, irəli, GATCCATGCAATACATACACTCAGCTAACGTGTTGTAAG ErkM, tərs, ACGTTTTGATTCAlig-ə ACGTTTTGATTCAlig) yumşaltmaqla ErkM peptidini ifadə etmək üçün hazırlanmış lentivirus ilə CMS5r-in ötürülməsi yolu ilə yaradılmışdır. BamHMən və EcoRpLV-EF1a-IRES-Puro-nun I saytları (Addgene refer. 53-dən plazmid 8513). Transduksiyadan sonra puromisin seçimindən (Invitrogen) istifadə edərək poliklonal hüceyrə xətti yaradıldı.

Ölümcül şüalanma peyvəndi təcrübələri üçün CMS5r hüceyrələri tripsinizləşdirilmiş, PBS-də 3 × 10 7 hüceyrə/mL-də dayandırılmış və i.d. siçan başına təxminən 10 6 hüceyrənin enjeksiyonu. Siçanlar bir həftəlik fasilələrlə iki dəfə peyvənd edildi və ikinci peyvənddən 1 həftə sonra 2 × 10 5 canlı hüceyrə ilə sınaqdan keçirildi.

PCR analizi. Genomik DNT istehsalçının göstərişlərinə uyğun olaraq Purelink Genomik DNT Ekstraksiya Kitlərindən (Life Technologies) istifadə edərək CMS5, CMS5r və CT26 hüceyrələrindən çıxarılıb. ERK2 primerlərindən (ERK2, irəli, 5′-TGTGCCGTGTTCTCTTCAGT-3′, ERK2, tərs, 5′-TGACTTGGCTGACCTTGAGA-3′) istifadə edərək ekstraksiya edilmiş DNT-də PCR Q5 Yüksək Dəqiqlik DNT Polimeraz Kiti (New England Biolabs) ilə aparıldı. istehsalçının təlimatları, T3000 Thermocycler (Biometra). Gücləndirmə proqramı aşağıdakı kimi idi: 30 saniyə üçün 98 ° C, sonra 10 saniyə üçün 98 ° C, 30 saniyə üçün 58 ° C, 30 saniyə üçün 72 ° C (×35 dövr), son uzanma 72 ° C-də 2 ilə dəqiqə. Gücləndirici məhsullar Sfc1 ilə həzm olundu və EZ-Vision yükləmə tamponu/boyası (Amresco) ilə 1% UltraPure agaroza gel (Life Technologies) üzərində işlədilib. Hər bir hüceyrə xəttindən olan PCR məhsulu yuxarıda təsvir edilən irəli primerdən istifadə edərək ardıcıllıqla tərtib edilmişdir.

In vitro T hüceyrələrinin diferensiasiyası. Transgen siçanlardan toplu splenositlər təcrid olunmuş və 7 gün ərzində 100 ng/mL ErkM və ya gp33 peptidinin iştirakı ilə becərilmişdir. Tcm differensasiyası üçün mədəniyyətə 10 ng/mL IL-15, 10 ng/mL IL-21 (BioLegend) və 20 ng/mL rapamisin (Sigma-Aldrich), 60 vahid/mL IL-2 (BioLegend) əlavə edildi. ) Teff istehsal etmək üçün istifadə edilmişdir.

Qarışıq terapiya. Şişlər təqribən 150 mm 3 orta həcmə çatdıqda, in vitro-differensiallaşdırılmış CD8 + transgen T hüceyrələri i.v. 10 6 hüceyrə/200 μL PBS dozasında vərəm siçanlarına. 24 saatdan sonra siçanlar müxtəlif peyvəndlərlə müalicə olundu. VSV (2 × 10 8 PFU) və vaccinia (7 × 10 7 PFU) vektorları i.v. və Ad-ErkM (5 × 10 8 PFU) əzələdaxili yeridildi. Peptid vaksinasiyası i.v. marşrut əvvəllər Cho et al tərəfindən optimallaşdırıldığı kimi. ( 25 ).

T hüceyrələrinin səthi və hüceyrədaxili boyanması. Aşağıdakı ləkələr və axın sitometrik analizi üçün Abs BD Biosciences-dən alınmışdır: Fc bloku (kataloq 553141), 7AAD (kataloq 559925), Fixable Canlılıq Ləkəsi 510 (kataloq 564406), Pasifik Mavisi siçovul əleyhinə siçan CD558 (CD551) siçovul əleyhinə IFN-γ (klon XMG1.2), PE siçovul əleyhinə CD4 (klon GK1.5), PE siçan anti-siçan Thy1.1 (klon OX-7), Alexa Fluor 700 siçovul əleyhinə CD62L (klon MEL-14) və FITC siçan əleyhinə CD44 (klon IM-7). Qan, dalaq və sümük iliyi nümunələri toplanmış və peptid stimullaşdırılması və/və ya boyanmadan əvvəl qırmızı qan hüceyrələrini çıxarmaq üçün ACK lizis tamponu ilə müalicə edilmişdir. Hüceyrələr Fc Bloku ilə müalicə olundu və səth markerləri üçün rəngləndi, sonra canlılıq boyandı.Antigen-spesifik cavabların təhlili üçün RBC lizis tamponundan istifadə edərək qan nümunələrindən PBMC-lər çıxarıldı və 4 saat ərzində 37°C-də mədəniyyətdə ErkM və ya gp33 peptid (1 μg/mL) ilə stimullaşdırıldı. Brefeldin A (GolgiPlug, BD Biosciences 1 μg/mL) inkubasiyanın son 3 saatı ərzində əlavə edilmişdir. Hüceyrələrin fiksasiya/keçiriciləşmədən (Cytofix/Cytoperm, BD Biosciences) və ya BD LSRFortessa, ya da LSR II axın sitometrindən (BD Biosciences) istifadə edərək hüceyrədaxili rəngləmə flüoresansının aşkarlanması istisna olmaqla, bloklama və səthin rənglənməsi yuxarıda göstərildiyi kimi həyata keçirilib. . Məlumatlar FlowJo (versiya 10) axın sitometriya analizi proqramından (Tree Star) istifadə edərək təhlil edilmişdir.

Sitotoksiklik analizi. CMS5r-LVErlM hüceyrələri 5 μM CFSE (MilliporeSigma, kataloq 21888) ilə etiketlənmiş, hər quyuda 10 5 hüceyrədə 96 quyu boşqabına səpilmiş və göstərilən nisbətlərdə 16 saat ərzində DUC18 Teffs (yuxarıda yaradılan) ilə birgə kulturasiya edilmişdir. Hüceyrələr eBioscience Fixable Viability Dye eFluor 780 (kataloq 65-0865-14, Thermo Fisher) ilə boyandı və boyanma yuxarıdakı kimi axın sitometriyası ilə qiymətləndirildi. Spesifik liziz faizi daha sonra aşağıdakı tənlikdən istifadə edərək hesablandı: spesifik liziz % = 100 × (% xüsusi hüceyrə ölümü – % bazal hüceyrə ölümü)/100 – % bazal hüceyrə ölümü, burada spesifik hüceyrə ölümü CFSE-nin canlılıq boyası ilə boyanması ilə müəyyən edilir. -T hüceyrə kokulturası quyularında müsbət hüceyrələr və kokulturasiya edilmiş T hüceyrələri olmayan quyulardan bazal hüceyrə ölümü

T-limfositlərin in vivo tükənməsi. T hüceyrələrinin tükənməsinə 2 i.p. anti-siçan CD4 və CD8 (müvafiq olaraq ATCC-dən alınmış GK1.5 və 2.43 hibridomadan istehsal olunur) və ya Thy1.2 antikorunun (klon 30H12, Bio X Cell) 250 mkq/200 mkL dozada 48 saat intervalla enjeksiyonları . İzotip nəzarət antikoru (klon HRPN, Bio X Cell) ilə müalicə eyni sxemə uyğun aparıldı. Daha uzun müşahidələr üçün tükənmə iki həftədə bir i.p. müvafiq antikorların inyeksiyası. CPX (Sigma-Aldrich) i.p. T hüceyrələrinin köçürülməsindən 1 gün əvvəl 3 mq/siçan dozasında tətbiq edilir. Müalicə zamanı müxtəlif vaxt nöqtələrində PBMC-lərin FACS analizi ilə tükənmə səmərəliliyi izlənildi (məlumatlar göstərilmir).

Histologiya. İmmunohistokimya Leica Bond Rx avtomatlaşdırılmış boyayıcısından (Leica Biosystem) istifadə edərək formalinlə fiksasiya olunmuş, parafinə daxil edilmiş şiş toxumalarından kəsiklər üzərində aparılmışdır. Slaydlar siçan əleyhinə CD8α antikoru (1:1000 klonu 4SM15, Thermo Fisher Scientific seyreltilmiş) ilə boyanmadan əvvəl 20 dəqiqə ərzində Leica Bond Epitope Retrieval buferi №2 (Leica Biosystems) ilə mumsuzlaşdırılmış və əvvəlcədən müalicə edilmişdir. Rəng Leica Bond Polymer Refine Detection Kit (Leica Biosystems) istifadə edərək işlənib hazırlanmışdır, bu da birincil komponenti dovşan anti-siçovul antikoru (1:100, Vector Laboratories) ilə əvəz etmişdir. Axiovert 100M mikroskopundan (Zeiss) istifadə edilməklə çəkilən şəkillər və kəmiyyəti ImageJ proqramının hissəciklərin təhlili funksiyasından istifadə etməklə həyata keçirilib (54).

Statistika. Windows üçün GraphPad Prism qrafik və statistik təhlillər üçün istifadə edilmişdir. İmmun cavab məlumatları vasitələri arasındakı fərqlər ya qoşalaşmış Student's 2-quyruqlu istifadə edərək sorğulandı. t test, 1-yollu ANOVA və ya rəqəm əfsanələrində təsvir olunduğu kimi təkrar tədbirlər 2-yollu ANOVA. Zəruri hallarda, çoxsaylı müqayisələri düzəltmək üçün Holm-Şidak metodundan istifadə edilmişdir. Ümumilikdə, a P 0,05-dən az olan dəyər əhəmiyyətli hesab edilmişdir. Orta + SD çubuqları göstərilir. Sağ qalma əyriləri, 1000 mm 2 şiş həcmi və ya son nöqtə kimi şiş xorası olan Kaplan-Meier metodu ilə yaradıldı və log-rank (Mantel-Cox) testindən istifadə edərək təhlil edildi.

Tədqiqatın təsdiqi. Bütün heyvan təcrübələri Kanada Heyvanlara Qulluq Şurası qaydalarına uyğun idi və McMaster Universitetinin Heyvan Tədqiqatları Etika Şurası vasitəsilə daxili təsdiq aldı.

SRW, BS, LC, DB, AN və TSM təcrübələri həyata keçirdi, məlumatları təhlil etdi və əlyazmaların hazırlanmasına kömək etdi. KS və BDL virus vektorlarını qurdu və məlumatların təhlilinə kömək etdi. JLB, SRW və YW eksperimental dizayn və məlumatların şərhinə nəzarət etdi və əlyazmanı hazırladı.

DUC18 siçanlarını təmin etdiyi üçün Lyse Norian'a təşəkkür edirik. Bu araşdırma Ontario Hökuməti tərəfindən maliyyələşdirilən Ontario Xərçəng Araşdırmaları İnstitutunun dəstəyi, habelə Kanada Sağlamlıq Araşdırmaları İnstitutu (FRN 123516 və FRN 152954), Kanada Xərçəng Cəmiyyəti (qrant 705143) və Terry Fox Araşdırma İnstitutu (TFRI-1073).

Maraqların toqquşması: SRW, BS, LC və YW patent müraciəti üzrə ixtiraçılardır. CA2017/050772 (nəşr nömrəsi WO/2017/219150), övladlığa götürülmüş T hüceyrə terapiyası və onkolitik virus peyvəndi kombinasiya terapiyasının istifadəsini əhatə edən McMaster Universiteti tərəfindən təqdim edilmişdir.


Videoya baxın: Ихор vs Квант. Сравнение брони. пвп шоу. pvp show. Thaumcraft vs IndustrialCraft 2 (Iyul 2022).


Şərhlər:

  1. Gagor

    Məncə o yanılır. Mən əminəm. Mən bunu müzakirə etməyi təklif edirəm. Mənə pm-də yazın.

  2. Akshobhya

    Bu əlamətdar fikir yalnız təxminən

  3. Shaktiran

    bağışlayın, mən o cümləni sildim

  4. Meziramar

    Üzr istəyirəm, amma məncə, siz haqlı deyilsiniz. Mən əminəm. Mən bunu sübut edə bilərəm. Mənə pm-də yazın.



Mesaj yazmaq