Məlumat

Antitripsin fermenti

Antitripsin fermenti


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Siqaret çəkən bir xəstədə, siqaretin birləşməsi və antitripsin genindəki bir qüsur (proteazdan həzmi maneə törədir) səbəbindən ağciyər həzm olunurmu? Yoxsa siqaret çəkmək genində qüsur olan bir xəstə ilə eyni hərəkət edir?


Vikipediyada xəstəlik haqqında gözəl məqalə var.

https://en.wikipedia.org/wiki/Alpha_1-antitripsin_deficiency

həmin məqalədən

Alpha-1 antitripsin (A1AT) qaraciyərdə istehsal olunur və onun funksiyalarından biri ağciyərləri birləşdirici toxumanı poza bilən ferment olan neytrofil elastazdan qorumaqdır.

Neytrofil proteazları neytrofillərin olduğu hər yerdə aktivdir. Siqaret çəkməyən insanlar yalnız bu xəstəliyin ikiqat resessiv formasına (aktiv alfa-1 antitripsin yoxdur) malik olmaqla KOAH-a yoluxa bilərlər. Ancaq bu sizinlə belədirsə və siz də siqaret çəkirsinizsə, sürətlənmiş KOAH alırsınız. KOAH artıq selik və neytrofil təsiri ilə əlaqəli iltihablı bir xəstəlikdir və bunun səbəb olduğu zərər, şübhəsiz ki, qoruyucu alfa-1 antitripsinin olmaması ilə artır.

Bu vəziyyətdən əziyyət çəkirsinizsə, alfa-1 antitripsin infuziyaları ala bilərsiniz - tip 1 diabet xəstələri insulin alırlar.


1.18: Ferment funksiyası

  • CK-12: Biologiya Konseptləri
  • CK-12 Fondundan qaynaqlanır

Hüceyrələrdə çoxlu funksiyaları olan bir ferment var, yoxsa hər biri yalnız bir funksiyaya malik bir çox ferment var?

Fermentlər. Həyat üçün lazım olan sehrli zülallar. Bəs fermentlər necə işləyir? Yalnız bir xüsusi biokimyəvi reaksiyanı necə kataliz edirlər? Bir tapmacada yalnız iki parça düzgün uyğunlaşacaq. Bunu anlamaq fermentlərin necə işlədiyini başa düşmək üçün əsas addımlardan biridir.


Səbəblər

İçindəki mutasiyalar SERPINA1 gen alfa-1 antitripsin çatışmazlığına səbəb olur. Bu gen bədəni neytrofil elastaz adlı güclü fermentdən qoruyan alfa-1 antitripsin adlı zülalın istehsalı üçün göstərişlər verir. Neytrofil elastaz infeksiyaya qarşı mübarizə aparmaq üçün ağ qan hüceyrələrindən sərbəst buraxılır, lakin alfa-1 antitripsin tərəfindən sıx şəkildə idarə olunmasa, normal toxumalara (xüsusilə ağciyərlərə) hücum edə bilər.

İçindəki mutasiyalar SERPINA1 gen alfa-1 antitripsinin çatışmazlığına (çatışmazlığına) və ya neytrofil elastazanı idarə edə bilməyən zülalın anormal formasına səbəb ola bilər. Kifayət qədər funksional alfa-1 antitripsin olmadan, neytrofil elastaz alveolları məhv edir və ağciyər xəstəliyinə səbəb olur. Anormal alfa-1 antitripsin də qaraciyərdə toplana və bu orqanı zədələyə bilər.

Tütün tüstüsü, kimyəvi maddələr və toz kimi ətraf mühit amilləri, ehtimal ki, alfa-1 antitripsin çatışmazlığının şiddətinə təsir göstərir.

Alpha-1 antitripsin çatışmazlığı ilə əlaqəli gen haqqında daha çox məlumat əldə edin


Müalicə Müalicəsi

Ümumiyyətlə, alfa-1 antitripsin çatışmazlığı (AATD) ilə əlaqəli tibbi problemlərin müalicəsinə standart tibbi müalicələr və xüsusi tibbi problem üçün dəstəkləyici qayğı daxildir. Bununla belə, ağciyər problemləri olan AATD olan bəzi insanlar üçün artırma terapiyası (bəzən əvəzedici terapiya adlanır) üçün xüsusi bir müalicə mövcuddur. [2] [3] [5]

Artırma terapiyası venadaxili (IV) infuziya yolu ilə birbaşa insanın qanına təmizlənmiş insan AAT əlavə etməklə alfa-1 antitripsin zülalının (AAT) qan səviyyəsini artırmaq məqsədi daşıyır. Məqsəd ağciyər xəstəliyinin inkişafının qarşısını almaqdır. Dəri problemləri də adətən yaxşılaşır. Augmentasiya terapiyası AATD ilə əlaqəli qaraciyər xəstəliyinə təsir etmir. [2] [3] [5]


Fəaliyyətdə olan fermentlər - Süd zülallarının miqdarını təyin etmək

Tripsin, zülalları peptidlərə hidroliz edən bir fermentdir, digər fermentlər onları bədəndə istifadə üçün amin turşularına qədər azaltmağa hazırdır. Fermentlər katalizatorlardır, yəni özləri istehlak edilmədən reaksiyaya kömək edir və ya səbəb olurlar. Tripsin nazik bağırsaqda işləyir, mədədəki turşu və pepsin zülalları parçalamaq işinə başladıqdan sonra.

Bu təcrübədə kazein proteini olan süddən istifadə edilir. Süddə olan kazein parçalandıqca kiçik molekullar həll olur və bununla da mayenin qeyri-şəffaflığını azaldır. Molekulları parçalamaq üçün lazım olan vaxt ölçülə bilər və məlum dəyərlərin naməlum dəyərlərlə müqayisəsi bilinməyənləri hesablamağa imkan verəcəkdir. Süd yağın qaçılmaz olması səbəbindən tamamilə aydınlaşmayacağından, son nöqtənin müxtəlif qərarları ilə bəzi səhvlər təqdim ediləcək, yalnız sinif arasında deyil, hər bir tələbənin öz uyğunsuzluqları ola bilər. Bu növ xətanı azaltmaq üçün əvəzinə keçiricilik rejimində kolorimetr istifadə edilə bilər, lakin vizual qiymətləndirmə əsas prinsipi nümayiş etdirmək üçün kifayət olmalıdır. Bu təcrübə yağsız süd tozunun məlum konsentrasiyaları ilə başlayır. İstədiyiniz halda zülalın özünün konsentrasiyasını hesablamaq olar, südün paketindəki məlumatlara əsasən yağsız süddə ümumiyyətlə 25 q tozda təxminən 9 q protein var (36%).

HAZIRLIQ: Laboratoriya TEXNİKİ

  1. 30 q süd tozunu 250 ml distillə edilmiş suda (dH2O) həll edin.
  2. 10% ehtiyat məhlulu üçün 300 ml etmək üçün distillə edilmiş su əlavə edin. (Sinifin ölçüsünə uyğun olaraq tənzimləyin &ndash 300mL ehtiyat 12 qrup üçün kifayət olmalıdır, dağılma ehtimalı ilə). Aşağıdakı kimi seyreltin:
        • 5% standart &ndash 75mL ehtiyat 75mL dH2O
        • 4% standart &ndash 60mL ehtiyat 90mL dH2O-da
        • 3% standart &ndash 45mL ehtiyat 105mL dH2O-da
        • 2% standart &ndash 30mL ehtiyat 120mL dH2O-da
        • 1% standart &ndash 15mL ehtiyat 135mL dH2O-da
        1. Qalan süddən 1-5% diapazonunda iki naməlum nümunə (X və Y) yaratmaq üçün istifadə edin, məsələn, 103mL dH2O-da 47mL ehtiyat və 122mL dH2O-da 28mL ehtiyat. Konsentrasiyanı qeyd edin, lakin tələbələrə açıqlamayın.

        Tripsin məhlulu:

        1. 1% məhlul hazırlamaq üçün 1 q tripsini 100 ml dH2O-da həll edin.
        2. 5% zülal standartının son nöqtəyə qədər təxminən 2-3 dəqiqə çəkəcəyinə əmin olmaq üçün sürətli analiz aparın (aşağıdakı üsula baxın).
        3. Vaxt uyğun olarsa, 1% məhlulunuzun qalan hissəsini hazırlamaq üçün 4 q Tripsini 400 ml dH2O-da həll edin. Çox sürətli və ya çox yavaşdırsa, seyreltməni müvafiq olaraq tənzimləyin.

        ÜSUL: TƏLƏBƏ FƏALİYYƏTİ

        1. Sınaq borularınızı 1%, 2%, 3%, 4%, 5%, X və Y ilə etiketləyin.
        2. Hər boruya 10 ml müvafiq süd məhlulu əlavə edin.
        3. Ağ kağızda təxminən sınaq borularınızın diametrinə bərabər olan qara xaç işarələyin.
        4. Birinci boruya (1%) 5 ml tripsin məhlulu əlavə edin. Taymeri işə salın və qarışdırmaq üçün yumşaq silkələyin. Əgər əlcək taxırsınızsa, baş barmağınızı borunun üstündə tutmağa və borunu tərsinə çevirərək qarışdırmağa üstünlük verə bilərsiniz.
        5. Çarmıxı sınaq borusunun arxasında tutun və onun görünməsi üçün lazım olan vaxtı qeyd edin.
        6. Qalan borularla təkrarlayın və xaçın görünməsini təyin etdiyiniz nöqtəni ardıcıl saxlayın.
        7. Anomaliyaları daha asan yoxlamaq üçün nəticələrinizi qrafik kağızınızdakı standartlara uyğunlaşdırın. Hər hansı bir nəticə yersiz görünürsə və bu standartı yenidən işə salmaq lazımdırsa, ən yaxşısı təmiz sınaq borularından istifadə etməkdir, çünki fermenti təmizləmək çətin ola bilər. Borudan yenidən istifadə etmək lazımdırsa, əvvəlcə 5 ml tripsin qoyun və taymerinizi süd əlavə etdikdən sonra işə salın.
        8. Kalibrləmə əyrinizin mənalı olduğuna əmin olduqdan sonra, hər birində südün konsentrasiyasını qiymətləndirmək üçün iki naməlum üçün nəticələrin qrafikini tərtib edin.
        9. Ümumi kalibrləmə əyrisini və təxminini yaratmaq üçün sinif nəticələri toplanmalı və orta hesablanmalıdır. Fərdi nəticələrlə müqayisədə ümumi nəticələrdən nə gözlədiyinizi nəzərdən keçirin.

        MÜŞAHİDƏLƏR VƏ NƏTİCƏLƏR

        Aşağıda gözlənilən nəticələrin nümunəsi verilmişdir. Fərdi nəticələr fərqli olacağı üçün yalnız bir bələdçidir.


        Monomer və Polimer Alfa-1 Antitripsinin Mərkəzdənqaçma ilə Ayrılması və Qərb Blotu ilə həll olunan və həll olunmayan komponentlərin təhlili ilə yarı kvantasiyası

        Alfa-1 antitripsin (a1AT) çatışmazlığı klassik formada böyüklərdə və uşaqlarda qaraciyər xəstəliyi riskinin artması, böyüklərdə isə ağciyər xəstəlikləri ilə əlaqəli otosomal resessiv xəstəlikdir. Qaraciyər xəstəliklərinin böyük əksəriyyəti PiZZ adlanan Z mutant allelinin homozigotluğu ilə əlaqələndirilir. Bu homozigot allel qaraciyərdə böyük miqdarda a1AT mutant Z zülalını sintez edir, lakin mutant zülal da biogenez zamanı düzgün olmayan şəkildə bükülür. Nəticədə molekulların təxminən 85%-i müvafiq şəkildə ifraz edilmək əvəzinə hepatositlərdə saxlanılır. Nəticədə aşağı və ya "çatışmayan" zərdab səviyyəsi ağciyərləri maneəsiz neytrofil proteazlarından iltihablı zədələrə qarşı həssas edir. Hepatositlərdə saxlanılan mutant Z zülalının çoxu hüceyrədaxili proteoliz yollarına yönəldilir, lakin bəzi molekullar uzun müddət endoplazmatik retikulumda qalır, digərləri isə qeyri-adi yığılmış və ya “polimerləşmiş” konformasiya qəbul edirlər. Bu hüceyrədaxili polimerlərin xroniki hepatit, siroz və hepatosellüler karsinoma da daxil olmaqla son orqan qaraciyər zədələnməsinə səbəb ola biləcək hüceyrədaxili zədələnmə kaskadını tetiklediyi düşünülür. Geniş qəbul edilir ki, mutant Z-alfa-1 antitripsin çatışmazlığında (AATD-Z) xəstəliyə səbəb olan amil mutant Z zülalının zəhərli yığılmasıdır. Yetişmə zamanı Z zülalının hamısının deyil, bir hissəsinin yanlış qatlanması homopolimerləşməyə səbəb olduğundan, normal qatlanmış ATZ və yığılmış polimer ATZ miqdarını qiymətləndirmək üçün analiz çox faydalı olardı. Burada bir toxuma və ya hüceyrə mədəniyyəti mənbəyində bu iki fraksiyanı yarı kəmiyyətcə qiymətləndirmək üçün bir üsul təsvir edirik.

        Açar sözlər: AAT ATZ Aqreqasiyası Alpha-1 antitripsin Qaraciyər sirozu Qaraciyər xəstəliyi Monomer-polimer Polimerləşmə Həll olunan/həllməyən zülalların ayrılması Saxlama xəstəliyi Z mutant.


        AATD simptomları hansılardır?

        Alfa-1 antitripsin çatışmazlığı (AATD) böyüklərdə ağciyər xəstəliyi kimi özünü göstərə bilər və təsirlənmiş uşaqların kiçik bir hissəsində qaraciyər xəstəliyi ilə əlaqələndirilə bilər. Təsirə məruz qalan böyüklərdə AATD-nin ilk simptomları yüngül aktivliklə nəfəs darlığı, məşq qabiliyyətinin azalması və hırıltıdır. Bu simptomlar adətən 20-40 yaş arasında görünür. Digər əlamətlər və simptomlar təkrarlanan tənəffüs yolu infeksiyaları, yorğunluq, ayaq üstə durarkən sürətli ürək döyüntüsü, görmə problemləri və qəsdən çəki itirməni əhatə edə bilər.

        AATD olan bəzi şəxslərdə inkişaf etmiş ağciyər xəstəliyi var və ağciyərlərdə kiçik hava kisələrinin (alveollar) zədələndiyi amfizem var. Amfizemin simptomlarına tənəffüs çətinliyi, öskürək və barrel formalı sinə daxildir. Siqaret çəkmək və ya tütün tüstüsünə məruz qalmaq simptomların görünüşünü və ağciyərlərin zədələnməsini artırır. Digər ümumi diaqnozlara KOAH (xroniki obstruktiv ağciyər xəstəliyi), astma, xroniki bronxit və bronşektazi daxildir - bir və ya bir neçə bronx və ya bronxiolun xroniki iltihablı və ya degenerativ vəziyyəti.

        Qaraciyər sirrozu adlanan qaraciyər xəstəliyi AATD-nin başqa bir əlamətidir. Bəzi təsirlənmiş uşaqlarda, təxminən 10 faizində mövcud ola bilər və AATD olan böyüklərin 15 faizində də bildirilmişdir. Onun gec mərhələlərində qaraciyər xəstəliyinin əlamətləri və simptomları arasında qarın şişməsi, qanla öskürək, ayaqların və ya ayaqların şişməsi, dərinin və göz ağlarının sararması (sarılıq) ola bilər.

        Nadir hallarda, AATD ağrılı topaqlar və ya yamalar ilə bərkimiş dəri ilə xarakterizə olunan pannikulit kimi tanınan bir dəri vəziyyətinə səbəb ola bilər. Pannikulit şiddətə görə dəyişir və hər yaşda baş verə bilər.

        Alfa-1 antitripsin çatışmazlığı (AATD) böyüklərdə ağciyər xəstəliyi kimi özünü göstərə bilər və təsirlənmiş uşaqların kiçik bir hissəsində qaraciyər xəstəliyi ilə əlaqələndirilə bilər. Təsirə məruz qalan böyüklərdə AATD-nin ilk simptomları yüngül aktivliklə nəfəs darlığı, məşq qabiliyyətinin azalması və hırıltıdır. Bu simptomlar adətən 20-40 yaş arasında görünür. Digər əlamətlər və simptomlar təkrarlanan tənəffüs yolu infeksiyaları, yorğunluq, ayaq üstə durarkən sürətli ürək döyüntüsü, görmə problemləri və qəsdən çəki itirməni əhatə edə bilər.

        AATD olan bəzi şəxslərdə inkişaf etmiş ağciyər xəstəlikləri var və ağciyərlərdə kiçik hava kisələrinin (alveolların) zədələndiyi amfizem var. Amfizemin simptomlarına tənəffüs çətinliyi, öskürək və barrel formalı sinə daxildir. Siqaret çəkmək və ya tütün tüstüsünə məruz qalmaq simptomların görünüşünü və ağciyərlərin zədələnməsini artırır. Digər ümumi diaqnozlara KOAH (xroniki obstruktiv ağciyər xəstəliyi), astma, xroniki bronxit və bronşektazi daxildir - bir və ya bir neçə bronx və ya bronxiolun xroniki iltihablı və ya degenerativ vəziyyəti.

        Qaraciyər sirrozu adlanan qaraciyər xəstəliyi AATD-nin başqa bir əlamətidir. Təsirə məruz qalan bəzi uşaqlarda, təxminən 10 faizində ola bilər və AATD olan yetkinlərin yüzdə 15-də də bildirilmişdir. Onun gec mərhələlərində qaraciyər xəstəliyinin əlamətləri və simptomları arasında qarın şişməsi, qanla öskürək, ayaqların və ya ayaqların şişməsi, dərinin və göz ağlarının sararması (sarılıq) ola bilər.

        Nadir hallarda, AATD ağrılı topaqlar və ya yamalar ilə bərkimiş dəri ilə xarakterizə olunan pannikulit kimi tanınan bir dəri vəziyyətinə səbəb ola bilər. Pannikulit şiddətə görə dəyişir və hər yaşda baş verə bilər.


        Fermentlər: mənası, mexanizmi, təsnifatı, amilləri və əhəmiyyəti

        Fermentləri dərindən araşdıraq. Bu məqaləni oxuduqdan sonra aşağıdakıları öyrənəcəksiniz: 1. Fermentlərin mənası 2. Fermentlərin təsnifatı 3. Fermentlərin təsir mexanizmi 4. Fermentlərin fəaliyyətinə təsir edən amillər 5. Ferment spesifikliyi 6. Fermentlərin inhibisyonu və 7. Fermentlərin diaqnostik əhəmiyyəti.

        Fermentlərin mənası:

        Fermentlər reaksiyanın sürətini dəyişdirən (ümumiyyətlə gücləndirən) zülallı (və hətta nuklein turşuları) biokatalizatordur.

        Aktivləşmənin sərbəst enerjisi və katalizin təsiri:

        Substratdan məhsula bənzər kimyəvi reaksiya o zaman baş verəcək ki, müəyyən sayda substrat molekulları hər hansı bir anda "keçid vəziyyəti" adlı aktivləşdirilmiş vəziyyətə çatmaq üçün kifayət qədər enerjiyə malik olsunlar, burada kimyəvi bağ yaratmaq və ya pozmaq ehtimalı var. formada məhsul çox yüksəkdir. “Aktivləşdirmənin pulsuz enerjisi” müəyyən bir temperaturda substratın bir qram molunda olan bütün molekulları keçid vəziyyətinə gətirmək üçün tələb olunan enerji miqdarıdır.

        Katalizatorun iştirakı ilə substrat onunla birləşərək tək substratdan daha az aktivləşmə enerjisi olan keçici vəziyyət yaradır. Bu reaksiyanı sürətləndirir. Məhsul əmələ gəldikdən sonra ferment (katalizator) substratın başqa bir molekulu ilə birləşmək və prosesi təkrarlamaq üçün sərbəstdir. Bir fermentin iştirakı ilə aktivləşmənin sərbəst enerjisində dəyişiklik olsa da, reaksiyanın ferment tərəfindən katalizləşdirilməsindən asılı olmayaraq, reaksiyanın ümumi sərbəst enerji dəyişməsi eyni qalır.

        Fermentlərin təsnifatı:

        Fermentlərin təsnifatı aşağıdakılara əsaslanır:

        (2) müəyyən bir zamanda mövcudluğu və ya olmaması,

        (3) Fəaliyyətin tənzimlənməsi,

        (4) Hərəkət yeri və

        (5) Onların klinik əhəmiyyəti.

        1. Katalizləşdirilmiş reaksiyaya əsasən təsnifat:

        Fermentlər katalizləşən reaksiya növünə görə geniş şəkildə altı qrupa bölünür.

        (a) Oksidoreduktazlar:

        Oksidləşmə və reduksiya reaksiyalarına səbəb olan fermentlər.

        Məs. Piruvat + NADH - laktat dehidrogenaz → Laktat + NAD +

        Qlutamik turşu + NAD—qlutamatdehidrogenaz → α-ketoqlutarat + NH3 + NADH

        Hidrogendən başqa qrupların bir substratdan digərinə keçidini kataliz edən fermentlər. Məs. Transaminaza yeni keto turşusu və yeni bir amin turşusu meydana gətirmək üçün amin qrupunun amin turşusundan keto turşusuna keçməsini katalizləyir.

        Məs. (α-Ketoqlutarat + Alanin—alanin aminotransferaza → Qlutamat + Piruvat

        Aspartat + α-Ketoglutarate —aspartataminotransferaza Oksaloasetat + Qlutamat

        Su əlavə etməklə bağların qırılmasını kataliz edən fermentlər (hidroliz). Bütün həzm fermentləri hidrolazalardır. Məs. Pepsin, tripsin, amilaza, maltaza.

        Su əlavə etməkdən başqa mexanizmlə birləşmənin iki maddəyə parçalanmasını kataliz edən fermentlər. Nəticədə məhsul həmişə ikiqat bağa malikdir.

        Məs. Fruktoza-1-6-difosfat-ALDOLASE → Qliseraldehid-3-fosfat + DHAP

        Optik və həndəsi izomerlərin qarşılıqlı çevrilməsini kataliz edən fermentlər.

        Məs. Gliseraldehid-3-fosfat-İSOMERAZA → Dihidroksiasetonfosfat

        Bu fermentlər iki birləşmənin birləşməsini katalizləyir. Bu həmişə enerji tələb edən bir prosesdir (aktiv proses).

        Məs. Piruvat + CO2 + ATP—piruvat karboksilaza Oksaloasetat + ADP + Pi

        2. Müəyyən bir zamanda mövcudluğu və ya olmaması əsasında təsnifat:

        İki növ müəyyən edilir:

        (a) İnduksiya olunan fermentlər:

        Lazım olduqda hüceyrə tərəfindən sintez edilən fermentlər. Bu fermentlərin sintezi adətən bir induktor tələb edir.

        Məs. İnvertaz, HMG-CoA reduktaza, p-qalaktosidaza və sidik cövhəri siklində iştirak edən fermentlər.

        (b) Təsisedici fermentlər:

        İnduktorlardan asılı olmayaraq orqanizmdə daim normal miqdarda olan fermentlər.

        3. Fermentlərin təsirinin tənzimlənməsinə əsaslanan təsnifat:

        Onlar iki növdür:

        (a) Tənzimləyici fermentlər:

        Bu fermentlərin fəaliyyəti hüceyrənin vəziyyətindən asılı olaraq tənzimlənir. Tənzimləyici fermentlərin fəaliyyəti “allosterik sahə” adlanan aktiv sahədən başqa bir yerdəki modulator tərəfindən artırılır və ya azaldılır.

        Məs. Fosfofruktokinaz (PFK) və glutamat dehidrogenaz.

        (b) Tənzimləyici olmayan fermentlər:

        Bu fermentlərin fəaliyyəti tənzimlənmir.

        Məs. Süksinat dehidrogenaz.

        4. Fəaliyyət yerinə görə təsnifat:

        İki hərəkət yerindən asılı olaraq, onlar bölünür:

        (a) hüceyrədaxili fermentlər:

        Hüceyrə tərəfindən istehsal olunan və eyni hüceyrə daxilində fəaliyyət göstərən fermentlərə hüceyrədaxili fermentlər deyilir.

        Məs. Qlikoliz və TCA dövrünün bütün fermentləri.

        (b) Hüceyrədənkənar fermentlər:

        Hüceyrə tərəfindən istehsal olunan, lakin ondan asılı olmayaraq hüceyrənin xaricində fəaliyyət göstərən fermentlər. Məsələn, bütün həzm fermentləri, yəni. tripsin, pankreas lipazı və s.

        5. Kliniki əhəmiyyətinə görə təsnifat:

        (a) Funksional plazma fermentləri:

        Fermentlər plazmada kifayət qədər yüksək konsentrasiyada olur və onların plazma substratının olması səbəbindən plazmada funksionaldır.

        Məs. Serum lipazı, qan laxtalanma fermentləri.

        (b) Qeyri-funksional plazma fermentləri:

        Fermentlər plazmada cüzi bir konsentrasiyada mövcuddur və tərkibində substratın olmaması səbəbindən plazmada heç bir funksiyası yoxdur. Qeyri-funksional plazma fermentləri diaqnostik əhəmiyyətə malikdir.

        Fermentlər ferment nomenklatura komissiyası tərəfindən 4 rəqəmlə adlandırılır, burada

        1-ci rəqəm əsas təsnifata aiddir

        2-ci rəqəm alt təsnifata aiddir

        3-cü rəqəm alt alt təsnifata aiddir

        4-cü rəqəm həmin fermentə aiddir

        Məs. 2.7.3.2 adenozin trifosfat-kreatin fosfotransferazadır (kreatin kinaz).

        Fermentlərin təsir mexanizmi:

        Bir ferment (və ya zülal) bioloji aktiv olmaq üçün öz təbii uyğunlaşmasında olmalıdır. Fermentlərin üç ölçülü konformasiyası, substratın bağlandığı və təsirləndiyi xüsusi bir yerə malikdir, bu sahə aktiv sahə adlanır.

        Aktiv sayt iki xüsusi sahəyə ayrılmışdır:

        (1) Bağlama yeri - substratın bağlandığı və

        (2) Katalitik sahə - ferment katalizinin baş verdiyi yer.

        Aktiv sahədə mövcud olan amin turşuları tirozin, histidin, sistein, glutamik turşu, aspartik turşu, lizin və serindir. Aldolazada lizin aktiv yerdə mövcuddur. Karboksipeptidazada aktiv yerdə iki tirozin qalığı mövcuddur. Ribonukleazın aktiv yerində iki histidin var. Michaelis və Menten ferment-substrat kompleksini yaratmaq üçün fermentin substratla birləşməsi nəzəriyyəsini yaratdılar. Buna əsasən ferment təsir göstərdiyi substratla birləşərək ferment-substrat kompleksi əmələ gətirir. Sonra bu ferment sərbəst buraxılır və substrat reaksiya məhsuluna parçalanır.

        E [Ferment] + S [Substrat] → ES [Ferment-Substrat kompleksi] → E + Məhsul

        ES kompleksi həm də ‘Michaelis Menten kompleksi’ adlanır.

        Fermentlər kimyəvi reaksiyanın sürətini dörd əsas mexanizmlə sürətləndirir, yəni.

        1. Yaxınlıq və Orientasiya:

        Ferment substratla elə birləşir ki, həssas bağ katalitik qrupa yaxındır və eyni zamanda katalizlə nəticələnən dəqiqliklə ona yönəlir.

        2. Gərginlik və Təhrif və ya Uyğunluq Modeli:

        Substratın bağlanması ferment molekulunda konformasiya dəyişikliyinə səbəb olur, bu da aktiv sahənin formasını gərginləşdirir və həmçinin məhdud substratı təhrif edir və bununla da kataliz baş verir. Substratın fermentə bağlanması ferment molekulunun üçüncü və ya dördüncü strukturunda dəyişikliyə səbəb olacaq ki, bu da fermenti sabitsizləşdirir. Sabitliyə nail olmaq üçün ferment substratı təhrif edərək reaksiya məhsulunu əmələ gətirir.

        3. Ümumi turşu əsaslı kataliz:

        Fermentin aktiv yerində yaxşı proton donorları və ya proton qəbulediciləri olan amin turşuları var, bu, substratın turşu-əsas katalizinə səbəb olur.

        4. Kovalent kataliz:

        Bəzi fermentlər öz substratları ilə reaksiyaya girərək çox qeyri-sabit, kovalent şəkildə birləşmiş ferment-substrat kompleksləri əmələ gətirir və məhsullar əmələ gətirmək üçün sonrakı reaksiyaya girirlər.

        Fermentin fəaliyyətinə təsir edən amillər:

        Enzim katalizator reaksiyasının sürətinə təsir edən amillər:

        3. Substratın konsentrasiyası

        5. Məhsulların konsentrasiyası

        1. Temperaturun Təsiri:

        Bütün digər parametrlər sabit saxlanıldıqda (yəni optimal səviyyədə), o zaman ferment reaksiyasının sürəti maksimuma çatana qədər temperaturun artması ilə yavaş-yavaş artır. Temperaturun daha da artması zülalı denatürasiya edir, nəticədə fermentin fəaliyyəti azalır və temperaturun daha da artması zülalı tamamilə məhv edə bilər.

        Fermentin fəaliyyətinin maksimum olduğu temperatur optimal temperatur adlanır. Fermentlərin çoxu 0°C-dən 4°C-yə qədər temperaturda tamamilə qeyri-aktivdir, aktivliyi 10°C-də başlayır və yavaş-yavaş artır, optimal temperaturda maksimum gücünə çatır. İnsan orqanizmindəki fermentlərin əksəriyyətinin optimal temperaturu 37°C ilə 40°C arasındadır.

        Bu temperaturdan sonra fermentlər daha az aktivləşir və yüksək temperaturda fəaliyyətini tamamilə itirə bilər. Qızdırmada temperaturun yüksəlməsi fermentativ təsirin artması səbəbindən metabolik aktivliyi artırır. Temperaturun azalması orqan transplantasiyası və açıq ürək əməliyyatlarında görülən hipotermiyaya gətirib çıxarır.

        Bununla belə, həyat çox soyuq bölgələrdə və həmçinin isti bulaqlarda mövcuddur ki, bu da insan hüceyrəsində mövcud olan eyni fermentin, məsələn, qlikoliz və TCA dövrünün fermentlərinin həddindən artıq temperaturlarda optimal temperaturlara sahib olduğunu göstərir.

        Beləliklə, soyuducu bakteriyalar, fermentlərinin optimal temperaturu 4 ° C-ə yaxın olduqda mövcuddur. Eynilə, isti bulaqlarda sağ qalan bakteriyalar, məsələn, yüz(s) dərəcə Selsiyə yaxın optimal temperaturları olan fermentlərə malikdirlər. Taq polimerazının optimal temperaturu 72°C-dir.

        Vant Hoffs əmsalı:

        Temperaturun hər 10°C qalxması üçün optimal temperatura çatana qədər fermentin aktivliyinin 2 dəfə artdığını izah edən əmsaldır.

        2. pH-ın təsiri:

        Bütün digər parametrlər sabit saxlanıldıqda, ferment katalizli reaksiyanın sürəti optimal pH-a çatana qədər artır və sonra pH-ın daha da artması/azalması ilə azalır. Bioloji pH 7,4 olan fermentlərin əksəriyyəti üçün aktivlik maksimumdur. Pepsin üçün optimal pH 1,5, turşu fosfataza 4,5 və qələvi fosfataz üçün 9,8-dir.

        3. Substrat konsentrasiyasının təsiri:

        Bütün digər parametrlər ferment konsentrasiyası da daxil olmaqla sabit saxlanıldıqda, substrat konsentrasiyası artdıqca, ferment substratla doymuşa qədər reaksiya sürəti davamlı olaraq artır. Bu mərhələdə reaksiya sürəti artmır və sabit qalır. Qrafik sürətə qarşı substrat konsentrasiyası ilə çəkildikdə hiperbolik əyri verir.

        Bunun səbəbi, substratın konsentrasiyası artdıqca, substrat molekulları daha aktiv sahələr mövcud olmayana qədər aktiv yerlərində mövcud olan bütün ferment molekulları ilə birləşirlər. Beləliklə, bu mərhələdə substrat yalnız məhsullar sərbəst buraxıldıqda yerləri doldurur və reaksiya sürətini artıra bilmir.

        Km fermentin katalizləşdiyi reaksiyanın sürətinin maksimum sürətin yarısı olduğu substratın konsentrasiyası kimi müəyyən edilir.

        i. Yüksək Km dəyər ferment və substrat arasında zəif bağlanmanı göstərir.

        ii. Aşağı Km güclü bağlanmasını göstərir.

        Michaelis-Menten tənliyinin məhdudiyyətləri:

        i. Bu tənlik dəqiq dəyəri deyil, maksimum sürətin təxmini dəyərini hesablamağa imkan verir.

        ii. Allosterik yeri deyil, yalnız aktiv yeri olan fermentlər üçün yaxşıdır.

        iii. K-ni hesablayırm mono-substrat reaksiyaları üçün, çox substratlı reaksiyalar üçün deyil.

        iv. O, tənzimləyici olmayan fermentlərin sürətini deyil, tənzimləyici fermentlərin sürətini bilmək üçün istifadə olunur.

        Yuxarıdakı məhdudiyyətləri aradan qaldırmaq üçün substratın konsentrasiyası və sürətin qarşılıqlı təsiri arasında əlaqə yaratmaq üçün Line Weaver-Burke süjeti çəkilir.

        Line Weaver-Burke süjeti:

        Michaelis-Menten tənliyini tərsinə çevirərək, əldə edirik

        Bu tənliklə biz dəqiq hesablaya bilərik:

        i. Hər hansı bir fermentin katalizləşdiyi reaksiyanın sürəti.

        ii. Birdən çox substratın mövcud olduğu reaksiyanın sürəti.

        iii. Bütün fermentlərin sürəti.

        Tənzimləyici fermentlər sigmoid əyri, qeyri-tənzimləyici fermentlər isə hiperbolik əyri verir.

        4. Enzim konsentrasiyasının təsiri:

        Fermentin konsentrasiyası artdıqca, həddindən artıq miqdarda substrat olduqda reaksiya sürəti davamlı olaraq artır, digər amillər sabit saxlanılır. Xətti əyri yaranır.

        5. Məhsulların Təsiri:

        Məhsul reaksiya qarışığında daha çox olduqda, əks əlaqənin inhibəsi səbəbindən reaksiya sürəti azalır.

        6. İşığın təsiri:

        Müxtəlif fermentlərin fəaliyyət sürəti işığın müxtəlif dalğa uzunluğunda dəyişir. mavi işıq tüpürcək amilazanın fəaliyyətini artırır, U.V. işıq sürəti azaldır.

        7. İonların təsiri:

        Xüsusi ionların olması və ya olmaması fermentlərin aktivliyini artırır və ya azaldır. Pepsinogen H+ ionlarının iştirakı ilə pepsinə çevrilir. Kinazlar Mg+2 ionlarının iştirakı ilə fəaliyyət göstərir.

        Ferment spesifikliyi:

        Fermentlər reaksiyalarında çox spesifikdir. Onlar ya müəyyən bir substratda hərəkət edirlər, ya da müəyyən bir reaksiyanı katalizləyirlər.

        Buna görə ferment spesifikliyi iki növdür:

        1. Reaksiya Xüsusiyyəti:

        Bu fermentlər, təsir etdikləri substratdan asılı olmayaraq, katalizlədikləri reaksiya növü üçün spesifikdirlər. Beləliklə, fərqli fermentlər eyni substratda fərqli reaksiyalar yaradır, yəni fermentlər hansı substratdan asılı olmayaraq, müəyyən bir reaksiya üçün spesifikdir. amin turşularına həm amin turşularını ketoturşulara oksidləşdirən amin turşusu oksidaza, həm də onlardan karbon qazını çıxaran dekarboksilaza təsir göstərir.

        2. Substrat Xüsusiyyəti:

        Bu fermentlər təsir göstərdikləri substrat üçün spesifikdir. Bu daha sonra aşağıdakı kimi təsnif edilir.

        (a) Mütləq spesifiklik:

        Bu fermentlər yüksək spesifikdir və yalnız bir xüsusi substratda fəaliyyət göstərir və başqa substratda hərəkət etmir. Məs. Ureaza, katalaza, aspartaza.

        (b) Nisbi spesifiklik:

        Bu fermentlər müəyyən bir əlaqə üzərində hərəkət edir. Məs. D-amin turşusu oksidazı.

        (c) Qrup spesifikliyi:

        Bu fermentlər yalnız müəyyən bir qrup üzərində fəaliyyət göstərir.

        Tirozin, triptofan və fenilalanin kimi aromatik amin turşularının yaratdığı peptid bağlarına təsir edən proteolitik fermentdir.

        Əsas amin turşuları üçün spesifikdir. Beləliklə, lizin və argininin yaratdığı peptid bağlarını parçalayır.

        Sərbəst amin ucuna yaxın peptid bağı üzərində işləyir.

        Sərbəst karboksilik qrup üçün xüsusi.

        α-1 → 4 qlikozid bağları üçün spesifikdir.

        (d) Stereo xüsusiyyət:

        Bu fermentlər müəyyən bir stereo izomer üzərində hərəkət edir.

        i. Süksinat dehidrogenaz:

        Stereo izomer fumarat üçün spesifikdir, yəni ikiqat bağın cis forması.

        β qlikozid əlaqəsi üçün spesifikdir.

        iii. L-amin turşusu oksidazları:

        Yalnız L-amin turşularına təsir edir, D-amin turşularına təsir etmir.

        Onlar fermentlərin fəaliyyəti üçün tələb olunan qeyri-zülal, istiliyə davamlı, aşağı molekulyar çəkidə dializ edilə bilən üzvi birləşmələrdir. Ümumiyyətlə vitaminlər koenzim kimi çıxış edir. biotin, piridoksin və s. Kofermentlə birlikdə ferment ‘holoenzim’ və ko-fermenti olmayan bir ‘apoenzim’ kimi tanınır. Apoenzim (zülal) + Koenzim (qeyri-zülal) → Holoenzim (aktiv ferment zülalı).

        Holoenzimdə üzvi və ya qeyri-üzvi birləşmə (metal ionları) və ya hər ikisi ola bilər. Əgər üzvi maddələr fermentlərlə birlikdə olarsa, onlar ‘ko-fermentlər’, qeyri-üzvi maddələr isə fermentlərlə təsir göstərirsə, onlara “ko-amillər’ (Mg, Mn, Zn, Co, Se) deyilir. və s.).

        Koenzimlərin rolu:

        (i) Onlar ko-substrat və ya ikinci substrat kimi çıxış edirlər. Piruvat + NADH → Laktat + NAD + . NADH koenzim və ya ikinci substrat rolunu oynayır,

        (ii) Onlar ya hidrogenin, ya da hidrogendən başqa qrupların köçürülməsinə kömək edir və

        (iii) Koenzimin xüsusi aktivliyi bir milliqram ferment zülalında mövcud olan koenzim vahidlərinin sayıdır.

        Ferment vahidi və ya fəaliyyəti:

        Ferment aktivliyinin bir vahidi 25°C temperaturda dəqiqədə 1,0 (JM substratın J.M)-ni məhsullara çevirən fermentin miqdarıdır.

        Fermentin spesifik fəaliyyəti:

        Zülalın bir milliqramına düşən ferment vahidlərinin sayı kimi müəyyən edilir.

        Ferment dövriyyəsi sayı:

        Tək bir ferment tərəfindən dəqiqədə çevrilən substrat molekullarının sayı (vahid vaxt) ferment dövriyyəsi sayı kimi tanınır. Karbonik anhidraz ən yüksək dövriyyə sayına malikdir - 36.000.000.

        Birinci və ikinci dərəcəli reaksiya:

        Yalnız bir substratın olduğu reaksiyaya 1-ci dərəcəli reaksiya deyilir. Məhsul yaratmaq üçün iki substratın iştirak etdiyi reaksiyaya 2-ci dərəcəli reaksiya, həmçinin bi-substrat reaksiyası deyilir. Bu, ya tək yerdəyişməni (yəni, hər iki substratın eyni vaxtda fermentin iki aktiv sahəsinə bağlanmasını) və ya ikili yerdəyişməni (pinq-ponq yerdəyişməsini, burada yalnız bir substratın müəyyən bir zamanda fermentin aktiv sahəsinə bağlanması, bu sərbəst buraxıldıqdan sonra) daxildir. digər substrat bağlanır).

        Bir fermentin qeyri-aktiv forması zimogen və ya pro-ferment kimi tanınır. Pepsinogen və tripsinogen müvafiq olaraq pepsinin və tripsinin zimogenləridir.

        Fermentlərə bənzər reaksiyanı kataliz edən ribonuklein turşularına ribozimlər deyilir. Bu ribozimlər yeni transkripsiya edilmiş RNT-nin emalına kömək edir. kiçik nüvə RNT (SnRNA) və hetero-nüvə RNT (hnRNA).

        Fermentin inhibisyonu:

        PH, temperatur və s. kimi qeyri-spesifik maddələrdən başqa spesifik maddələrin ferment aktivliyinin dəyişməsi fermentin inhibəsi adlanır.

        İki növ ferment inhibəsi var:

        1. Geri dönməz ferment inhibəsi:

        Enzimin fəaliyyəti inhibitorun aktiv yerdəki kovalent bağlanması ilə inhibə edilir. Enzim inhibitor bağı dissosiasiya edilə bilməz, buna görə də daimi və geri dönməzdir, yəni geri qaytarıla bilməz.

        i. Aldolaz yodoasetat tərəfindən daimi olaraq inhibə edilir.

        ii. Sinir qazının tərkib hissəsi olan di-izopropilflurofosfat (DFP) insanlarda həzm fermentlərinin əksəriyyətini daimi olaraq inhibə edir. Buna görə də çox zəhərlidir.

        iii. Paraxloromerkurik benzoat (PCMB) heksokinaz və ureaz fermentlərini geri dönməz şəkildə inhibə edir.

        iv. Alkaloid reagentlər kimi üzvi reagentlər fermentləri geri dönməz şəkildə inhibə edir.

        2. Geri dönən ferment inhibisyonu:

        İnhibitorlar fermentə geri çevrilir və buna görə də daimi deyil. İnhibisyon müxtəlif mexanizmlərlə geri qaytarıla bilər.

        (a) Rəqabətli ferment inhibəsi:

        Bu, struktur oxşarlığına görə bir fermentin aktiv sahəsi üçün substrat və inhibitor arasında rəqabətin olduğu geri dönən inhibə növüdür. Bütün qeyri-tənzimləyici fermentlər rəqabətli inhibə göstərir. Clinically competitive enzyme inhibition is of great importance since most of the drugs act by competitive inhibition.

        (i) The enzyme succinate dehydrogenase’s (SDH) substrate is succinic acid and the competitive inhibitors are oxalic acid, mallonic acid and glutaric acid. Among these, mallonic acid is the most potent competitive inhibitor of SDH.

        (ii) Folic acid, a vitamin for human beings has para-amino benzoic acid (PABA) as one of its components. Whereas it is not a vitamin for microorganisms i.e., they cannot utilize preformed folic acid from external source, instead they synthesize their own folic acid from aba. Sulpha drugs contain para-amino sulphonate which is structurally similar to PABA and hence competes for the enzyme active site of folic acid synthesis in microorganisms. If excess dose of sulpha drug is given, it results in inhibition of folic acid synthesis thus acting as an antibiotic. Human beings are not affected, because they do not synthesize folic acid.

        (iii) Methanol is acted upon by the enzyme alcohol dehydrogenase forming formaldehyde which is highly poisonous. If ethanol if given to methanol intoxicated patients then ethanol competitively binds to alcohol dehydrogenase thereby preventing formation of formaldehyde.

        (iv) Allopurinol is the competitive inhibitor of the enzyme xanthine oxidase whose substrate is hypoxanthine. Allopurinol prevents the formation of uric acid by competitive inhibition because it has structural similarity to hypoxanthine. This principle is used in the treatment of gout i.e. abnormal accumulation of uric acid crystals in the joint causing inflammation.

        (v) Glaucoma is a condition in which there is accumulation of fluid in the lens resulting in enlargement of eye. This can be treated with ‘acetazolamide’ which inhibits the enzyme carbonic anhydrase competitively. This prevents water formation and subsequent release of more water through the urine.

        (b) Non-competitive enzyme inhibition:

        It is shown by regulatory enzymes, also called allosteric enzymes.

        These are the enzymes that contain a site other than the active site which is called ‘allosteric site’. The action of some enzymes is regulated by ‘effectors’ which can bind reversibly to the enzyme molecule at specific sites other than the substrate binding site called the modulator site or the allosteric site.

        There is no competition between substrate and inhibitor for the active site since the inhibitor or modulator binds at the modulator site or allosteric site. If the binding of the effector causes inhibition of the enzyme action then it is called a negative effector and the process is called ‘allosteric inhibition’.

        If the enzyme reaction is activated by a modulator then it is called a positive modulator or effector and the process is called ‘allosteric activation’.

        Məs. Phosphofructo kinase (PFK) is an allosteric enzyme of the glycolytic pathway.

        The positive modulators of this enzyme are AMP and ADP.

        The negative modulators of PFK are ATP and citrate.

        These are substances (generally proteinacious in nature) that inhibit most of the digestive enzymes, ex. certain roundworms and hookworms survive in the intestine by secreting anti enzymes. Uncooked rice contains certain proteins that act as anti enzymes.

        Reversible covalent modification:

        Enzyme activity can be regulated by reversible covalent modification.

        It is regulated by cyclic inter-conversion of enzyme into two forms:

        The inter-conversion is brought about by a ‘converting enzyme’. The process of activation and inactivation of the enzyme is generally brought about by covalent phosphorylation or de-phosphorylation of the target enzyme. For example hormones like epinephrine, glucagon etc. bind to the hormone receptor site on the cell membrane and activate the enzyme adenyl cyclase, which in turn converts ATP to cyclic AMP (cAMP). This cAMP converts inactive protein kinase to active protein kinase (‘a’ form). This protein kinase phosphorylates many enzymes in the cell, some of which become active and yet some others become inactive.

        The inactive phosphorylase (‘b’ form) gets converted to active phosphorylase (‘a’ form) upon phosphorylation and affects the breakdown of glycogen to glucose. On the other hand glycogen synthase becomes inactive upon phosphorylation thereby inhibiting the formation of glycogen.

        Diagnostic Importance of Enzymes:

        Enzymes were classified into two groups based upon their clinical importance as ‘functional plasma enzymes’ i.e., those enzymes present in the plasma in considerably high amounts and are functional in the plasma due to the presence of their substrate in it.

        Məs. serum lipase, blood clotting enzymes, and ‘non-­functional plasma enzymes’ i.e., those enzymes that are present in the plasma in negligible amounts and have no function in the plasma due to the absence of their substrate in it. Non-functional plasma enzymes are of diagnostic importance.

        The non-functional plasma enzymes are present in higher concentration in tissues and very low concentration in the plasma i.e. in trace amounts, but their concentration in plasma increases immediately following tissue injury or destruction.

        If there is tissue damage leading to cell rupture then the enzymes present in that tissue leaks into the blood leading to the increase in the concentration of these enzymes in the plasma. Increase in the level of non-functional plasma enzymes in the blood, indicates the disorder to the tissue where they exist. Different enzymes exist in different tissues in varying levels. Damage to a specific tissue releases a particular enzyme. Therefore estimation of enzymes in the plasma has a diagnostic importance.

        The non-functional plasma enzymes include lactate dehydrogenase (LDH), creatine phosphokinase (CPK), alanine amino transferase (ALT) or serum glutamate pyruvate transaminase (SGPT), aspartate transaminase (AST) or serum glutamate oxaloacetate transaminase (SGOT), sorbitol dehydrogenase, alkaline phosphatase, acid phosphatase, amylase, pancreatic lipase etc.

        However functional plasma enzymes are already in higher concentration in the plasma, hence their decrease in the concentration in the plasma indicates malfunction of the organ where they are synthesized ex. blood clotting enzymes are synthesized in the liver hence decrease in their concentration indicates liver dysfunction.

        Anyway an immediate assessment of the liver function cannot be made by this assessment because by the time the enzyme concentration in the plasma decreases (may take 4 to 5 days), the liver must have regained its normal vitality.

        Diagnosis of Myocardial Infarction using Enzyme Assay:

        There are three main enzymes that are used in the diagnosis of myocardial infarction (1) Lactate dehydrogenase (LDH) (2) Creatine phosphokinase (CPK)—marker enzyme and (3) Transaminase (AST or SGOT).

        (1) Lactate dehydrogenase (LDH):

        LDH catalyses the inter conversion of pyruvate to lactate, a very important reaction of anaerobic glycolysis. Glycolysis occurs in each and every cell, in some cells it is always anaerobic (RBC) whereas in others it is aerobic sometimes and anaerobic at some other time (muscle tissue, liver, kidney etc.).

        In other words LDH is present in each and every cell of the body. Therefore damage to any of the tissues of the body results in release of LDH into the plasma. Hence it becomes a difficult task to trace out the organ from which it has leaked.

        However LDH exists in five isoenzyme forms i.e. multiple forms of the same enzyme (These enzymes bring about the same reaction but exhibit different physical characters like molecular weight, charge, electrophoretic mobility, Km and isoelectric pH). The polypeptides in LDH are designated as ‘H chain’ and ‘M chain’.

        All the isoenzyme forms of LDH are tetramer i.e. has four polypeptides in the following combinations:

        (e) M4 or LDH5—Liver and skeletal muscle

        All these isomers have been successfully separated on Sodium Dodecyl Sulphate Polyacryl Amide Gel Electrophoresis (SDS-PAGE) and their banding pattern from the plasma is established as under—

        LDH1 və ya H4 is predominantly present in the cardiac muscle, whereas the isoenzyme form LDH5 or M4 is more abundant in the skeletal muscle. These two enzymes have different Km values and Km is indirectly proportional to affinity (Km a 1/affinity).

        The skeletal muscle enzyme M4 has low Km value for pyruvate and hence greater affinity for pyruvate resulting in high rate of conversion of pyruvate to lactate. The cardiac isoenzyme LDH1 və ya H4 has high Km value for pyruvate hence lesser affinity for pyruvate, therefore low rate of conversion of pyruvate to lactate. Thus the concentration of H4 or LDH1 isoenzyme form of lactate dehydrogenase increases in the plasma during myocardial infarction. The peak levels of LDH are maintained in the plasma for 6 days following the attack, after which it starts receding in its concentration.

        (2) Creatine phosphokinase (CPK):

        This is known as the marker enzyme for the diagnosis of myocardial infarction or heart attack, because this is the first enzyme to increase within a short time in the blood plasma following a heart attack. CPK is an enzyme that catalyses the conversion of creatine to creatine phosphate, a high energy compound that works to supply energy during muscle contraction. Therefore this enzyme is present only in a few tissues like the cardiac muscle, skeletal muscle and the brain.

        CPK also exists in various isoenzyme forms. It has two polypeptides ‘B’ & ‘M’ that form dimers in the following combinations to give rise to three isoenzymes of CPK.

        MB — Predominant in cardiac muscle

        MM — Predominant in skeletal muscle

        Thus estimation of the isoenzyme MB is indicative of heart attack. CPK maintains a higher concentration in the plasma for 1-2 days. The concentration of CPK after the first attack is 10 times more than the normal and if another attack occurs within a day or two the concentration further increases to 100 fold and a third attack within a short span of time raises the level of CPK to 300 fold which is lethal concentration.

        Among the two transaminases, aspartyl transaminase (AST or SGOT) increases in the plasma following an attack and the higher levels are seen in 4 to 5 days following an attack.


        Z and S Mutations of the 㬑-Antitrypsin Gene and the Risk of Chronic Obstructive Pulmonary Disease

        Chronic obstructive pulmonary disease (COPD) has been associated with heterozygosity for the Z and S alleles of the α1-antitrypsin gene in some studies, but these observations have not been confirmed by others. Cigarette smoking is the major risk factor for COPD and may have been a confounding factor in many of the previous studies. We investigated whether the Z or S alleles were more prevalent in a group of heavy smokers with COPD than in a group of nonobstructed smokers. Forced expiratory volume in 1 s and forced vital capacity were derived for 266 patients undergoing lobar or lung resection. These lung-function measurements were used to divide the patients into a COPD group and a group of nonobstructed control subjects. The subjects were typed for the Z and S alleles of the α1-antitrypsin gene using a polymerase chain reaction–based technique. In the COPD patients, 12 of 193 (6%) were heterozygous for the Z allele (MZ) compared with 0 of 73 control subjects, which gave a P value of 0.04 after correction for age, gender, and smoking history. There was no association of the S allele with COPD. The results indicate that the Z, but not the S, allele is a risk factor for COPD in the heterozygous state.

        Chronic obstructive pulmonary disease (COPD) is characterized by decreased expiratory flow rates, increased pulmonary resistance, and hyperinflation. The processes that underlie these symptoms are thought to be proteolytic destruction of the lung parenchyma and inflammatory narrowing of the peripheral airways.

        The association between very low serum concentrations of α1-antitrypsin and pulmonary emphysema was originally described by Laurell and Eriksson (1). α1-Antitrypsin is a serine protease inhibitor (Pi) that primarily binds neutrophil elastase and therefore prevents the breakdown of elastic tissue, mainly in the lung. More than 70 different biochemical variants, or Pi types, have been described (2). The most common variant, M, consists of at least six subtypes, all characterized by normal serum α1-antitrypsin levels. The Z and S variants are associated with α1-antitrypsin deficiency. The population prevalences for the MM, MS, and MZ genotypes among whites are 86, 9, and 3%, respectively (3). MM individuals have normal levels of α1-antitrypsin, whereas MS and MZ individuals have mean levels of 75% and 57% of normal, respectively. Individuals with the ZZ genotype have severe α1-antitrypsin deficiency, with mean levels at ∼ 15% of normal, and are at increased risk for COPD (4). Homozygosity for the S allele results in a mean α1-antitrypsin level ∼ 52% of normal and occurs in ∼ 0.1% of whites (5, 6). Individuals with the SS genotype may have an increased risk for emphysema (7, 8). SZ compound heterozygotes are also at risk for COPD (9).

        The issue of whether the Z and S alleles are risk factors for COPD in the heterozygous state remains controversial. Several case–control studies have found a higher prevalence of MZ heterozygotes among COPD patients than in control populations (7, 8, 10-15). However, comparisons of MZ individuals with MM subjects from the general population have generally found no excess risk of COPD (or decline in respiratory function) associated with MZ heterozygosity (16-23).

        We have investigated the prevalence of α1-antitrypsin genotypes in a group of heavy cigarette smokers with and without airway obstruction. The subjects for both groups were selected on the basis of their development of bronchogenic cancer, which resulted in a study population with a high level of exposure to cigarette smoke. Therefore, the COPD patients could be compared with individuals who had maintained normal airway function despite being chronic heavy smokers. Measurements of lung elastic recoil (maximal static recoil pressure [P l maks]) and emphysema were available for the majority of subjects. Therefore, we were able to investigate whether the Z allele was associated with emphysema and loss of elastic recoil, as suggested by previous studies (24). By employing a polymerase chain reaction (PCR) method to genotype the samples, we were able to include individuals in the study for whom only paraffin-embedded tissue samples were available.

        Subjects for the study were recruited from 532 patients undergoing lobar or lung resection. Before surgery, the patients completed an interviewer-administered questionnaire regarding smoking history, occupational exposure to dusts or fumes, and respiratory symptoms. Lung-function measurements made on each patient included subdivisions of lung volume measured in a pressure-compensated body plethysmograph, and maximal expiratory flow and volume. Values of forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), and the FEV1/FVC ratio were calculated. In 63% of the subjects a pressure volume curve of the lung was also obtained, from which the P l maks was derived as previously described (25). In 68% of the subjects, resected lung samples were graded for emphysema as previously described (26).

        Any patients in whom the lung lesion was obstructing a segmental or larger bronchus, or in whom there was evidence of significant obstructive pneumonitis, were not included in the study because these conditions may influence lung function. There were 28 nonsmokers who were excluded from the study groups.

        On the basis of the lung function tests, the remaining 504 patients were divided into those with and without significant airway obstruction. Obstructed patients were those who had an FEV1 < 80% predicted and an FEV1/ FVC < 70%. Nonobstructed patients were those who had an FEV1 > 85% predicted and an FEV1/FVC > 75%. There were 219 patients classified as obstructed, and 73 as nonobstructed. All of the patients were of white ancestry. We were able to extract and amplify DNA successfully from 266 of these subjects, including 193 obstructed and 73 nonobstructed patients. In this population the mean age was 63 ± 10 yr, and mean cigarette smoking was 55 ± 33 pack-yr. The 212 subjects with intermediate levels of lung function were not used in the study.

        Genomic DNA was extracted from frozen lung-tissue samples, peripheral blood leukocytes (27), or paraffin-embedded tissue samples (28) by standard techniques.

        Detection of the Pi Z allele was performed by a modification of the PCR method described by Dry (29). For PCR amplification of the region of exon V containing the Z mutation, the following oligonucleotide primers were used: 5′TAAGGCTGTGCTGACCATCGTC3′ and 5′CAAAGGGTTTGTTGAACTTGACC3′.

        PCR was carried out in a 20-μl volume containing 100 ng genomic DNA 1 μM of each primer 200 μM each of dGTP, dCTP, dTTP, and dATP 1.5 mM MgCl2 and 0.5 U Taq DNA polymerase. Amplification conditions were 40 cycles of 94°C for 30 s, 59°C for 30 s, and 72°C for 10 s. Samples were then digested at 65°C with 10 U of TaqI restriction enzyme, and electrophoresed on 3% agarose gels stained with ethidium bromide. The amplification produced a 110-base pair (bp) product and introduced a TaqI restriction site into the wild-type M allele but not into the Z allele. Therefore, after TaqI digestion, the M allele was cut into 89- and 21-bp bands, whereas the Z allele remained as a 110-bp band (Figure 1 ).

        Fig. 1. Analysis of the α1-antitrypsin Z and S mutations using restriction endonuclease digestion. (A) TaqI digestion of PCR products amplified from exon V yields an 89-bp fragment from the M allele and a 110-bp fragment from the Z allele. (B) TaqI digestion of PCR products amplified from exon III yields a 98-bp fragment from the M allele and a 78-bp fragment from the S allele. L = 100-bp DNA ladder.

        Analysis of the S allele in exon III was performed by a similar method. Primers were designed so that the upstream primer introduced an artificial TaqI restriction site in the M allele but not in the S allele. Primers for this analysis were 5′GAGGGGAAACTACAGCACCTCG3′ and 5′ACCCTCAGGTTGGGGAATCACC3′. The PCR was carried out using the same conditions as the Z mutation. The amplification produced a 98-bp product that was subsequently digested with 10 U of TaqI. The M allele sequence contained a TaqI restriction site and therefore was cut into 78- and 20-bp bands, but the S allele remained as a 98-bp band (Figure 1 ). Samples of these restriction enzyme analyses were confirmed using sequence-specific oligonucleotide (SSO) probes as described by Bruun-Petersen and colleagues (30).

        The associations of the Z and S mutations with obstruction were tested by the score test from logistic regression. Analyses were adjusted for the effects of age, sex, and smoking. Smoking was examined by cigarette years: the number of years smoked times the number of cigarettes smoked per day.

        The mean physiologic and morphologic data for the two groups are shown in Table 1. Because the obstructed and nonobstructed groups were significantly different for age, sex, and smoking, the results were corrected for these potentially confounding factors by logistic regression.

        Table 1. Population characteristics and pulmonary function values in obstructed versus nonobstructed individuals

        The prevalence of MS heterozygosity in all of the study subjects was 23 of 266 (9%). In addition, 2 of 266 (1%) subjects were found with the SS genotype. The distribution of genotypes was consistent with previous studies of white populations (3). The results are summarized according to phenotype in Table 2. The genotypes of all the MS and SS individuals were confirmed using the SSO method.

        Table 2. Prevalence of S and Z alleles of the α1-antitrypsin gene in obstructed and nonobstructed subjects

        * Adjusted for age, sex, and smoking history.

        In the obstructed group, 16 of 193 subjects (8%) were MS, compared with 7 of 73 (10%) in the nonobstructed subjects. The two SS homozygotes were from the obstructed group. The FEV1 values for these subjects were 71% and 70% predicted, and the FEV1/FVC values were 64% and 61%. The odds ratio associated with the MS/SS genotypes was 0.80 (95% CI = 0.29, 2.18) after correction for age, sex, and smoking history, and was not significant (P = 0.65).

        Twelve of 266 (4%) of the subjects in the study were heterozygous for the Z allele, and no ZZ individuals were detected. These data were consistent with previous population studies of white individuals (3). The prevalence of the MZ genotype in the obstructed and nonobstructed groups is summarized in Table 2. All of the MZ genotypes were confirmed by SSO typing.

        The Z allele was found in 12 of 193 (6%) of the obstructed group compared with 0 of 73 subjects in the nonobstructed control group. The MZ genotype was associated with airway obstruction after correction for age, sex, and smoking history (P = 0,04). It was not possible to calculate an odds ratio for this genotype because none of the control group had the mutation. There were no significant differences in mean P l maks % predicted (89% versus 80%, P = 0.62) or mean emphysema score (14 versus 16, P = 0.77) in obstructed subjects with the MZ genotype versus obstructed patients with the MM genotype.

        Previous studies of α1-antitrypsin deficiency alleles and the risk of COPD have been of two designs. First, case– control studies were used to compare the prevalence of MZ and MS heterozygotes in groups of COPD patients and in control subjects. The usual finding from these studies was that the presence of the MZ genotype was a significant risk factor for COPD (7, 8, 10-15). The major criticism of these studies has been that the cases and controls were ascertained separately with different recruitment strategies. This may lead to a systematic difference between cases and controls (e.g., in ethnic background) that may bias the results.

        The second type of study designed to detect an effect of S and Z heterozygosity involved selecting samples of individuals with MZ or MS genotypes for comparison with MM individuals. For the most part these population studies have shown no increased risk of impaired lung function with heterozygosity for either allele (16-23). The major problem with these studies is that they have insufficient power to detect a factor that produces a modest increase in risk. In addition, many of the subjects in these studies were not old enough to have developed COPD or were nonsmokers. However, in some population studies MZ individuals were found to have significantly worse lung function (14, 31-35).

        In the present study we used a novel design to improve the power of the case–control approach and decrease the chance of ascertainment bias. By selecting only those individuals who have smoked enough to develop lung cancer we attempted to ensure that both the cases and the controls had a high exposure to the most important risk factor for airway obstruction. However, the obstructed group was older, had smoked more, and had a higher percentage of males than the nonobstructed group. These differences may have accounted for the development of COPD in the obstructed group. Therefore, we adjusted the results of the analyses by logistic regression.

        The genotype frequencies in our study subjects (9% MS, 4% MZ) were similar to those found in general white populations (9% MS, 3% MZ) (3). We did not identify any ZZ homozygotes in our study groups. Previous studies have found that 1 to 3% of COPD patients have the ZZ genotype (8, 11). We may have found fewer ZZ homozygotes than expected because our subjects were recruited from lung cancer patients. It is possible that ZZ individuals would have experienced fatal loss of lung function before they could have smoked enough to develop lung cancer. Alternatively, these individuals may have had early onset COPD with lung function sufficiently impaired to preclude lung resection.

        There was no association of the MZ genotype with emphysema or loss of elastic recoil. However, we cannot rule out such associations because the number of MZ subjects for whom these data were available was small (emphysema score, n = 7 P l maks, n = 5). In addition, although patients who have COPD and are homozygous ZZ often have a pure form of emphysema, they may also present with primarily airway disease (36).

        Because all subjects were ascertained in the same way, the risk for a systematic bias in the genotype distribution was minimized. However, we recognize the possibility that an association observed in patients with lung cancer may not be applicable to the general population.

        We devised genotyping protocols that allowed detection of the Z and S alleles by PCR. The products of the amplification were designed to be short DNA fragments of approximately 100 bp. This enabled us to analyze DNA extracted from archival material in the form of blocks of paraffin-embedded tissue. DNA from such a source is frequently degraded, and it is often only possible to amplify small molecules. This approach permitted us to use the considerable patient resources available as pathologic specimens. By using a mismatched primer in the PCR reaction we were able to genotype the samples using TaqI restriction enzyme. This is a rapid, reliable, and inexpensive procedure that allowed efficient study of a large number of samples.

        The results demonstrated no difference in the prevalence of MS heterozygotes in the obstructed group compared with the nonobstructed. This result may reflect the fact that the S allele is a mild deficiency variant and if an increased risk of COPD is associated with the allele, it would be expected to be small. In some case–control studies an increased prevalence of MS genotypes in COPD patients has been reported (7, 8), whereas in others no association was found (12, 13, 15). Population studies have failed to detect increased risk of impaired lung function associated with the MS genotype (16, 18, 20-23). However, it is possible that the S allele may contribute to the susceptibility to COPD in conjunction with other factors (either genetic or environmental). The two individuals with the SS genotype had COPD, consistent with previous observations that this genotype is more prevalent in subjects with airway obstruction (7, 8).

        The Z allele causes a more severe deficiency of α1-antitrypsin, and the results of this study show that all of the MZ individuals in our population had COPD. This association was significant even after correction for potentially confounding factors such as age and smoking history. These results support previous studies that have suggested that the Z allele is a risk factor for COPD in the heterozygous state (7, 8, 10-15). The data indicate that intermediate deficiency of α1-antitrypsin enhances the decline in lung function that accompanies chronic exposure to cigarette smoke.

        In summary, we have used a novel study design to examine further the risk for COPD associated with S and Z heterozygosity. Although there was no increased risk for COPD associated with the presence of the S allele, we found that the prevalence of MZ individuals was increased in the COPD group compared with control subjects.



Şərhlər:

  1. Maverick

    Hesab edirəm ki, siz haqlı deyilsiniz. Mən mövqeyi müdafiə edə bilərəm. PM-ə yazın, əlaqə saxlayaq.

  2. Musho

    Yalanı o deməlidir.

  3. Manfrit

    Nə diqqətəlayiq bir sual

  4. Avishai

    Səhv edirsən. Bunu müzakirə etməyi təklif edirəm. PM-də mənə e-poçt göndərin, danışacağıq.

  5. Fitz Gerald

    Bəli, doğru dedin



Mesaj yazmaq