Məlumat

Homodimerləri heterodimerlərdən fərqləndirməyin proqram yolu?

Homodimerləri heterodimerlərdən fərqləndirməyin proqram yolu?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

üçünpdbfaylların homodimerlərdən və ya heterodimerlərdən ibarət olub olmadığını müəyyən etmək üçün sadə proqram yolu var.

Mənim çoxlu faylım var, ona görə də onlayn alət və ya bəzi psuedokod/skriptlər hər birini əl ilə qiymətləndirməkdən daha çox kömək edəcək.


Mən sadəcə fərdi zülal zəncirlərinin amin turşusu ardıcıllığını müqayisə edərdim. Sıxlıqda müşahidə edilməyən qalıqlar üçün bəzi boşluqlarla, yəni yalnız 90 və ya 95% ardıcıllıq eyniliyini tələb edir və ya boşluqlara məhəl qoymur.

Bu, dimerin (asimmetrik vahiddə bir neçə molekulu müşahidə etsəniz) həqiqətən real olub-olmadığı barədə heç nə deməyəcək. Bunun üçün siz eksperiment, ədəbiyyat araşdırması etməli və ya PISA serveri kimi proqram təminatının sizə ipucu verə biləcəyini görməlisiniz.


Öz alt proqramınızı yazmaq istəyirsinizsə,
1. Bütünü skan edin.pdbmövcud zəncirlərin sayı üçün fayl, əgər çoxsa, davam edin.
2. Yaradınindex_counterbir zəncirin hər bir amin turşusu üçün.
3. İndi, TEK zəncir üçün. Hər bir amin turşusu üçün skan edərkən ai=i+1xüsusi əməliyyatamin turşularının_sayıcısı.
4. Müqayisə edinamin turşularının_sayıcısızəncirlər arasında/arasında.
5. Tam uyğunluq = homomer və ya qeyri-dəqiq uyğunluq = heteromer.
Ümid edirəm məntiqi başa düşəcəksiniz.


Ann K. Corsi, Ph.D.

Araşdırmamız inkişaf biologiyasının əsas sualını anlamaq məqsədi daşıyır: "İnkişaf zamanı hüceyrənin taleyi necə müəyyənləşir?" Və ya daha sadə desək, hüceyrə sinir hüceyrəsi və ya başqa bir hüceyrə növü deyil, əzələ hüceyrəsi olduğunu necə bilir? Xüsusi zülallar hüceyrənin taleyinə kömək edir və transkripsiya faktorları adlanan tənzimləyicilər bu zülalların varlığına nəzarət edir. Transkripsiya faktorlarının öz funksiyalarını necə yerinə yetirdiyini diqqətlə araşdırmaq hüceyrə taleyinin spesifikasiyasını başa düşmək üçün çox vacibdir. Mezodermada transkripsiya tənzimlənməsi kontekstində hüceyrə taleyinin spesifikasiyasını öyrənirik. Mezoderma əzələ, birləşdirici və ürək toxumalarının əmələ gəldiyi orta embrion mikrob təbəqəsidir. İstifadə etdiyimiz model orqanizm qeyri-parazit torpaq nematodu Caenorhabditis elegansdır. C. elegans şəffaf hüceyrələr, tam genom məlumatı və güclü genetika kimi inkişafı öyrənmək üçün bir sıra üstünlüklərə malikdir. Heyvanların 3 gün kimi qısa nəsil müddəti də var ki, bu da sürətli təcrübələrə imkan verir. Bundan əlavə, nematodlar mezodermal mənşəli bir neçə toxuma növünə malikdir və bununla belə, bir hüceyrə səviyyəsində hadisələrə diqqət yetirə bilməyimiz üçün az sayda mezodermal hüceyrələr var.

Hüceyrə taleyinin spesifikasiyasında bir sıra transkripsiya faktorları rol oynayır. Biz C. elegans-da mezodermanın naxışlanmasında və spesifikasiyasında rol oynayan əsas heliks-loop-helix (bHLH) transkripsiya faktoru CeTwist-ə diqqət yetiririk. Məqsədimiz bu amilin müxtəlif mezodermal hüceyrələr dəstində hədəf genlərin ifadəsini idarə edən mexanizmi anlamaqdır. CeTwist başqa bHLH faktoru olan CeE/DA ilə heterodimerlər əmələ gətirir. Məqsədimizə doğru ilk addım olaraq, C. elegans genomundakı bütün transkriptləri təmsil edən mikroarraylardan istifadə edərək heterodimerlərin hədəf genlərini müəyyən etdik (Wang et al., 2006). Hədəf genlərdən biri olan arg-1-in tənzimlənməsi mexanizmini də araşdırdıq (Zhao et al., 2007). arg-1-in promotor bölgəsində arg-1-in ifadə nümunəsi üçün unikal tələb olunan üç element tapdıq. Hal-hazırda, bu elementlərin fərdi hüceyrələrdə transkripsiyanı tənzimləmək üçün bHLH amilləri tərəfindən unikal şəkildə necə istifadə edildiyini başa düşmək üçün müxtəlif araşdırma xətlərini davam etdiririk. Bundan əlavə, Homodimerləri ehtiva edən CeTwist üçün rol müəyyən etdik (hazırlıqda olan əlyazma) və homodimerlərin hədəf genlərini müəyyən etmək üçün mikroarray yanaşmasından istifadə edirik. Nəhayət, CeTwist və CeE/DA genlərinin müvəqqəti və məkan tənzimlənməsini başa düşmək üçün biz onların ifadəsi üçün vacib olan elementləri müəyyən etmək üçün reportyor gen yanaşmasından istifadə edirik. Kollektiv olaraq, çoxşaxəli yanaşmalarımızın mezodermanın inkişafında bHLH amilləri ilə hədəf gen nəzarətinin mexaniki anlayışını təmin edəcəyini gözləyirik.

Bizim işimizin insan sağlamlığı üçün mühüm nəticələri var. İnsanın Twist genindəki mutasiyalar Saethre-Chotzen sindromu adlı inkişaf pozğunluğu ilə əlaqələndirilir və bu xəstəlikdə xəstələrdə kraniofasiyal və rəqəmsal qüsurlar olur. arg-1 də daxil olmaqla bir neçə CeTwist hədəf geninin insan homoloqlarında mutasiyalar Saethre-Chotzen xəstələrində müşahidə olunanlara bənzər qüsurlara səbəb olan digər insan sindromları ilə əlaqələndirilir və əsas genetik əsası hələ məlum olmayan oxşar xəstəliklər mövcuddur. Beləliklə, laboratoriyamızda genetik və molekulyar yanaşmalarla müəyyən edilən C. elegans genləri əlaqəli inkişaf sindromlarından əziyyət çəkən fərdlərdə qüsurlu insan genlərinə namizədləri ortaya çıxaracaq. Biz artıq bir neçə namizəd gen tapmışıq və gözləyirik ki, onların tənzimlənməsinin diqqətlə başa düşülməsi insanlarda kraniofasiyal xəstəliklər haqqında daha çox başa düşməyə kömək edəcək.

Tədqiqatın maliyyələşdirilməsi

Dr. Korsinin işi Milli Sağlamlıq İnstitutunda Milli Diş və Kran-Üz Tədqiqatları İnstitutunun R15 Akademik Tədqiqatların Təkmilləşdirilməsi Mükafatı (AREA) qrantı ilə maliyyələşdirilir.  

Son Nəşrlər

1. Kim, S, Twigg, SRF, Scanlon, VA, Chandra, A, Hansen, TJ, Alsubait A, Fenwick AL, McGowan SJ, Lord H, Lester T, Sweeney E, Weber A, Cox H, Wilkie AOM, Golden , A, Corsi, AK (2017) Lokallaşdırılmış TWIST1 və TWIST2 əsas domen mutasiyaları modelləşdirilə bilən dörd fərqli insan xəstəliyinə səbəb olur. C. elegans. Hum Mol Genet. 26:2118-2132.

2. Corsi, AK, Wightman B, and Chalfie M (2015) A Transparent Window into Biology: A Primer on Biology Caenorhabditis elegans. Genetika 200:387-407.


Mücərrəd

Meqanükleazlar genomlarda uzun (㸒 bp) unikal ardıcıllıqları kəsir və onların bölünmə sahəsinin yaxınlığında homoloji rekombinasiya yolu ilə hədəflənmiş genom mühəndisliyi yaratmaq üçün istifadə edilə bilər. Bununla belə, təbii meqanükleazların istifadəsi onların hədəf ardıcıllığının repertuarı ilə məhdudlaşır və seçilmiş hədəfləri parçalayan yenidən işlənmiş meqanukleazların mühəndisliyi üçün xeyli səy göstərilmişdir. I-CreI kimi homodimerik meqanükleazlar bir iskele təmin etdi, lakin yalnız yeni kvazi-palindromik DNT ardıcıllıqlarını tanımaq üçün dəyişdirilə bilər, onların ümumi tətbiqini məhdudlaşdırır. Digər qruplar I-DmoI və I-CreI kimi əlaqəli meqanükleazlar arasında heterodimerləşməni idarə etmək üçün dimer-interfeysinin yenidən dizaynı və peptid əlaqəsindən istifadə etdilər, lakin indiyə qədər bunun I-CreI-nin mövcud kombinator kitabxanalarından iskelelərə yönəlmiş heç bir tətbiqi olmamışdır. . Burada göstəririk ki, məcburi heterodimerlər yaratmaq üçün mühəndislik meqanükleazları qeyri-palindromik ardıcıllığı kəsən funksional endonükleazlarla nəticələnir. Zülal dizayn alqoritmi (FoldX v2.7) iki meqanukleaz monomeri arasında spesifik heterodimer interfeyslərinin layihələndirilməsi üçün istifadə edilmişdir, onların özləri müxtəlif DNT ardıcıllıqlarını tanımaq üçün hazırlanmışdır. Yeni monomerlər funksional heterodimer əmələ gəlməsinə üstünlük verir və homodimer sahəsinin tanınmasının qarşısını alır. Bu dizayn dizayn edilmiş I-CreI meqanükleazları tərəfindən xüsusi olaraq hədəf alına bilən DNT ardıcıllığının potensial repertuarını kütləvi şəkildə artırır və daha təhlükəsiz hədəflənmiş genom mühəndisliyinə yol açır.


Nəticələr

Xüsusi PRLR-PRLR qarşılıqlı təsiri split lusiferaza tamamlama analizi ilə aşkar edilir.

GHR-GHR tamamlama tədqiqatlarımıza paralel olaraq, PRLR-PRLR assosiasiyasını öyrənmək üçün split lusiferaza tamamlama analizindən (45) istifadə etməyə çalışdıq. Biz əvvəlcə reseptor və luc fraqmentləri arasında çevik 10 qalıq bağlayıcı (AAAGSGGGGS) ilə hPRLR-Nluc və PRLR-Cluc kimera zülallarını yaratdıq (Şəkil 1 A). Müqayisə üçün, daha əvvəl təsvir edilmiş GHR-Nluc, GHR-Cluc, EPOR-Cluc və ER fraqmenti-Cluc (44) də Şəkil 1 A-da göstərilmişdir. Əvvəllər olduğu kimi, biz JAK2-ifadə edən insan fibrosarkoma hüceyrə xəttini istifadə etmişik. x003b32A-JAK2 (53,�), kimeraların ifadəsi üçün host kimi. Vəhşi tipli PRLR-ni kodlayan ifadə vektoru PRLR-Nluc və PRLR-Cluc kodlayan vektorların keçici transfeksiyasını müqayisə edən təcrübələr üçün müsbət nəzarət kimi və vektordan isə yalnız mənfi nəzarət kimi istifadə edilmişdir. Anti-PRLR ilə transfeksiya edilmiş hüceyrələrin yuyucu ekstraktlarının immunoblotlanması (Şəkil 1 B) hər iki ximeranın gözlənildiyi kimi müvafiq M-də ifadə edildiyini və aşkar edildiyini aşkar etdi.r. Bundan əlavə, həm GH, həm də PRL əvvəllər GHR üçün göstərildiyi kimi PRLR-luc kimera reseptorlarının müvafiq qatlama və hüceyrə səthi təqdimatını göstərən anti-pSTAT3/anti-STAT3 (Şəkil 1 C) ilə immunoblotting tərəfindən aşkar edildiyi kimi siqnalın kəskin aktivləşməsinə səbəb oldu. -luc və EPOR-luc kimeraları (44).

PRLR-Nluc-un PRLR-Cluc ilə spesifik lusiferaza tamamlanması. A, Bu işdə istifadə edilən lusiferaza fraqmenti kimeralarının sxematik diaqramı. Mətndə və Materiallar və Metodlarda təsvir edilən bütün konstruksiyalar. PRLR-Nluc və PRLR-Cluc: tam uzunluqlu hPRLR ICD-nin sonunda bir bağlayıcı peptid vasitəsilə müvafiq olaraq Nluc və ya Cluc-a birləşdirilir. GHR-Nluc və GHR-Cluc: ICD-nin sonunda bir bağlayıcı peptid vasitəsilə Nluc və ya Cluc-a birləşdirilən tam uzunluqlu insan GHR. EPOR-Cluc: ICD-nin sonunda bağlayıcı peptid vasitəsilə Cluc-a birləşdirilən tam uzunluqlu insan EPOR. ER-Cluc: Cluc ilə birləşdirilən insan ER fraqmenti. B, PRLR-Nluc və PRLR-Cluc spesifik olaraq immun təyin edilə biləndir və gözlənilən SDS-PAGE miqrasiyasını nümayiş etdirir. 𻌪-JAK2 hüceyrələri PRLR, PRLR-Nluc, PRLR-Cluc və ya boş vektor pcDNA3.1(+)/zeo ilə ifadə etmək üçün müvəqqəti olaraq transfeksiya edilmişdir. Yuyucu hüceyrə ekstraktları SDS-PAGE ilə həll edildi və anti-PRLR (H-300) ilə immunoblotlaşdırıldı. PRLR və PRLR-luc kimeraları ulduz işarəsi ilə göstərilir və gözlənilən miqrasiyanı nümayiş etdirir. NS, qeyri-spesifik. C, PRLR-Nluc və PRLR-Cluc normal kəskin liqand-induksiya siqnalına imkan verir. 𻌪-JAK2 hüceyrələri PRLR, PRLR-Nluc, PRLR-Cluc və ya boş vektor pcDNA3.1(+)/zeo ilə ifadə etmək üçün transfeksiya edilmişdir. Müalicə: ±GH və ya PRL. Fosforlanmış və ümumi STAT3 üçün hüceyrə ekstraktlarının immunoblotu. D, PRLR-Nluc-un PRLR-Cluc ilə spesifik lusiferaza tamamlaması. 𻌪-JAK2 hüceyrələri göstərilən kimeraları kodlayan ifadə plazmidləri ilə müvəqqəti transfeksiya edildi. Bioluminescence üç nüsxədə müəyyən edilmişdir (daxil edilmiş faktiki rəng kodlu siqnalları göstərir) və qrafik olaraq ümumi axının orta €x000b1 SE (foton/s × 1000) kimi göstərilir. PRLR-Nluc/PRLR-Cluc vs PRLR-Nluc/EPOR-Cluc və ya PRLR-Nluc/ER-Cluc üçün, P < .05, müvafiq olaraq. Ətraflı məlumat üçün Materiallara və Metodlara baxın.

Reseptorların qarşılıqlı təsirini qiymətləndirmək üçün biz müvəqqəti olaraq PRLR-Nluc ilə PRLR-Cluc ilə 𻌪-JAK2-də birgə ifadə etdik və transfektasiya edilmiş D hüceyrələrinin canlı varlığında IVIS 100 biolüminesans təsvirindən istifadə edərək lusiferaza fəaliyyətinin yenidən qurulmasını ölçdük (Nluc-un Cluc ilə tamamlanması) lusiferin (Şəkil 1 D). Əhəmiyyətli tamamlama PRLR-Nluc/PRLR-Cluc birgə ifadəsi ilə nəticələndi, halbuki PRLR-Nluc/EPOR-Cluc və ya PRLR-Nluc/ER-Cluc birgə ifadəsi ilə çox az siqnal aşkar edildi. Bu nəticə, ligand-müstəqil PRLR dimer əmələ gəlməsini nümayiş etdirən müxtəlif metodlardan istifadə edilən tədqiqatlara uyğun olaraq PRLR-lərin ligand-müstəqil xüsusi preassosiasiyasını göstərir (25, 31).

Liqand müalicəsinin PRLR-PRLR komplementasiyasına təsiri

PRLR-PRLR komplementasiyasına liqand təsirlərini araşdırmaq üçün biz PRLR-Nluc və PRLR-Cluc-un 𻌪-J2 hüceyrə fonunda sabit şəkildə birgə ifadə olunduğu 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələrini təcrid etdik. Şəkil 1-dəki keçici transfeksiyalarda olduğu kimi, PRLR-Nluc və PRLR-Cluc 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələrində anti-PRLR immunoprecipitation və immunoblotting yolu ilə aşkar edilmişdir və hər iki kimera anti-pY tərəfindən aşkar edilmişdir. hüceyrələrin PRL ilə qısa müalicəsindən sonra immunoblotinq (Şəkil 2 A, yuxarı panel). Bu stabil klonda PRLR-Nluc bir qədər çox idi və PRLR-Cluc ilə müqayisədə PRL-yə cavab olaraq müvafiq olaraq daha çox induksiya olunan fosforilləşdi. Gözlənildiyi kimi, PRL həm də JAK2 və STAT5-in kəskin fosforlaşmasına səbəb olub, hüceyrə ekstraktlarının immunoblotlanması ilə aşkar edilib (Şəkil 2 A, aşağı panel).

PRL və GH xüsusi olaraq PRLR-PRLR tamamlamasında müvəqqəti dəyişikliklərə səbəb olur. A, PRLR-Nluc və PRLR-Cluc-un 𻌪-JAK2 fonunda sabit şəkildə ifadə olunduğu 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələrində PRL siqnalı. Müalicə: ±PRL. Üst panel, Yuyucu hüceyrə ekstraktları anti-PRLR (anti-PRLR) ilə immuno-çökülmüşdürcyt-AL84), SDS-PAGE ilə həll edilir və ardıcıl olaraq anti-pY və anti-PRLR (anti-PRLR) ilə immunoblotlanır.cyt-AL84). Aşağı panel, anti-pJAK2, anti-JAK2, anti-pSTAT5 və anti-STAT5 üçün hüceyrə ekstraktlarının immunoblotu. Qara ox başları fosforlanmış və ya ümumi PRLR-Nluc (yuxarı zolaq) və fosforlanmış və ya ümumi PRLR-Cluc (aşağı zolaq) göstərir. B, tamamlamada PRL konsentrasiyasından asılı dəyişikliklər. 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələrində bazal bioluminesans təyin edildikdən sonra, göstərilən konsentrasiyalarda PRL əlavə edildi və bioluminesans 40 dəqiqə ərzində 5 dəqiqəlik fasilələrlə ardıcıl olaraq təyin olundu. Məlumatlar PRL-induksiya etdiyi siqnalın orta €x000b1 SE kimi əsas siqnaldan yuxarı faizlə ifadə edilir (hər şərt üçün n = 3). 100-ng/mL PRL və 250-ng/mL PRL və ya 500-ng/mL PRL üçün, P Hər bir zaman nöqtəsində müvafiq olaraq < .05. 250-ng/mL PRL və 500-ng/mL PRL üçün, P < .05-də 35 və 40 dəqiqə. C, tamamlamada GH konsentrasiyasından asılı dəyişikliklər. 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələrində bazal bioluminesans təyin edildikdən sonra göstərilən konsentrasiyalarda GH əlavə edildi və bioluminesans ardıcıl olaraq təyin olundu. Ətraflı məlumat üçün Materiallara və Metodlara baxın. 100-ng/mL GH və 500-ng/mL GH üçün, P < .05 hər zaman nöqtəsində. 100-ng/mL GH və 250-ng/mL GH üçün, P < .05-də 25 və 30 dəqiqə. D, PRLR-spesifik antaqonist, G129R, 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələrində GH və PRL-induksiya etdiyi JAK2 aktivasiyasını maneə törədir. Əvvəlcədən inkubasiya: ±G129R (20 μg/mL). Müalicə: ±GH və ya PRL. Fosforlanmış və ümumi JAK2 üçün hüceyrə ekstraktlarının immunoblotu. E, G129R tək başına PRLR-PRLR bazal tamamlamasına təsir göstərmir. 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələri vasitə və ya G129R ilə 30 dəqiqə əvvəlcədən inkubasiya edildi, bundan sonra bioluminesans təyin olundu. Məlumatlar qrafik olaraq orta €x000b1 SE ümumi axını (foton/s × 1000) kimi göstərilir. Əhəmiyyətli fərq aşkar edilmədi (hər şərt üçün n = 12). F, PRLR-spesifik antaqonist, G129R, PRLR-PRLR komplementasiyasında PRL-induksiya etdiyi dəyişiklikləri maneə törədir. 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələri ± G129R-də inkubasiya edildi və ardınca PRL (500 ng/ml) müalicəsi aparıldı, bundan sonra bioluminesans ardıcıl olaraq təyin olundu. Ətraflı məlumat üçün Materiallara və Metodlara baxın. PRL vs PRL+G129R üçün, P < .05 hər zaman nöqtəsində. G, PRLR-spesifik antaqonist, G129R, PRLR-PRLR tamamlamasında GH-induksiya etdiyi dəyişiklikləri maneə törədir. 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələri ± G129R-də inkubasiya edildi və ardınca GH (500 ng/ml) müalicəsi aparıldı, bundan sonra bioluminesans ardıcıl olaraq təyin olundu. Ətraflı məlumat üçün Materiallara və Metodlara baxın. GH vs GH+G129R üçün, P < .05 hər zaman nöqtəsində.

HPRLR həm PRL, həm də GH ilə məşğul olduğundan (Cədvəl 1), biz PRL (Şəkil 2 B) və GH (Şəkil 2 C) müxtəlif konsentrasiyaları ilə zaman kursu təcrübələrində PRLR-Nluc/PRLR-Cluc tamamlanmasına liqand təsirlərini sınaqdan keçirdik. Hər bir halda, bazal bioluminescence aşkar edildikdən sonra, liqand 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələrinə əlavə edildi və bioluminescence 40 dəqiqə ərzində 5 dəqiqəlik fasilələrlə ardıcıl olaraq ölçüldü. PRL, 500 ng/mL PRL ilə 15 dəqiqədən sonra orta hesabla təxminən 45% artaraq, dozadan asılı olaraq bazal bioluminesansı sürətlə artırdı. Bundan sonra siqnal 30 dəqiqə ərzində bazaldan təxminən 30%-ə qədər azaldı. (Şəkil 2 B). PRL kimi, GH müalicəsi də asılı olaraq artırılmış PRLR-Nluc/PRLR-Cluc komplementasiyasını 500 ng/mL GH ilə 15 dəqiqədən sonra təxminən 70% dozada (Şəkil 2 C). Bu nümunələr əvvəllər GHR-Nluc/GHR-Cluc (44) ifadə edən hüceyrələrin GH müalicəsi üçün görülənləri xatırladır və eyni zamanda, həm PRL, həm də GH-nin PRLR-Nluc və PRLR-Cluc-un C-terminal quyruqlarının yaxınlaşmasını gücləndirdiyini göstərir. əvvəlcədən hazırlanmış PRLR dimer.

Cədvəl 1.

Reseptor dimerlərinə qarşı liqandların və antaqonistlərin bağlanma yerləri

G129R arginin ilə əvəz edilmiş PRL-nin 129-cu mövqeyində qlisin qalığı olan hPRL mutantıdır və xalis effekti PRL-nin 2-ci yerinin PRLR-yə bağlanma yaxınlığını azaltmaqdır və beləliklə, G129R həm GH, həm də GH üçün spesifik antaqonist kimi davranır (58, 59). PRL (Cədvəl 1). Gözlənildiyi kimi, 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc hüceyrələrinin G129R ilə müalicəsinin özü də siqnal vermədi, lakin G129R həm GH-, həm də PRL-induksiya etdiyi JAK2 fosforilasiyasını tamamilə blokladı (Şəkil 2 D). Bu siqnal məlumatlarına uyğun olaraq, G129R özü PRLR-Nluc/PRLR-Cluc bazal tamamlamasını dəyişmədi (Şəkil 2 E), lakin PRLR-nin həm PRL-induksiya etdiyi (Şəkil 2 F), həm də GH-induksiyasının (Şəkil 2 G) artmasının qarşısını aldı. Nluc/PRLR-Cluc tamamlaması. Bu, PRLR-Nluc/PRLR-Cluc tamamlamasının liqandla induksiya edilmiş artmasının liqand bağlanması zamanı PRLR aktivasiyasının proksimal hadisələrini əks etdirdiyini göstərir.

GHR-PRLR qarşılıqlı əlaqəsi və hetero-tamamlama

Həm GHR, həm də PRLR-ni endogen şəkildə ifadə edən T47D insan döş xərçəngi hüceyrələrində 2 reseptor xüsusi olaraq ligand bağlanmasından asılı olmayaraq koimmunopresipitasiya olunur (42), bu, GHR və PRLR-nin bütöv hüceyrələrdə qarşılıqlı təsir göstərdiyini göstərir, baxmayaraq ki, GHR-PRLR komplekslərinin stexiometriyası və arxitekturası məlum deyil. . PRLR-Nluc (𻌪-JAK2-PRLR-Nluc) sabit şəkildə ifadə edən 𻌪-JAK2 hüceyrələrindən istifadə edərək, split lusiferaza tamamlama analizimizlə bu əlaqəni daha da davam etdirdik (Şəkil 3 A). 𻌪-JAK2-PRLR-Nluc hüceyrələri GHR-Cluc, PRLR-Cluc, EPOR-Cluc və ya ER-Cluc ilə keçici olaraq transfeksiya edilmişdir. Gözlənildiyi kimi, PRLR-Cluc ifadəsi əhəmiyyətli spesifik PRLR-Nluc/PRLR-Cluc tamamlanması ilə nəticələndi. Xüsusilə, oxşar tamamlama PRLR-Nluc/GHR-Cluc birgə ifadəsi ilə müşahidə edilmişdir. Bu, əvvəlki GHR-PRLR koimmunoprecipitation tapıntılarımıza uyğundur.

PRLR-luc-un GHR-luc ilə spesifik lusiferaza hetero-tamamlaması və liqandlar effekti. A, PRLR-Nluc-un GHR-Cluc ilə xüsusi lusiferaza tamamlaması. 𻌪-JAK2-PRLR-Nluc hüceyrələri göstərilən kimeraları kodlayan ifadə plazmidləri ilə müvəqqəti transfeksiya edildi. Bioluminescence üç nüsxədə müəyyən edilmişdir (daxil edilmiş faktiki rəng kodlu siqnalları göstərir) və qrafik olaraq orta 'S ümumi axını (foton/s 'x000d7 1000) kimi göstərilir. GHR-Cluc vs EPOR-Cluc və ya ER-Cluc üçün, P < .05. PRLR-Cluc vs EPOR-Cluc və ya ER-Cluc üçün dəyər belə idi P < .05. Ətraflı məlumat üçün Materiallara və Metodlara baxın. B, GNR-Nluc və PRLR-Cluc ikiqat sabit hüceyrələrin xarakteristikası. Serum aclığı olan 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələri ± GH və ya PRL ilə müalicə edildi. Sol panel, Yuyucu hüceyrə ekstraktları anti-GHR (anti-GHR) ilə immuno-çökülmüşdürcyt-AL47) və ya anti-PRLR (anti-PRLRcyt-AL84), SDS-PAGE tərəfindən həll edilir və ardıcıl olaraq anti-pY və anti-GHR (anti-GHR) ilə immunoblottedcyt-AL47) və ya anti-PRLR (anti-PRLRcyt-AL84). Sağ panel, fosforlanmış və ümumi STAT5 və fosforlanmış və ümumi STAT3 üçün hüceyrə ekstraktlarının immunoblotu. C, hetero-tamamlamada GH konsentrasiyasından asılı dəyişikliklər. 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələrində bazal bioluminesans təyin edildikdən sonra, göstərilən konsentrasiyalarda GH əlavə edildi və bioluminesans ardıcıl olaraq təyin edildi. Ətraflı məlumat üçün Materiallara və Metodlara baxın. 50-ng/mL GH və 100-ng/mL GH üçün, P < .05 hər zaman nöqtəsində 20 ilə 40 dəqiqə arasında. 50-ng/mL GH və 250-ng/mL GH üçün, P 10 və 15 dəqiqə istisna olmaqla, hər zaman nöqtəsində < .05. 50-ng/mL GH və 500-ng/mL GH üçün, P 5 dəqiqə istisna olmaqla, hər zaman nöqtəsində < .05. 50-ng/mL GH və 1000-ng/mL GH üçün, P 5 dəqiqə istisna olmaqla, hər zaman nöqtəsində < .05. 100-ng/mL GH və 250-ng/mL GH üçün, P 10 və 15 dəqiqə istisna olmaqla, hər zaman nöqtəsində < .05. 100-ng/mL GH və 500-ng/mL GH üçün, P 5 dəqiqə istisna olmaqla, hər zaman nöqtəsində < .05. 100-ng/mL GH və 1000-ng/mL GH üçün, P 5 dəqiqə istisna olmaqla, hər zaman nöqtəsində < .05. 250-ng/mL GH və 500-ng/mL GH və ya 1000-ng/mL GH üçün, P < .05 hər zaman nöqtəsində. D, hetero-komplementasiyada PRL konsentrasiyasından asılı dəyişikliklər. 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələrində bazal bioluminesans təyin edildikdən sonra, göstərilən konsentrasiyalarda PRL əlavə edildi və bioluminescence ardıcıl olaraq təyin edildi. Ətraflı məlumat üçün Materiallara və Metodlara baxın. 50-ng/mL PRL və 100–ng/mL PRL üçün, P < .05-də 25, 30 və 40 dəqiqə. 50-ng/mL PRL və 250-ng/mL PRL və ya 500-ng/mL PRL üçün, P 5 dəqiqə istisna olmaqla, hər zaman nöqtəsində < .05. 50-ng/mL PRL və 1000-ng/mL PRL üçün, P < .05 hər zaman nöqtəsində. 100-ng/mL PRL və 250-ng/mL PRL və ya 500-ng/mL PRL və ya 1000-ng/mL PRL üçün, P < .05 hər zaman nöqtəsində. 250-ng/mL PRL və 500-ng/mL PRL üçün, P < .05-də 20 və 25 dəqiqə. 250-ng/mL PRL və 1000-ng/mL PRL üçün, P < .05 10 dəqiqədən 25 dəqiqəyə qədər.

GH həm GHR, həm də PRLR-ni aktivləşdirdiyinə görə, biz hesab edirik ki, GHR-PRLR assosiasiyası bioloji cəhətdən müvafiq nəticələr verə bilər. GHR-PRLR heteromerinin təbiətini və liqand müalicəsinin təsirlərini daha yaxşı başa düşmək üçün biz GHR-Nluc və PRLR-Cluc-u sabit şəkildə ifadə edən və əsaslı bazal komplementasiya lusiferaza nümayiş etdirən 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələrini təcrid etdik. (məlumatlar göstərilmir). Gözlənildiyi kimi, GH həm GHR-Nluc, həm də PRLR-Cluc-un fosforlaşmasını tetikledi və PRL yalnız PRLR-Cluc-un fosforlaşmasını tetikledi (Şəkil 3 B, sol panel). Eyni şəkildə, həm GH, həm də PRL mobil STAT3 və STAT5 siqnalını işə saldı (Şəkil 3 B, sağ panel). Beləliklə, həm GHR-Nluc, həm də PRLR-Cluc hüceyrə səthində geniş şəkildə ifadə edilir və normal olaraq bu hüceyrələrdə ligandların birləşməsinə və siqnalın aktivləşməsinə imkan verir.

Daha sonra GH və ya PRL müalicəsinin GHR-Nluc/PRLR-Cluc komplementasiyasına təsirini araşdırdıq. Xüsusilə, GHR-Nluc/GHR-Cluc və PRLR-Nluc/PRLR-Cluc-da GH ilə tamamlamanın artırılmasından kəskin fərqli olaraq, 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələrinin GH müalicəsi böyük dərəcədə nəticə verdi. 40 dəqiqəlik müalicə müddətində tamamlamada dozadan asılı azalma, ən çox 15 dəqiqədən sonra nəzərə çarpır (Şəkil 3 C). Bu, GHR-PRLR heteromerinin GH-yə cavab olaraq GHR-GHR homodimerindən və ya PRLR-PRLR homodimerindən tamamilə fərqli davrandığını göstərir. Prinsipcə, heteromerin mümkün düzülüşü özlüyündə GHR-PRLR heterodimer şəklindədir. Bu, GH-nin heterodimer partnyorlarına bağlana biləcəyini, onların quyruğunun ayrılmasına və nəticədə azaldılmış komplementasiyaya təsir göstərə biləcəyini nəzərdə tutur. Bununla belə, başqa bir mümkün tənzimləmə heteromerin hetero-oliqomerik kompleksdə GHR-Nluc/GHR-Nluc homodimerləri və PRLR-Cluc/PRLR-Cluc homodimerlərindən ibarət olmasıdır. Bu halda, bazal tamamlama GHR-Nluc-un hər biri yaxınlıqdakı homodimerlərdə olan PRLR-Cluc ilə qarşılıqlı təsirindən və GH-nin hər bir homodimerə bağlanması nəticəsində dimerlər içərisində tamamlayıcı olmayan reseptor quyruqları bir-birinə yaxınlaşır, lakin dimerlər arasında tamamlayıcı quyruqlar hərəkət edir. bir-birindən uzaqlaşır və bununla da tamamlama siqnalını azaldır. Bunu sınamaq üçün PRL-nin GHR-PRLR heterodimerini və ya GHR-GHR homodimerini işə sala bilməyəcəyini əsas gətirərək, PRL müalicəsinin hansı təsirə malik olacağını soruşduq, əksinə, yalnız PRLR-PRLR homodimeri. Maraqlıdır ki, 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələrinin PRL müalicəsi (Şəkil 3 D) GHR-yə cavab olaraq göründüyü kimi tamamlamada dozadan asılı azalma ilə nəticələndi və bu hipotezi dəstəklədi. Hər iki liqand tərəfindən cəlb olunan PRLR yığılması GHR-PRLR heterodimerlərindən daha çox heteromerik GHR-GHR və PRLR-PRLR dimerlərindən biridir. Bu heteromerik birləşmə (GHR-GHR)x/(PRLR-PRLR)y multimer kimi təqdim oluna bilər, burada hər bir reseptorun ifadə səviyyələri x və y-ni və beləliklə də kompleksin stokiometriyasını təyin edə bilər (məsələn, əgər x varsa dimerlərin dimeri). =y = 1, lakin məsələn, x = 1 və y = 2 olarsa, 3 dimerdən ibarət heksamer).

GHR və PRLR antaqonistlərinin GHR-PRLR hetero-komplementasiyasına təsiri

G120R, qalıq 120-də Gly-to-Arg əvəzedicisi olan hGH mutantıdır. Bu əvəzetmə həm GHR, həm də PRLR ilə qarşılıqlı əlaqə üçün sahə 2-yə bağlanma yaxınlığının kəskin şəkildə azalması ilə nəticələnir, lakin sahə 1-ə bağlanma yaxınlığı toxunulmaz qalır, beləliklə G120R hər ikisinə qarşı antaqonist kimi fəaliyyət göstərir. GHR və PRLR ( Cədvəl 1 ) (60). B2036, hGH-nin başqa bir analoqudur, qalıq 120-də Gly-to-Lys dəyişikliyi ilə 2-ci sahənin bağlanma yaxınlığını azaldır, 1-ci bağlama yerində 8-amin turşusu əvəzetmələri ilə birlikdə, 1-ci sahənin GHR-yə bağlanma yaxınlığını xüsusi olaraq artırır, nəticədə GHR- spesifik antaqonist ( Cədvəl 1 ) (61). Yuxarıda göstərildiyi kimi, G129R qalıq 129-da (sahə 2) Gly-to-Arg əvəzedicisi olan PRL mutantıdır və həm GH, həm də PRL-nin PRLR spesifik antaqonisti kimi davranır (Cədvəl 1) (58, 59). Bu antaqonistlərin hər birinin, G120R, B2036 və G129R-nin 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələrində GHR/PRLR hetero-komplementasiyasına təsirini sınaqdan keçirdik. Qeyd edək ki, hər biri GHR (G120R və B2036) və ya PRLR (G120R və G129R) bağlaya bilən yalnız bir sahəyə malik olan antaqonistlərin heç biri bazal GHR-Nluc/PRLR-Cluc tamamlamasını dəyişdirməmişdir (Şəkil 4 A) sahənin bağlanması heteromerlər daxilində distal quyruqların yaxınlığını azaltmaq və ya artırmaq üçün kifayət deyil.

Antaqonistlərin GHR-PRLR hetero-komplementasiyasına təsiri. A, nə GHR-spesifik antaqonist, B2036, PRLR-spesifik antaqonist, G129R, nə də ümumi GHR və PRLR antaqonisti, G120R, bazal GHR-PRLR hetero-komplementasiyasına təsir etmir. 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələri vasitə, B2036, G129R və ya G120R ilə 30 dəqiqə müalicə olundu, bundan sonra bioluminesans təyin olundu. Məlumatlar qrafik olaraq orta €x000b1 SE ümumi axını (foton/s × 1000) kimi göstərilir. Əhəmiyyətli fərq aşkar edilmədi (hər şərt üçün n = 9). B, G129R-nin PRL ilə əlaqəli GHR-PRLR hetero-tamamlama dəyişikliyinə təsiri. Serum aclığı olan 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələri G129R ilə və ya onsuz əvvəlcədən inkubasiya edilmiş və sonra PRL (500 ng/ml) ilə müalicə edilmişdir. Bundan sonra bioluminesans ardıcıl olaraq ölçüldü. Ətraflı məlumat üçün Materiallara və Metodlara baxın. PRL vs PRL+G129R üçün, P < .05 hər zaman nöqtəsində. C, G120R-nin GH-induksiya etdiyi GHR-PRLR hetero-tamamlama dəyişikliyinə təsiri. Serum aclığı olan 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələri G120R ilə və ya onsuz əvvəlcədən inkubasiya edilmiş və sonra GH (500 ng/ml) ilə müalicə edilmişdir. Bundan sonra bioluminesans ardıcıl olaraq ölçüldü. Ətraflı məlumat üçün Materiallara və Metodlara baxın. GH vs GH+G120R üçün, P 5 dəqiqə istisna olmaqla, hər zaman nöqtəsində < .05. D, GH ilə bağlı GHR-PRLR hetero-tamamlama dəyişikliyinə G129R və B2036 təsirlərinin müqayisəsi. Serum aclığı olan 𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələri ± G129R və ya B2036 inkubasiya edilmiş və sonra GH (500 ng/ml) ilə müalicə edilmişdir. Bundan sonra bioluminesans ardıcıl olaraq ölçüldü. Ətraflı məlumat üçün Materiallara və Metodlara baxın. Kəsik xətt və bərk dairələri olan əyri, ehtimal ki, GH-nin GHR-GHR homodimerlərinə bağlanması yolu ilə G129R varlığında GH-nin təsirini əks etdirir. Möhkəm xətt və boş dairələri olan əyri, ehtimal ki, GH-nin PRLR- ilə bağlanması yolu ilə B2036-nın mövcudluğunda GH-nin təsirini əks etdirir. PRLR homodimerləri. Möhkəm xətt və boş üçbucaqlı əyri (GH+B2036) hər zaman nöqtəsindəki dəyəri (GH+G129R) ilə riyazi şəkildə birləşdirərək yaradıldı, beləliklə heç bir xəta zolağı tətbiq olunmadı. Bu kombinasiya izləmə, GH-nin səbəb olduğu dəyişiklikləri əks etdirən eksperimental izləmə ilə demək olar ki, üst-üstə düşürdü (kesik xətt və bərk üçbucaqlar), GH-nin hetero-komplementasiyaya təsirinin onun GHR-GHR homodimerləri və PRLR-PRLR homodimerlərinə müstəqil bağlanmasının xalis təsiri olduğunu göstərir. E, hər bir reseptor vasitəsilə GH ilə bağlı komplementasiya dəyişiklikləri müxtəlif stabil klon hüceyrələrində reseptorların nisbi bolluğu ilə mütənasibdir. Sol panel, 2 GHR-Nluc/PRLR-Cluc stabil klonunun hüceyrə lizatları (𻌪-JAK2-GHR-Nluc/PRLR-Cluc hüceyrələri və 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 hüceyrələri) idi. SDS-PAGE ilə həll edilir və ardıcıl olaraq anti-GHR (anti-GHR) ilə immunoblotlanır.cyt-AL47) və anti-PRLR (anti-PRLRcyt-AL84). 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 hüceyrələri 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-dan daha yüksək GHR/PRLR nisbətinə malik idi. Sağ panel, GH (500 ng/ml) müalicəsindən 40 dəqiqə sonra antaqonistlərin 2 GHR-Nluc/PRLR-Cluc stabil klonlarında hetero-komplementasiyaya təsirini göstərən yığılmış bar qrafikləri. Qara çubuq, GH-nin PRLR-PRLR homodimerləri vasitəsilə təsiri dəyər tamamlama dəyişikliyinin (GH+B2036) GH-dən olana bölünməsi kimi hesablanmışdır. Boz çubuq, GH-nin GHR-GHR homodimerləri vasitəsilə təsiri dəyər tamamlama dəyişikliyinin (GH+G129R) GH-dən olana bölünməsi kimi hesablanmışdır. Qeyd edək ki, 2 fraksiyanın cəmi hər bir klonda təxminən 1-dir. Hər bir çubuq 4 müstəqil təcrübədən əldə edilən məlumatları birləşdirir və orta fraksiya ± SE kimi göstərilir. Qeyd edək ki, 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-dan daha çox GHR/PRLR nisbəti ilə 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2, həmçinin GHR vasitəsilə tamamlama dəyişikliyinin daha böyük nisbətinə malik idi. -GHR homodimerləri (GH+G129R).

Biz həmçinin antaqonistlərin liqandla səbəb olan GHR-Nluc/PRLR-Cluc tamamlama dəyişikliklərinə təsirlərini sınaqdan keçirdik. Bazal hetero-komplementasiyaya təsir etməsə də, G129R GHR-Nluc/PRLR-Cluc komplementasiyasının PRL səbəb olduğu enişini tamamilə inhibə etdi (Şəkil 4 B), PRL ilə bağlı azalmanın PRLR ilə bağlanması nəticəsində olduğu qənaətinə uyğun olaraq (GHR-GHR)x/(PRLR-PRLR)y multimer daxilində -PRLR homodimerləri.

PRL-dən fərqli olaraq, GH həm GHR-GHR, həm də PRLR-PRLR ilə məşğul ola bilər. Buna uyğun olaraq, GH-nin GHR-Nluc/PRLR-Cluc komplementasiyasına təsiri GH-nin hər iki reseptorla bağlanmasını bloklayan G120R tərəfindən tamamilə qarşısı alındı ​​(Şəkil 4 C). Xüsusilə, GHR-yə (B2036 ilə) və PRLR-yə (G129R ilə) GH bağlanmasının selektiv inhibəsi GH-induksiya etdiyi GHR-Nluc/PRLR-Cluc tamamlama dəyişikliklərini müxtəlif yollarla dəyişdi (Şəkil 4 D). Prinsipcə, B2036-nın GH-nin GHR-GHR homodimerlərinə bağlanma antaqonizmi GH-nin PRLR-PRLR homodimerlərinə bağlanmasını pozmamalıdır, beləliklə, (GH+B2036) hetero-komplementasiyasına təsirlər PRLR-PRLR homodimerləri vasitəsilə GH-induksiya etdiyi dəyişikliklərdir (Şəkil 4). D). Eynilə, G129R-nin GH-nin PRLR-PRLR homodimerlərinə bağlanma antaqonizmi GH-nin GHR-GHR homodimerlərinə bağlanmasını pozmamalıdır, beləliklə (GH+G129R) hetero-komplementasiyasına təsirlər GHR-GHR homodimerləri vasitəsilə GH-induksiya etdiyi dəyişikliklərdir (Şəkil 4) . Hetero-komplementasiyada GH ilə bağlı dəyişikliklərin hər bir reseptor homodimerinə müstəqil bağlanmasından xalis dəyişikliklər olduğunu əsaslandırdıq. Bunu həll etmək üçün biz riyazi olaraq GH-nin PRLR-PRLR homodimerlərinə (GH+B2036) bağlanması ilə GHR-GHR (GH+G129R) ilə bağlanması yolu ilə təsirini birləşdirdik və izləmə planını qurduq. x0201d GH-nin hər bir reseptor homodimerinə bağlanmasından əldə edilən xalis effektləri təmsil edir (Şəkil 4 D). Maraqlıdır ki, birləşmiş GH effekti (GHR-GHR)x/(PRLR-PRLR)y multimer modelini güclü şəkildə dəstəkləyən tək GH müalicəsindən yaranan eksperimental izləmə ilə faktiki olaraq üst-üstə düşür (Şəkil 4 D).

Bu ideyanı daha da davam etdirmək üçün biz GHR-Nluc və PRLR-Cluc-u birgə ifadə edən ayrıca transfektant klonu təcrid etdik və sınaqdan keçirdik. In this clone, designated 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 cells, the ratio of GHR-Nluc to PRLR-Cluc is greater than that in JAK2-GHR-Nluc/PRLR-Cluc cells by immunoblotting ( Figure 4 E, left panel). Intriguingly, consistent with its greater GHR-Nluc to PRLR-Cluc ratio, 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 has a greater proportion of GH's effect via GHR-GHR homodimers (GH+G129R) vs its effect via PRLR-PRLR homodimers (GH+B2036) than seen in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc ( Figure 4 E, right panel). Collectively, these data suggest a (GHR-GHR)x/(PRLR-PRLR)y multimer model, in which GHR-GHR and PRLR-PRLR homodimers are activated independently by their corresponding ligands and in proportion relative to the relationship between x and y. In contrast, these data do not support a scenario in which biofunctional GHR-PRLR heterodimers form and are activated per se by GH.

Effects of a novel GHR-PRLR agonist on GHR-PRLR hetero-complementation

B-G is a recombinant protein in which B2036 and G129R are fused in tandem with B2036 situated N-terminal to G129R ( Figure 5 A) this combined GHR-PRLR antagonist, by virtue of possessing single binding sites for each receptor ( Table 1 ), can be an agonist in cells that express both GHR and PRLR, but not in cells expressing only GHR or PRLR (49). Indeed, B-G treatment of our 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells resulted in acute tyrosine phosphorylation of both GHR and PRLR, as well as phosphorylation of STAT3 ( Figure 5 B), suggesting that both receptors are engaged by B-G. As expected, B-G treatment did not alter complementation in cells expressing GHR-Nluc/GHR-Cluc or PRLR-Nluc/PRLR-Cluc (data not shown). In contrast, B-G acutely and dose dependently augmented GHR/PRLR hetero-complementation in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells ( Figure 5 C). We emphasize that this B-G-induced pattern is dramatically different from that observed with either GH ( Figure 3 C) or PRL ( Figure 3 D) in the hetero-complementation setting. The augmentation of GHR-Nluc/PRLR-Cluc complementation from B-G was completely inhibited by either B2036 alone or G129R alone ( Figure 5 D), confirming that B-G engages both GHR and PRLR to affect GHR-PRLR heteromer complementation. In the context of the data presented in Figures 3 and ​ and4, 4 , the data with B-G in Figure 5 may conform with the (GHR-GHR)x/(PRLR-PRLR)y multimer model, in that B-G binds to 1 GHR monomer within a GHR-GHR dimer and to 1 PRLR monomer within a nearby PRLR-PRLR dimer in the hetero-multimer. This B-G binding is envisioned to exert different effects on intracellular tail approximation (bringing GHR-Nluc within one GHR-Nluc-GHR-Nluc dimer into proximity with PRLR-Cluc within a PRLR-Cluc-PRLR-Cluc dimer to augment complementation) compared to GH or PRL (each bringing monomers within homodimers together and separating homodimers within the hetero-multimers).

Effect of a novel GHR-PRLR agonist on GHR-PRLR hetero-complementation. A, Diagram of B-G: a novel GHR-PRLR agonist. B2036 and G129R are fused in tandem with a single binding site (site 1, in red) on B2036 for GHR and a single binding site (site 1, in yellow) on G129R for PRLR, respectively. Yellow “X” indicates the mutated site 2 of GH on B2036 or mutated site 2 of PRL on G129R. B, Agonist B-G induces phosphorylation of GHR and PRLR and triggers cellular signaling in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells. Treatment: ଛ-G. Detergent cell extracts were immuno-precipitated with anti-GHR (anti-GHRcyt-AL47) (upper panel) or anti-PRLR (anti-PRLRcyt-AL84) (middle panel), resolved by SDS-PAGE and sequentially immunoblotted with anti-pY and anti-GHR (anti-GHRcyt-AL47) or anti-PRLR (anti-PRLRcyt-AL84). Lower panel, Immunoblot of cell extracts for phosphorylated and total STAT3. C, B-G induces concentration-dependent augmentation in hetero-complementation. After basal bioluminescence was determined in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells, B-G at indicated concentrations was added, and bioluminescence was serially determined. See Materials and Methods for details. For 0.5-μg/mL B-G vs 1-μg/mL B-G, P < .05 at each time point except 35 minutes. For 0.5-μg/mL B-G vs 5-μg/mL B-G or 10-μg/mL B-G, P < .05 at each time point. For 1-μg/mL B-G vs 5-μg/mL B-G or 10-μg/mL B-G, P < .05 at each time point except 35 and 40 minutes. For 5-μg/mL B-G vs 10-μg/mL B-G, P < .05 at 5 minutes. D, G129R or B2036 each completely antagonizes B-G-induced hetero-complementation changes. Serum-starved 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells were preincubated ± G129R or B2036 and then treated ± B-G (1 μg/mL). Bioluminescence was measured serially thereafter. See Materials and Methods for details. For B-G vs B-G+G129R or B-G+B2036, P < .05 at each time point.


Types of DNA binding domains with examples - Zinc finger, Leucine Zipper, Helix loop Helix

DNA binding proteins interact with DNA by means of various structural motifs, and can stimulate or repress transcription of messenger RNA, depending on the properties and location of the DNA sequence to which they bind.

  • This protein consists of three linked alpha helices (helices 1, 2and 3). Helices 2 and 3 are arranged in a conspicuous helix turn helix motif.
  • A 60 amino acid long region (homeodomain) within helix 3 binds specifically to DNA segments that contain the sequence 5’ATTA3’

II) Zinc finger protein :


Examples of Zinc finger proteins are:
a) Transcription factor IIIA(TFIIIA), which engages RNA polymerase II to the gene promoter
b) Sp1(First described for its action on the SV40 promoter), which engages RNA polymerase II to the gene promoter by binding to the GC box
c) Glucocorticoid receptor, estrogen receptor, progesterone receptor, thyroid hormone receptor (erbA), retinoid acid receptor, and the vitamin D3 receptor.


Molecular controls of lymphatic VEGFR3 signaling

Məqsədlər: Vascular endothelial growth factor receptor 3 (VEGFR3) plays important roles both in lymphangiogenesis and angiogenesis. On stimulation by its ligand VEGF-C, VEGFR3 is able to form both homodimers as well as heterodimers with VEGFR2 and activates several downstream signal pathways, including extracellular signal-regulated kinases (ERK)1/2 and protein kinase B (AKT). Despite certain similarities with VEGFR2, molecular features of VEGFR3 signaling are still largely unknown.

Yanaşma və nəticələr: Human dermal lymphatic endothelial cells were used to examine VEGF-C-driven activation of signaling. Compared with VEGF-A activation of VEGFR2, VEGF-C-induced VEGFR3 activation led to a more extensive AKT activation, whereas activation of ERK1/2 displayed a distinctly different kinetics. Furthermore, VEGF-C, but not VEGF-A, induced formation of VEGFR3/VEGFR2 complexes. Silencing VEGFR2 or its partner neuropilin 1 specifically abolished VEGF-C-induced AKT but not ERK activation, whereas silencing of neuropilin 2 had little effect on either signaling pathway. Finally, suppression of vascular endothelial phosphotyrosine phosphatase but not other phosphotyrosine phosphatases enhanced VEGF-C-induced activation of both ERK and AKT pathways. Functionally, both ERK and AKT pathways are important for lymphatic endothelial cells migration.

Nəticələr: VEGF-C activates AKT signaling via formation of VEGFR3/VEGFR2 complex, whereas ERK is activated by VEGFR3 homodimer. Neuropilin 1 and vascular endothelial phosphotyrosine phosphatase are involved in regulation of VEGFR3 signaling.

Açar sözlər: NRP1 NRP2 VE-PTP VEGF-C VEGFR2 VEGFR3.

© 2014 American Heart Association, Inc.

Maraqların toqquşması bəyanatı

Disclosure: The authors have declared that no conflict of interest exists.

Rəqəmlər

Figure 1. Comparison of VEGFR2 and VEGFR3…

Figure 1. Comparison of VEGFR2 and VEGFR3 signaling

Figure 2. VEGFR2 is involved in VEGF-C-induced…

Figure 2. VEGFR2 is involved in VEGF-C-induced AKT but not ERK activation

Figure 3. NRP1 but not NRP2 is…

Figure 3. NRP1 but not NRP2 is required for VEGF-C signaling

Figure 4. VE-PTP negatively regulates VEGFR3 signaling…

Figure 4. VE-PTP negatively regulates VEGFR3 signaling and endocytosis

Figure 5. VEGFR2 and NRP1 but not…

Figure 5. VEGFR2 and NRP1 but not VE-PTP or NRP2 are required for VEGF-C-induced cell…


MATERİALLAR VƏ METODLAR

Hairpin, double-stranded and monomolecular and bimolecular quadruplex DNA structures

Nucleotide sequences of synthetic DNA oligomers (products of Sigma/Genosys Rehovot, Israel) represented guanine-rich segments of promoter regions of the α7 integrin and sarcomeric mitochondrial creatine kinase (sMtCK) genes ( 35), included the core E-box DNA sequence or encoded the basic regions of MyoD or Myogenin ( Table 1). Following purification of the single-stranded oligonucleotides by denaturing gel electrophoresis in 8.0 M urea, 12% polyacrylamide (acryl/bisacrylamide, 19:1) ( 37), their 5′ ends were labeled by 32 P in bacteriophage T4 polynucleotide kinase (PNK)-catalyzed reaction ( 38). Hairpin, monomolecular and bimolecular tetraplex structures of the integrin and sMtCK DNA oligomers were formed as we described ( 35). E-box or basic region encoding DNA duplexes were prepared by annealing under described conditions ( 39) equimolar amounts of 5′ and 3′ complementary oligomers.

DNA oligomers used in this study

Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG A GGGG CT GG A GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3
Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG A GGGG CT GG A GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3

The integrin and sMtCK oligomers are tetraplex-forming guanine-rich sequences derived from promoter regions of the respective genes ( 35). Underlined are guanine clusters that participate in quadruplex formation. The core E-box sequence is underlined in the 5′ and 3′ E-box complementary oligomers. Sequences representing the Myogenin and MyoD basic regions are italicized in the respective basic region 5′ and 3′ complementary oligomers and the BsmI and SphI complementing ends are underlined.

DNA oligomers used in this study

Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG A GGGG CT GG A GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3
Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG A GGGG CT GG A GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3

The integrin and sMtCK oligomers are tetraplex-forming guanine-rich sequences derived from promoter regions of the respective genes ( 35). Underlined are guanine clusters that participate in quadruplex formation. The core E-box sequence is underlined in the 5′ and 3′ E-box complementary oligomers. Sequences representing the Myogenin and MyoD basic regions are italicized in the respective basic region 5′ and 3′ complementary oligomers and the BsmI and SphI complementing ends are underlined.

Preparation, purification and expression of full-length and mutant recombinant MyoD, MRF4 and Myogenin

Plasmids harboring cDNA that encoded full-length unmodified member proteins of the MRF family were: pGEX-6P-MyoD (Musculus) ( 15) pGEX-MRF4 (Rattus norvegicus) (gift of Dr P. Muñoz-Cánoves, Center for Genomic Regulation, Barcelona, Spain) pEMSV- Myogenin (Rattus norvegicus) (contributed by Dr S.J. Tapscott, FHCRC, Seattle, WA, USA) was subcloned into a pGEX-6P vector. The pGEX4T1-E47 harboring cDNA that encoded full-length Musculus E47 protein was a gift of Dr A. Cano (CSIC-UAM, Madrid, Spain).

To create mutant Myogenin with basic amino acid clusters identical to those of MyoD and MRF4, an R84K mutation was introduced by PCR into the second triad using the 5′ and 3′ primers 5′-d(GTCTGTGGACCGGCGGAAGGCAGCCCACACTGAGGG)-3′ and 5′-d(CCCTCAGTGTGGGCTGCCTTCCGCCGGTCCACAGAC)-3′, respectively, and full-length pGEX-6P-Myogenin cDNA template. Following verification of the mutation by sequencing, an additional K91R mutation was introduced by PCR into the third triad using a pGEX-6P-myogenin R84K cDNA template and the respective 5′ and 3′ primers 5′-d(GCCACACTGAGGGAGAGGCGCAGGCTCAAGAAAG)-3′ and 5′(CTTTCTTGAG CCTGCGCCTCTCCCTCAGTGTGGC)-3′.

To construct chimerical MyoD, which had its native basic region replaced by a Myogenin basic region (MyoD/Myogeninb), SphI and BsmI cleavage sites were generated at positions 99 and 126, respectively, upstream and downstream to the MyoD basic region (residues 102–121). A BsmI restriction site was formed by PCR as we described ( 36) using as template GST-fused full-length MyoD cDNA in pGEX-6P and the 5′ and 3′ primers 5′-d(GCAAAGTGAATGAGGCATTCGAGACGCTCAAGC)-3′ and 5′-d(GCTTGAGCGTCTCGAATGCCTCATTCACTTTGC)-3′, respectively. Presence of the BsmI restriction site was verified by sequencing and the mutated cDNA was used as template to generate by PCR a SphI restriction site using the respective 5′ and 3′ primers 5′-d(CTGCTTGCTGTGGGCATGCAAGGCGTGCAAG)-3′ and 5′-d(CTTGCACGCCTTGCATGCCCACAGCAAGCAG)-3′. The doubly mutated MyoD DNA was cut by SphI, treated with calf intestinal phosphatase (CIP), cleaved by BsmI, resolved by gel agarose electrophoresis and isolated. Myogenin basic region 5′ and 3′ oligomers ( Table 1) that were annealed and phosphorylated at their 5′-termini by PNK were ligated into the restricted MyoD cDNA. The insert had at its ends SphI and BsmI complementary sites and 5′ and 3′ sequences that encoded MyoD residues 99–101 and 122–126, respectively whereas its core encoded the Myogenin basic region (residues 74–93). Reciprocal chimerical Myogenin that contained a MyoD basic region (Myogenin/MyoDb) was prepared as follows: GST-fused full-length Myogenin cDNA in pGEX-6P vector served as a template into which a BsmI restriction site was introduced by PCR using the 5′ and 3′ primers 5′-d(GAAAGTGAATGAGGCATTCGAGGCTCTGAAGAGAAGC)-3′ and 5′-d(GCTTCTCTTCAGAGCCTCGAATGCCTCATTCACTTTC)-3′, respectively. To have the generated BsmI site as a single a BsmI restriction sequence in the Myogenin cDNA, PCR was employed to eliminate a native site at position 486 by using the respective 5′ and 3′ primers 5′-d(CCCAGTGAATGTAACTCCCACAGCGCCTCC)-3′ and 5′-d(GGAGGCGCTGTGGGAGTTACATTCACTGGG)-3′ and the modified Myogenin cDNA template. A SphI restriction site was introduced into the mutated Myogenin cDNA template by PCR using the respective 5′ and 3′ primers 5′-d(CAGTGCCTGCCCTGGGCATGCAAGGTGTGTAAGAG)-3′ and 5′-d(CTCTTACACACCTTGCATGCCCAGGGCA GGCACTG)-3′. Restriction and isolation of linear Myogenin DNA was conducted as described for MyoD DNA. MyoD basic region 5′ and 3′ oligomers ( Table 1) were annealed, phosphorylated and ligated into the restricted Myogenin DNA as detailed above. The insert had at its ends SphI and BsmI complementary sites and 5′ and 3′ sequences that encoded Myogenin residues 71–73 and 94–98, respectively, whereas its core encoded the MyoD basic region (residues 102–121).

Recombinant unmodified or mutant proteins were expressed and purified as follows: pGEX-6P plasmids harboring the respective cDNA sequences were electroporated into competent Escherichia coli BL21 (DE3)pLysS cells that were grown in LB medium containing ampicillin and chloramphenicol to an A600 of ∼0.6. Synthesis of the GST-fused proteins was induced by exposure to 100 μM IPTG for 3 h. Purification of the recombinant proteins from the bacterial cell extracts to >95% homogeneity was attained by glutathione-agarose (Sigma) affinity column chromatography. The GST residue was cleaved from the MyoD or Myogenin fusion proteins by incubating 100 μg protein at 4°C for 4 h with 1.0 unit preScission protease (GE Healthcare, Bucks, UK). The DNA-binding capacity of Myogenin that was used in some experiments as an intact fusion protein was found to be indistinguishable from that of the preScission protease cleaved protein. MRF4 and E47 were used as uncleaved fusion proteins.

Electrophoresis mobility shift separation of protein–DNA complexes and determination of their dissociation constants

Heterodimers of MyoD, MRF4 or Myogenin with E47 were generated prior to their binding to the various DNA probes by incubating at 37°C for 10 min purified recombinant MRF protein with an equimolar amount of E47 in reaction mixtures that contained in a final volume of 10 μl: 45 mM KCl, 4.5 mM MgCl2, 0.5 mM EDTA, 1 mM DTT, 20% glycerol in 20 mM Tris–HCl buffer, pH 8.0. Protein–DNA binding was conducted in reaction mixtures that contained in a final volume of 10 μl: specified amounts of homodimeric MRF proteins or their heterodimers with E47 and 5′- 32 P labeled DNA probe, 10 mM KCl, 1.0 mM EDTA, 0.5 mM DTT, 20% glycerol in 25 mM Tris–HCl buffer, pH 8.0. Mixtures for the binding of end-labeled bimolecular tetraplex DNA structures of muscle-specific regulatory sequences were also supplemented with 10 mM KCl. The mixtures were incubated at 30°C for 20 min and protein–DNA complexes were resolved from free DNA by electrophoresis at 4°C and under 200–250 V in nondenaturing 4 or 6% polyacrylamide gel (acryl/bisacrylamide, 19:1) in 10 mM KCl in 0.25× TBE buffer (0.5 mM EDTA in 22.5 mM Tris–borate buffer, pH 8.3). Electrophoresis of the DNA was conducted until a bromophenol blue marker dye migrated 7.5 cm into the gel. The gels were dried on DE81 filter paper and the relative proportions of bands of free and protein-bound DNA were quantified by phosphor imaging analysis.

Dissociation constants, Kd, values of complexes of homodimeric MRF proteins or their heterodimers with E47 with E-box DNA or with bimolecular tetraplex structures of guanine-rich muscle-specific DNA sequences were determined as follows: increasing amounts of 32 P-labeled DNA were incubated with a constant amount of protein in the above described protein–DNA binding reaction mixtures. Following electrophoretic resolution of the protein–DNA complexes from free DNA by mobility shift, their relative amounts were determined by phosphor imaging quantification of the respective radioactive bands. Kd values were deduced from the negative reciprocal of the slope of a Scatchard plot of the results as described elsewhere ( 40).


Təşəkkürlər

We thank Lukasz Patyk, Froukje van der Wal and Richard Immink for assistance with the yeast two-hybrid and yeast one-hybrid assays, and the latter as well as Selahattin Danisman for useful discussions. Mrs Ruth White (Boyce Thompson Institute, Ithaca, NY) is gratefully acknowledged for sending us tomato EST clones. This work was partially funded by European Commission 6 th Framework programme project “High Quality Solanaceous crops for consumers, processors and producers by exploration of natural biodiversity” (EU-SOL contract nr. PL 016214–2), by the Dutch Ministry of Agriculture, Nature and Food Quality and the Dutch Organization for Scientific Research NWO-ALW project nr. 828.08.005.


Gene organization and evolutionary history

Peptidoglycan recognition proteins (PGRPs) are innate immunity molecules that contain a conserved peptidoglycan-binding type 2 amidase domain that is homologous to bacteriophage and bacterial type 2 amidases [1–6]. PGRPs are ubiquitous in most animals. Insects have multiple PGRP genes that are classified into short (S) and long (L) transcripts and are often alternatively spliced into up to 19 different proteins (Table 1) [1–5]. PGRPs have also been identified in mollusks, echinoderms, and vertebrates (Table 1), but plants and lower metazoa, including nematodes such as Caenorhabditis elegans, do not have PGRPs. PGRP genes usually form clusters that suggest their origin by gene duplication.

Mammals have a family of four PGRPs, which were initially named PGRP-S, PGRP-L, and PGRP-Iα and PGRP-Iβ (for 'short', 'long', or 'intermediate' transcripts, respectively), by analogy to insect PGRPs [3]. Subsequently, the Human Genome Organization Gene Nomenclature Committee changed their symbols to PGLYRP-1, PGLYRP-2, PGLYRP-3, and PGLYRP-4, respectively. This terminology is also used for mouse PGRPs, and is beginning to be adopted for all vertebrate PGRPs. In this article, the abbreviation PGRP will be used for all invertebrate members and PGLYRP for all vertebrate members of the PGRP family.

Phylogenetic analysis of insect PGRPs reveals an early separation of PGRPs into enzyme-active amidases and the remaining PGRPs, which activate signal transduction pathways and proteolytic cascades (Figure 1). PGRPs from other animals cannot easily be grouped with any individual insect PGRPs, so they are considered separately here. The non-insect PGRPs also evolved into two groups. The first group are all amidases, which in echinoderms, mollusks, fish, and amphibians are evolutionarily older and which more recently evolved into the mammalian amidases (PGLYRP-2 Figure 2). The second group are mammalian bactericidal proteins, which separated into two well defined branches: PGLYRP-1 (present in phagocytic granules) and PGLYRP-3 and PGLYRP-4 (present on skin and mucous membranes Figure 2). The only probable orthologs between non-insect and insect PGRPs are the amidase-active PGRPs (Figures 1, 2 and Table 1).

A phylogenetic tree of insect PGRPs, indicating their known and deduced functions. For branches supported by bootstrap analysis with the proportion of 1000 replications higher than 70%, the percentage is indicated. The bar indicates the p-distance. İxtisarlar: Ag, Anopheles gambiae Am, Apis mellifera Bm, Bombyx mori Ce, Calpodes ethlius Dm, Drosophila melanogaster Glm, Glossina morsitans Gm, Galleria mellonella Hd, Holotrichia diomphalia Ms, Manduca sexta Tm, Tenebrio molitor Tn, Trichoplusia ni. Accession numbers and references are listed in Table 1. PPO, prophenol-oxidase.

A phylogenetic tree of mollusk, echinoderm, and vertebrate PGRPs, indicating their known and deduced functions. Bootstrap analysis and p-distance indicated as in Figure 1. Abbreviations: Ai, Argopecten irradians Ar, Asterias rubens Bt, Bos taurus Cd, Camelus dromedaries Cf, Canis familiaris Dr, Danio Es, Euprymna scolopes Gg, Gallus gallus Hs, Homo sapiens Mm, Mus musculus Pt, Pan troglodytes Rn, Rattus norvegicus Sp, Strongylocentrotus purpuratus Ss, Sus scrofa Ten, Tetraodon nigroviridis Xl, Xenopus laevis Xt, Xenopus tropicalis. Accession numbers and references are listed in Table 1. The asterisk indicates that Es PGRP-4 is not a predicted amidase.


Müzakirə

Although no stable marker for the ERGIC is known, the continuous recycling of ERGIC-53 has allowed us to visualize the ERGIC for prolonged times in living cells and to compare the dynamics of sorting of the retrograde marker protein ERGIC-53 and the anterograde markers VSV-G and ssDsRed. Our findings shed new light on the nature of the ERGIC and on protein trafficking early in the secretory pathway. They support the notion of a stationary ERGIC consisting of numerous discontinuous elements that operate in bidirectional sorting to the ER and Golgi. This conclusion is based on three major observations. First, GFP-ERGIC-53 is localized in stationary spots displaying short-range non-directional movement. Unlike VSV-G-GFP spots, GFP-ERGIC-53 spots do not show a preferential movement toward the Golgi region and hence do not exhibit typical features of anterograde carriers (ACs). Their short-range movement is dependent on intact microtubules as it is lost in nocodazole-treated cells. Second, many of the stationary GFP-ERGIC-53 structures are long-lived and persist for more than 30 minutes, another feature that is inconsistent with an exclusive AC function. ER to Golgi transport is a rapid event. The ERGIC spots can undergo splitting and occasionally fuse with one another some appear de novo, others disappear. Interestingly, similar features have been observed for ERES (Stephens, 2003 Bevis and Glick, 2002) suggesting that the dynamics of ERES and ERGIC clusters may be regulated in concert. Third, the ERGIC spots are not consumed by the sorting of GFP-ERGIC-53 and ssDsRed. They can undergo multiple rounds of sorting of anterograde and retrograde cargo.

Our conclusion regarding the nature of the ERGIC is different from previous live-imaging studies on VSV-G-GFP transport (Presley et al., 1997 Scales et al., 1997). These authors concluded that the ERGIC clusters are transport vehicles for protein delivery to the Golgi, rather than a stable compartment (Lippincott-Schwartz et al., 2000). In accord with these studies, we observed that the ACs moving to the Golgi, containing ssDsRed (or VSV-G-GFP), are rather large and cannot be small transport vesicles. However, they derive from the stationary ERGIC defined by ERGIC-53. Only by visualization of the sorting of anterograde and retrograde traffic from the ERGIC in living cells did the stationary nature of this compartment become apparent.

Quantification of the directionality of movement by a numerical processing procedure supports our visual impression that GFP-ERGIC-53 largely escapes packaging into ACs. Unlike VSV-G-GFP, GFP-ERGIC-53 shows no preferential movement to the Golgi upon exit from the ERGIC: it moves in the opposite direction. Considering the apparently random distribution of ERGIC clusters in the peripheral cytoplasm one would expect no preferred directionality for GFP-ERGIC-53 cycling back to the ER. However, low temperature blocks tend to concentrate the ERGIC clusters closer to the Golgi apparatus (Klumperman et al., 1998). Therefore, the measured net flow for ERGIC-53 results from a combined effect: repositioning of ERGIC clusters and recycling of ERGIC-53. At first glance, the measured difference of 13.5% between anterograde and retrograde movements of VSV-G-GFP appears to be small. It should be noted, however, that the quantification time was short (10 seconds) and that extrapolation to a longer time results in a net flow to the Golgi within a few minutes. Thus, directed transport is the consequence of a slight preference in movement towards one direction. Overall, this novel vector field method based on the optical flow estimation validates previous conclusions derived from fixed cells (Klumperman et al., 1998), proposing that ERGIC to ER retrograde transport largely bypasses the Golgi. It is also consistent with our ssDsRed/GFP-ERGIC-53 dual-imaging data showing preferential sorting of anterograde and retrograde traffic in the ERGIC.

ERGIC clusters defined by ERGIC-53 and COP I are localized in close proximity to ERES (Bannykh et al., 1996 Klumperman et al., 1998 Martinez-Menarguez et al., 1999 Stephens et al., 2000), which precludes the visualization of protein transport from ERES to ERGIC in live cells owing to the insufficient resolution of light microscopy. Therefore, a simple alternative interpretation of our data would be that GFP-ERGIC-53, unlike endogenous ERGIC-53, is trapped in ERES and has no access to the ERGIC. Accordingly, the dispersal of GFP-ERGIC-53 induced by H89 could reflect diffusion within the plane of the ER membrane. Several observations argue against this interpretation. Like endogenous ERGIC-53, GFP-ERGIC-53 co-localizes with the COP I subunit β-COP but shows only partial overlap with COPII subunits, Sec13 and Sec31, in fixed cells analyzed by confocal microscopy. Likewise, our biochemical analysis indicates normal folding of GFP-ERGIC-53. Furthermore, NEM blocks the H89-induced dispersal of ERGIC-53 from the stationary structures indicating discontinuity with the ERES. The combined data suggest that the GFP-ERGIC-53 stationary structures correspond to the tubulovesicular ERGIC clusters defined by ERGIC-53 and COP I at the ultrastructural level (Schweizer et al., 1988 Klumperman et al., 1998).

By imaging at high temporal resolution of 5 frames per second (fast imaging) we have uncovered a third pathway not previously described. This pathway is mediated by fast-moving carriers (FCs) a fraction of which contains both GFP-ERGIC-53 and ssDsRed. The pathway is highly sensitive to microtubule-disrupting drugs as well as H89, and requires the existence of stationary ERGIC structures as unveiled by H89 wash-out experiments. As FCs do not exhibit preferential movement to the Golgi area and can occasionally be seen to originate from and fuse with stationary ERGIC structures, we propose that they functionally connect ERGIC clusters by lateral exchange. Although a majority of the FCs remains unsorted and appears to eventually fuse with a stationary structure, some can separate into a GFP-ERGIC-53-containing and an ssDsRed-containing dot, which move in opposite directions. The GFP-ERGIC-53 dot tends to rapidly disappear, whereas the ssDsRed dot moves to the Golgi. This suggests that some FCs are involved in anterograde/retrograde sorting.

Integrating our new data with previously published findings, the following picture regarding the organization and traffic routes in the early secretory pathway emerges (Fig. 7). Newly synthesized secretory proteins and ERGIC-53 are transported from the ER to stationary ERGIC clusters that are lying close to, but separate from ERES (Bannykh et al., 1996 Mezzacasa and Helenius, 2002). Although there is agreement that ER exit is COP II-dependent (Horstmann et al., 2002 Mironov et al., 2003), the precise mechanism of membrane traffic from ERES to ERGIC remains to be elucidated. Once in the ERGIC, anterograde cargo is sorted from ERGIC-53 into rather large ACs by a dissociative process. The size of ACs may vary according to cargo flux and can be considerable under conditions of massive synchronized release of VSV-G from the ER (Horstmann et al., 2002). ACs then rapidly move to the Golgi in a microtubule-dependent way. In contrast, ERGIC-53 is packaged into retrograde carriers (RCs), the size and shape of which can also vary. RCs must also be of a considerable size to be visible. When traffic is inhibited at 15°C followed by rewarming to 37°C, RCs emanating from the ERGIC clusters are often tubular. It appears that conditions of massive cargo transport favor the formation of tubules regardless of the pathway. Like ERGIC to Golgi anterograde transport, efficient ERGIC to ER retrograde transport requires intact microtubules.



Şərhlər:

  1. Godofredo

    Qəlbi bu barədə əfv diləyirəm ... Mən bu sualı başa düşürəm. Hesab edəcəyik.

  2. Putnam

    the very good information

  3. Chris

    Bunu məmnuniyyətlə qəbul edirəm. In my opinion, this is relevant, I will take part in the discussion.



Mesaj yazmaq