Məlumat

Hədəf DNT-nin məhdudlaşdırma sahələri yoxdursa nə olacaq?

Hədəf DNT-nin məhdudlaşdırma sahələri yoxdursa nə olacaq?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Qarşılaşdığım DNT klonlanması ilə bağlı bütün nümunələr, hədəf genin və vektorun hər ikisinin düzgün yerlərdə (yəqin ki, izahat asanlığı üçün) uyğun məhdudlaşdırma sahələrinə malik olduğunu güman etdi. Bunun əvəzinə bir neçə məhdudlaşdırıcı ferment üçün məhdudlaşdırıcı saytları olan bir vektorum olduğunu düşünək, lakin mənim hədəf DNT ardıcıllığımda onların heç biri üçün məhdudlaşdırıcı sahə yoxdur, mən bunlardan rekombinant DNT yaratmağa necə gedərdim?


Əgər daxiletməni sintez edirsinizsə, onda siz onu vektora uyğun olan məhdudiyyət saytları ilə dizayn edə bilərsiniz. Əks təqdirdə, məhdudlaşdırma yerləri olan PCR primerlərini tərtib edə bilərsiniz. Beləliklə, əlavənizi gücləndirdiyiniz zaman məhdudiyyət saytlarını ona əlavə edəcəksiniz. EMBL, Addgene və NEB öz saytlarında bunun bir qədər ətraflı izahatlarını təqdim edirlər.


DNT bağlama yeri

DNT bağlama yerləri digər molekulların bağlana biləcəyi DNT-də tapılan bir bağlayıcı yer növüdür. DNT bağlama yerləri digər bağlanma yerlərindən fərqlidir ki, (1) onlar DNT ardıcıllığının (məsələn, genom) bir hissəsidirlər və (2) DNT-ni bağlayan zülallarla bağlanırlar. DNT bağlayan yerlər tez-tez transkripsiya faktorları kimi tanınan xüsusi zülallarla əlaqələndirilir və beləliklə, transkripsiya tənzimlənməsi ilə əlaqələndirilir. Müəyyən bir transkripsiya faktorunun DNT-ni bağlayan yerlərinin cəminə onun sistromu deyilir. DNT-ni birləşdirən yerlər həmçinin məhdudlaşdırıcı fermentlər, sahəyə məxsus rekombinazlar (sahəyə məxsus rekombinasiyaya baxın) və metiltransferazlar kimi digər zülalların hədəflərini də əhatə edir. [1]

Beləliklə, DNT bağlayan yerlər bir və ya daha çox DNT-ni bağlayan zülallar və ya zülal kompleksləri ilə xüsusi olaraq bağlanmış qısa DNT ardıcıllıqları (adətən 4-30 əsas cüt uzunluğu, lakin rekombinasiya yerləri üçün 200 bp-ə qədər) kimi müəyyən edilə bilər. Bəzi bağlayıcı saytların sürətli təkamül dəyişikliyinə məruz qalma potensialı olduğu bildirildi. [2]


Məhdudiyyət fermenti nədir?

Məhdudiyyət fermentləri müəyyən bir nukleotid ardıcıllığının tanınması əsasında DNT-ni parçalara ayıran fermentlər sinfidir. Məhdudiyyət fermentləri məhdudlaşdırıcı endonükleazlar kimi də tanınır.

Yüzlərlə fərqli məhdudlaşdırıcı ferment olsa da, hamısı eyni şəkildə işləyir. Hər bir fermentin tanınma ardıcıllığı və ya yeri kimi tanınan şey var. Tanınma ardıcıllığı adətən DNT-də spesifik, qısa nukleotid ardıcıllığıdır. Fermentlər tanınan ardıcıllıqla müəyyən nöqtələrdə kəsilir. Məsələn, məhdudlaşdırıcı ferment guanin, adenin, adenin, timin, timin, sitozinin xüsusi ardıcıllığını tanıya bilər. Bu ardıcıllıq mövcud olduqda, ferment ardıcıllıqla şəkər-fosfat onurğasında pilləli kəsiklər edə bilər.

Bəs məhdudlaşdırıcı fermentlər müəyyən ardıcıllıqla kəsilirsə, bakteriyalar kimi hüceyrələr öz DNT-lərini məhdudlaşdırıcı fermentlər tərəfindən parçalanmaqdan necə qoruyurlar? Tipik bir hüceyrədə metil qrupları (CH3) məhdudlaşdırıcı fermentlər tərəfindən tanınmasının qarşısını almaq üçün əsaslara ardıcıllıqla əlavə edilir. Bu proses nukleotid əsaslarının eyni ardıcıllığını məhdudlaşdırıcı fermentlər kimi tanıyan tamamlayıcı fermentlər tərəfindən həyata keçirilir. DNT-nin metilasiyası modifikasiya kimi tanınır. Modifikasiya və məhdudlaşdırma prosesləri ilə hüceyrələr həm hüceyrə üçün təhlükə yaradan xarici DNT-ni kəsə, həm də hüceyrənin mühüm DNT-sini qoruya bilirlər.

DNT-nin iki zəncirli konfiqurasiyasına əsaslanaraq, tanınma ardıcıllığı müxtəlif dayaqlarda simmetrikdir, lakin əks istiqamətlərdə işləyir. Xatırladaq ki, DNT-nin ipin sonundakı karbon növü ilə göstərilən "istiqaməti" var. 5' ucunda bir fosfat qrupu, digər 3' ucunda isə hidroksil qrupu var. Misal üçün:

5' sonu - . guanin, adenin, adenin, timin, timin, sitozin. - 3' sonu

3' sonu - . sitozin, timin, timin, adenin, adenin, guanin. - 5' sonu

Əgər, məsələn, məhdudlaşdırıcı ferment guanin və adenin arasındakı ardıcıllıqla kəsilirsə, bunu hər iki ardıcıllıqla, lakin əks uclarda edər (çünki ikinci ardıcıllıq əks istiqamətdə işləyir). DNT hər iki zəncirdə kəsildiyi üçün bir-birinə hidrogen bağlaya bilən tamamlayıcı uclar olacaqdır. Bu uclara çox vaxt “yapışqan uclar” deyilir.


DNT-nin təcrid edilməsi

Rekombinant DNT-nin yaradılmasında ilk addım donor və vektor DNT-ni təcrid etməkdir. DNT izolyasiyası üçün ümumi protokollar rekombinant DNT texnologiyasının yaranmasından bir çox onilliklər əvvəl mövcud idi. Bu cür üsulların istifadəsi ilə donordan çıxarılan DNT-nin əsas hissəsi eukaryotlarda nüvə genomik DNT və ya prokaryotlarda əsas genomik DNT olacaq bu tiplər ümumiyyətlə analiz üçün tələb olunanlardır. Vektor DNT-ni əldə etmək üçün istifadə olunan prosedur vektorun təbiətindən asılıdır. Bakterial plazmidlər çox istifadə olunan vektorlardır və bu plazmidlər bakterial genomik DNT-dən təmizlənməlidir. Ultrasentrifuqa ilə plazmid DNT-nin çıxarılması üçün protokol Şəkil 12-2-də ümumiləşdirilmişdir. Plazmid DNT, tərkibində etidium bromid olan sezium xlorid sıxlığı qradiyentində ultrasentrifuqadan sonra fərqli bir zolaq meydana gətirir. Plazmid bandı plastik sentrifuqa borusunda bir deşik açmaqla toplanır. Başqa bir protokol, müəyyən bir qələvi pH-da bakterial genomik DNT-nin denatürasiya edildiyini, lakin plazmidlərin bunu etmədiyi müşahidəsinə əsaslanır. Sonrakı zərərsizləşdirmə genomik DNT-ni çökdürür, lakin plazmidlər məhlulda qalır. λ kimi faqlar bakterial sistemlərdə DNT-nin klonlanması üçün vektor kimi də istifadə edilə bilər. Fag DNT-si fag lizatından əldə edilən saf fag süspansiyonundan təcrid olunur.

Şəkil 12-2

Antibiotik tetrasiklinə müqavimət üçün genləri daşıyanlar kimi plazmidlər (yuxarı sol) bakterial xromosom DNT-dən ayrıla bilər. Çünki etidium bromidin iki DNT növü ilə diferensial bağlanması dairəvi plazmid DNT-ni yaradır (daha çox. )


Solaxay Z-DNT

Richard R. Sinden, DNT Structure and Function, 1994

4. Məhdudlaşdırma/Modifikasiya Sistemi ilə bağlı təhlillər

Məhdudiyyətli endonükleazlar və onların müvafiq metilazları adətən 4, 6 və ya 8 bp DNT-ni tanıyır. Endonükleazlar iki DNT zəncirinin hər birinə bir nick daxil edir və metilazlar DNT-ni eyni ardıcıllıqla metilləşdirir. Daha sonra metilləşmə müvafiq endonükleaz tərəfindən sonrakı həzmin qarşısını alır. Endonükleazlar və metilazlar DNT-nin B-formasını tanıyır və ümumiyyətlə, Z-DNT şəklində və ya B-Z qovşağındakı yeri tanımırlar.

Bu yanaşmanın etibarlılığını ilk dəfə Singleton nümayiş etdirmişdir və b. (1983) məhdudlaşdırıcı endonükleazdan istifadə etməklə BamHI. The BamHI tanınma yeri (GGATCC) plazmid DNT-də alternativ GC baza cütlərinin bir sırasına bitişik yerləşdirildi. Bu yer rahat DNT-dəki ferment tərəfindən kəsildi. DNT supercoiled zaman, Z-DNT GC ardıcıllıqla formalaşır və BamHI saytı B-Z qovşağı kimi mövcud idi BamHI kəsimi 80%-dən çox azaldı. The HhaI məhdudlaşdırıcı ferment, Z-DNT (Azorin) kimi mövcud olduqda onun tanınma yerini (GCGC) ayıra bilmir. və b., 1984 Vardimon və Rich, 1984 Zacharias və b., 1984). Bundan əlavə, HhaI methylase, təyin MHhaI, Z-DNT konformasiyasında tanınma yeri mövcud olduqda sitozini metilləşdirə bilmir. Növbəti bölmədə təsvir olunduğu kimi, məhdudlaşdırıcı fermentlər və metilazlar Z-DNT-nin analizində faydalı vasitələr olduqlarını sübut etdilər. in vivo.


Məhdudiyyət fermentləri: Növlər & Nümunələr

Molekulyar biologiyanın, xüsusən də molekulyar genetikanın və analizin ən mühüm addımlarından biri DNT-nin insan genomundan təcrid edilməsi və onun çoxlu surətinin çıxarılmasıdır. İndi bu nüsxələrdən istənilən növün əlavə təhlili üçün istifadə oluna bilər.

Molekulyar genetika metodologiyasının inkişafında əsas hadisə kimi də tanınan məhdudlaşdırıcı fermentlərin kəşfi olmuşdur. Məhdudiyyətli endonukleazlar.

Giriş

A məhdudlaşdırıcı ferment ikiqat zəncirli DNT-ni parçalaya bilən bir növ nukleaza fermentidir. Fermentlər DNT-ni təsadüfi və ya xüsusi ardıcıllıqla parçalaya bilər məhdudiyyət saytları. Tanınma yerləri palindromik mənşəlidir, yəni eyni irəli və geri oxunan ardıcıllıqlardır.

Bu məhdudlaşdırıcı fermentlər təbii olaraq bakteriyalar tərəfindən istehsal olunur. Bakterial növlər ondan viruslara qarşı müdafiə mexanizmi kimi istifadə edirlər. Bununla belə, bakteriyalarda məhdudlaşdırıcı fermentlər adlanan birləşmiş sistemin bir hissəsi kimi mövcuddur məhdudiyyət modifikasiyası sistemi. Bakteriya növləri öz DNT-lərini onu metilləşdirən fermentlərin köməyi ilə dəyişdirirlər. Bakterial DNT-nin bu xüsusi metilasiyası prosesi onu öz məhdudlaşdırıcı endonükleazlarından parçalanmadan qoruyur.

Növlər

İki fərqli məhdudlaşdırıcı ferment var:

  1. Exonucleases: məhdudlaşdırıcı ekzonükleazlar, ilk növbədə, DNT və ya RNT molekulunun ucundan terminal nukleotidlərin hidrolizindən ya 5'-dən 3' istiqamətə, ya da 3'-dən 5'-ə qədər, məsələn, ekzonükleaza I, ekzonükleaza II və s.
  2. Endonukleaz: məhdudlaşdırıcı endonükleazlar DNT və ya RNT molekulu daxilində xüsusi əsas ardıcıllıqları (məhdudiyyət yerləri) tanıyır və exEcoRI, Hind III, BamHI və s. üçün daxili fosfodiester bağının parçalanmasını katalizləyir.

Tarix

Kəşf edilən ilk məhdudlaşdırıcı ferment 1970-ci ildə Hind II idi. 1978-ci ildə Daniel Nathans, Werner Arber və Hamilton O. Smith Fiziologiya və Tibb üzrə Nobel Mükafatına layiq görüldülər.

Məhdudiyyət fermentinin nomenklaturası

Məhdudiyyət fermentlərinin adı üç hissədən ibarətdir:

  1. Cinsin və orqanizmin növünün 3 hərfdən ibarət abbreviaturası, məsələn- Escherichia coli üçün Eco cinsin ilk hərfi E və növün ilk iki hərfi co ilə müəyyən edilir.
  2. Bundan sonra növün gərginliyini ifadə etmək üçün hərf, rəqəm və ya hər ikisinin birləşməsi gəlir.
  3. Fərqli məhdudlaşdırma-modifikasiya sistemlərinin eyni orqanizmdə və ya ştammda tapılma sırasını göstərmək üçün Roma rəqəmi.

Məhdudiyyətli endonukleazların təsnifatı

Müəyyən edilmiş ardıcıllıq növlərinə, DNT-də edilən kəsiklərin təbiətinə və ferment quruluşuna əsasən üç sinif var:

  1. I tip məhdudlaşdırıcı fermentlər,
  2. II tip məhdudlaşdırıcı fermentlər,
  3. III tip məhdudlaşdırıcı fermentlər.

A. Tip I məhdudlaşdırıcı fermentlər

  • Tip I məhdudlaşdırıcı fermentlər həm məhdudlaşdırıcı, həm də modifikasiya fəaliyyətinə malikdir. Bu halda, məhdudiyyət hədəf DNT ardıcıllığının metilasiya vəziyyətindən asılı olacaq.
  • Parçalanma məhdudlaşdırma yerindən təxminən 1000 əsas cüt uzaqda baş verir.
  • Tanınma sahəsinin strukturu asimmetrikdir. 2 hissədən ibarətdir. Tanınma sahəsinin bir hissəsi 3-4 nukleotiddən, digəri isə 4-5 nukleotiddən ibarətdir. İki hissə təxminən 6-8 nukleotiddən ibarət qeyri-spesifik boşluqla ayrılır.
  • I tip məhdudlaşdırıcı fermentlər funksiyaları üçün S-adenosilmetionin (SAM), ATP və Mg 2+ tələb edir.
  • Onlar 3 alt bölmədən, tanınma yerini təyin edən spesifiklik alt bölməsindən, məhdudlaşdırma alt bölməsindən və modifikasiya alt bölməsindən ibarətdir.

B. II tip məhdudlaşdırıcı fermentlər

  • İki ayrı ferment məhdudlaşdırma və modifikasiyaya vasitəçilik edir. Bundan sonra DNT dəyişdirici fermentlər olmadıqda parçalana bilər. İki ferment tərəfindən təyin olunan hədəf ardıcıllığı eyni olsa da, onlar bir-birindən ayrı təmizlənə bilər.
  • Nukleotidlər yalnız məhdudlaşdırma yerində parçalanır. Tanınma ardıcıllığı fırlanan simmetrikdir, palindromik ardıcıllıq adlanır. Xüsusi palindromik sahə ya davamlı ola bilər (məsələn, KpnI 5´-GGTACC-3´ ardıcıllığını müəyyən edir) və ya qeyri-davamlı ola bilər (məsələn, BstEII 5´-GGTNACC-3´ ardıcıllığını tanıyır, burada N hər hansı nukleotid ola bilər)
  • Bunlar ATP deyil, kofaktor kimi Mg 2+ tələb edir.
  • Onlar genetik xəritəçəkmə və DNT-nin in vitro rekonstruksiyasında tələb olunur, çünki onlar yalnız müəyyən yerləri müəyyən edirlər və yalnız həmin yerlərdə parçalanırlar.

Necə işləyirlər:

  • II tip məhdudlaşdırıcı fermentlər əvvəlcə DNT ilə qeyri-spesifik əlaqə qurur və dimmerlər şəklində onlara bağlanır.
  • Hədəf ardıcıllığı daha sonra iki prosesin birləşməsi ilə aşkar edilir. Ya ferment xətti şəkildə yayılır / qısa məsafələrdə DNT ardıcıllığı boyunca sürüşür və ya uzun məsafələrə sıçrayır / sıçrayır.
  • Hədəf ardıcıllığı yerləşdikdən sonra fermentdə, eləcə də DNT-də müxtəlif konformasiya dəyişiklikləri baş verir. Bu konformasiya dəyişiklikləri, öz növbəsində, katalitik mərkəzi aktivləşdirir.
  • Fosfodiester bağı hidroliz edilir və məhsul buraxılır.

BamHI-nin sərbəst, qeyri-spesifik və spesifik DNT-yə bağlı formalarının strukturları

C. Tip III məhdudlaşdırıcı ferment

  • III tip fermentlər eyni DNT ardıcıllığını tanıyır və metilləşdirir. Bununla belə, onlar təxminən 24-26 baza cütünü ayırırlar.
  • Onlar iki fərqli alt bölmədən ibarətdir. DNT-nin tanınması və modifikasiyası birinci subunit- ‘M’ tərəfindən həyata keçirilir və nukleaz aktivliyi digər alt-birlik “R” tərəfindən həyata keçirilir.
  • DNT parçalanmasına ATP, eləcə də Mg 2+ kömək edir, SAM isə parçalanmağı stimullaşdırmaqdan məsuldur.
  • DNT zəncirindən yalnız biri parçalanır. Bununla belə, cüt zəncirli DNT-ni qırmaq üçün əks istiqamətdə iki tanınma yeri lazımdır.

Ulduz Fəaliyyəti

Bəzi məhdudlaşdırıcı fermentlər qeyri-standart reaksiya şəraitində (aşağı ion gücü, yüksək pH) müəyyən edilmiş tanınma ardıcıllığına bənzəyən, lakin onunla eyni olmayan tanınma sahələrini ayırmağa qadirdir.

İzoşizomerlər, neoskizomerlər və izokaudomerlər

  • İzoşizomerlər eyni tanınma yerində tanıyan və parçalanan məhdudlaşdırıcı fermentlərdir. Məsələn, SphI (CGTAC/G) və BbuI (CGTAC/G) bir-birinin izosşizomerləridir.
  • Neoskizomerlər eyni saytı tanıyan və fərqli parçalanma modelinə malik olan məhdudlaşdırıcı fermentlərdir. Məsələn, SmaI (GGG/CCC) və XmaI (G/GGCCC) bir-birinin neoschizomerləridir.
  • İzokaudomerlər bir qədər fərqli ardıcıllığı tanıyan, lakin eyni ucları əmələ gətirən məhdudlaşdırıcı fermentlərdir. Məsələn, həm Sau3a, həm də BamHI 5'-GATC-3' yapışqan son verir, baxmayaraq ki, hər ikisinin tanınma ardıcıllığı fərqlidir.

Bölünmə Nümunələri

HindIII, SmaI, EcoRI və BamHI-nin parçalanma nümunələri aşağıda təsvir edilmişdir. Fermentlərin əksəriyyəti 4-6 əsas cüt uzunluğunda olan ardıcıllığı tanıyır. Bununla belə, onların uzunluğu 8 əsas cütə qədər ola bilər.

DNT-nin məhdudlaşdırıcı ferment tərəfindən parçalanması prosesi ya yapışqan ucların, ya da küt ucların əmələ gəlməsi ilə başa çatır.

Küt uclu fraqmentlər yalnız bağlayıcılar və adapterlərin köməyi ilə DNT fraqmenti ilə birləşdirilə bilər.


Məhdudiyyət fermentləri

Məhdudiyyət fermentləridir DNT kəsici fermentlər bakteriyalarda tapılır (və istifadə üçün onlardan yığılır). Molekulun içərisində kəsildikləri üçün onlara tez-tez deyilir məhdudlaşdırıcı endonükleazlar.

DNT-ni ardıcıllıqla sıralaya bilmək üçün əvvəlcə onu daha kiçik parçalara ayırmaq lazımdır. Bir çox DNT-ni həzm edən fermentlər (mədəaltı vəzi mayenizdəkilər kimi) bunu edə bilər, lakin onların əksəriyyəti ardıcıllıqla işləmək üçün istifadə edilmir, çünki onlar hər molekulu təsadüfi şəkildə kəsirlər. Bu, müxtəlif ölçülü fraqmentlərin heterojen kolleksiyasını yaradır. Lazım olan, kiçik bir homogen fraqmentlər dəsti əldə etmək üçün DNT molekulunu bir neçə dəqiq yerləşmiş yerdə parçalamaq üçün bir yoldur. Bunun üçün alətlər məhdudlaşdırıcı endonükleazlardır. Tanıdığı yer nə qədər nadir olsa, verilmiş məhdudlaşdırıcı endonükleaz tərəfindən istehsal olunan parçaların sayı bir o qədər az olar.


Bir məhdudlaşdırıcı ferment yalnız müəyyən bir nukleotid ardıcıllığında DNT-ni tanıyır və kəsir. Məsələn, bakteriya Hemophilus aegypticus adlı ferment əmələ gətirir HaeIII ki, ardıcıllıqla qarşılaşdığı yerdə DNT-ni kəsir

Kəsmə qonşu G və C arasında aparılır. Bu xüsusi ardıcıllıq virusun dairəvi DNT molekulunun 11 yerində baş verir. &phiX174. Beləliklə, bu DNT-nin fermentlə müalicəsi hər biri dəqiq uzunluğa və nukleotid ardıcıllığına malik 11 fraqment əmələ gətirir. Bu fraqmentləri bir-birindən ayırmaq və hər birinin ardıcıllığı müəyyən edilə bilər.

HaeIII və AluI "küt" ucları istehsal edən ikiqat sarmal boyunca düz kəsdi. Bununla belə, bir çox məhdudlaşdırıcı fermentlər ofset şəkildə kəsilir. Kəsmənin uclarında tək zəncirli DNT-nin həddindən artıq bir hissəsi var. Bunlar deyilir "yapışqan uclar" çünki onlar tamamlayıcı yapışqan ucunu ehtiva edən hər hansı DNT molekulu ilə əsas cütləri meydana gətirə bilirlər. Eyni fermentlə müalicə olunan hər hansı digər DNT mənbəyi belə molekulları əmələ gətirəcək.

Bir-birinə qarışdıqda, bu molekullar yapışqan ucları arasında əsas cütləşməsi ilə bir-biri ilə birləşdirilə bilər. Birlik başqa bir ferment tərəfindən daimi ola bilər, a DNT ligaza, hər bir ipin onurğası boyunca kovalent bağlar əmələ gətirir. Nəticə bir molekuldur rekombinant DNT (rDNT).

Rekombinant DNT molekulları istehsal etmək qabiliyyəti təkcə genetikanın öyrənilməsində inqilab etmədi, həm də biotexnologiya sənayesinin çox hissəsinin əsasını qoydu. İnsanın mövcudluğu insulin (diabet xəstələri üçün), insan amil VIII (hemofiliya A olan kişilər üçün) və insan terapiyasında istifadə edilən digər zülalların hamısı rekombinant DNT ilə mümkün olmuşdur.


Şimal ləkələri

The Şimal ləkəsi DNT kimi gellərdə RNT-nin ölçüdə ayrılmasını nəzərdə tutur. Çünki biz RNT transkriptinin yerli ölçüsünü müəyyən etmək istəyirik (və RNT tək zəncirli olduğundan) heç bir məhdudlaşdırıcı ferment istifadə edilmir. Əksər RNT tək zəncirli olduğundan və molekuldaxili əsas cütləşməsi yolu ilə müxtəlif konformasiyalara qatlana bildiyindən, elektroforezin ayrılması ikiqat zəncirli DNT ilə müqayisədə daha təsadüfi olur və lentlər çox vaxt daha az kəskin olur.


Həzm fermentinin məhdudlaşdırılması

Ənənəvi klonlama üsulları üçün DNT-nin hazırlanması, bir-birinə bağlana bilən uyğun uçlar yaratmaq üçün məhdudlaşdırıcı ferment həzmindən asılıdır. Klonlaşdırılacaq DNT, təmiz bakteriya mədəniyyətindən və ya qarışıq populyasiyadan çıxarılan genomik DNT-dən tutmuş, bir vektordan digərinə (alt klonlaşdırma) köçürülməsi lazım olan əvvəllər klonlaşdırılmış genə qədər geniş şəkildə dəyişə bilər. Məhdudlaşdırıcı fermentlər həmçinin PCR məhsullarında uyğun ucları yaratmaq üçün istifadə edilə bilər. Bütün hallarda, bir və ya bir neçə məhdudlaşdırıcı ferment DNT-ni həzm etmək üçün istifadə olunur ki, bu da uyğun plazmidə istiqamətsiz və ya istiqamətli daxil edilməsi ilə nəticələnir.

Genomik DNT, mənbədən asılı olmayaraq, bir qayda olaraq, 6-8 ardıcıl bazanı tanıyan məhdudlaşdırıcı fermentlərlə həzm olunur, çünki bu tanınma yerləri genomda 4 əsaslı sahələrə nisbətən daha az baş verir və daha böyük DNT fraqmentləri ilə nəticələnir. Klon kitabxanası üçün istədiyiniz daxiletmə ölçüsü hansı fermentlərin seçildiyini, həmçinin həzm şərtlərini müəyyən edir. Çox vaxt seçilmiş məhdudlaşdırıcı ferment(lər)in ardıcıl seyreltilməsi başlanğıc materialı həzm etmək üçün istifadə olunur və istənilən daxiletmə ölçüsü diapazonu elektroforezlə, sonra DNT-nin gel ekstraksiyasından təcrid olunur. Bu hazırlıq üsulu seçilmiş vektor DNT-yə uyğun ucları olan istənilən ölçülü DNT fraqmentlərini təmin edir.

Subklonlaşdırma 1-2 məhdudlaşdırıcı fermentin istifadəsini tələb edir ki, onlar daxiletmə parçasının içərisində kəsilmədən dərhal kənar fraqmenti kəsir. Çoxlu klonlama sahəsi (MCS) daxilində tanınma sahəsinə malik olan məhdudlaşdırıcı fermentlər vektor DNT-nin başqa bir yerində kəsilmədikləri və adətən iki asanlıqla həll olunan DNT fraqmenti istehsal etdikləri üçün istifadə olunur. Maraqlanan gen daha çox zülal ifadəsini yaxşılaşdırmaq və/və ya təmizləyici etiket əlavə etmək üçün ekspressiya vektoruna subklonlaşdırılır. Bu halda, genin düzgün oriyentasiyada və transkripsiya promotoru ilə çərçivəyə daxil edilməsi vacibdir.

Polimeraza Zəncirvari Reaksiya (PZR) adətən klonlanmaq üçün istənilən DNT mənbəyindən maraq doğuran bir gen və ya DNT fraqmentini gücləndirmək üçün istifadə olunur. Uyğun ucları yaratmaq üçün hər iki PCR primerinin 5-ci ucuna məhdudlaşdırıcı yerlər əlavə etmək adi haldır. PCR primerinə məhdudlaşdırıcı yerlər əlavə edərkən, tanınma yeri ilə primerin 5&rsquo ucu arasında 6 əsas daxil etmək tövsiyə olunur. Bu əlavə əsaslar məhdudlaşdırıcı fermentin tanınma yerini bağlaması və effektiv şəkildə kəsilməsi üçün kifayət qədər DNT təmin edir. Primerlərə əlavə etmək üçün məhdudlaşdırıcı sayt(lar)ı seçərkən, seçdiyiniz vektorla hansı saytın/saytların uyğunlaşacağını, istiqamətli klonlamanın arzuolunan olub-olmadığını müəyyən etmək və ən əsası, tanınma sayt(lar)ını təsdiqləmək vacibdir. gen və ya DNT fraqmentində baş vermir.


Həzm fermenti və məhdudlaşdırıcı endonükleaz nədir?

Məhdud həzm də məhdudlaşdırıcı endonükleaz adlanır, DNT-nin ətrafdakı DNT ardıcıllığı ilə diktə edilmiş xüsusi yerlərdə kəsildiyi bir prosesdir. Məhdudiyyətli həzm hədəf DNT molekulunun məhdudlaşdırıcı fermentlərlə - xüsusi DNT ardıcıllığını tanıyan və bağlayan və ya tanınma ardıcıllığı daxilində, ya da tanınma ardıcıllığından kənarda xüsusi nukleotidlərdə parçalanan fermentlərlə inkubasiyası ilə həyata keçirilir. Məhdud həzm küt ucların (əsas cütü ilə bitən DNT molekulunun ucları) və ya yapışqan ucların (nükleotid çıxıntısı ilə bitən DNT molekulunun ucları) istehsalı ilə nəticələnə bilər. Məhdudiyyətli həzm adətən ardıcıl molekulyar klonlama üçün DNT fraqmentini hazırlamaq üçün istifadə olunur, çünki prosedur DNT fraqmentlərini ligasiya yolu ilə tikinti blokları kimi birləşdirməyə imkan verir. Məhdud həzmin nəticələri elektrik sahəsinin tətbiq olunduğu polimer geldə həzm məhsullarının molekul uzunluğuna (DNT molekullarının mənfi yükü əsasında) ayrıldığı gel elektroforezi ilə qiymətləndirilə bilər. Tipik məhdudlaşdırıcı həzm reaksiyasının komponentlərinə DNT şablonu, seçilmiş məhdudlaşdırıcı ferment, bufer və bəzən BSA zülalı daxildir. Reaksiya məhdudlaşdırıcı fermentin optimal fəaliyyəti üçün tələb olunan müəyyən bir temperaturda inkubasiya edilir və istiliklə dayandırılır.


Hədəf DNT-də məhdudiyyət sahələri yoxdursa nə olacaq - Biologiya

Mutasiya prosesi: Mikrosatellitlər faydalı genetik markerlərdir, çünki onlar yüksək polimorfikliyə meyllidirlər. 20 və ya daha çox allel və heterozigotlu insan mikropeyklərinin olması qeyri-adi deyil (Hexp = gen müxtəlifliyi, D) > 0,85. Niyə onlar bu qədər dəyişkəndirlər? Səbəb, görünür, onların mutasiyalarının "klassik" nöqtə mutasiyalarından (burada bir nukleotidin digəri ilə əvəzlənməsi baş verir, məsələn, G-nin C-ni əvəz etməsi) çox fərqli şəkildə baş verir. Mikropeyklərdəki mutasiya prosesi sürüşmə replikasiyası kimi tanınan şey vasitəsilə baş verir. Təkrar vahidləri (məsələn, AC dinukleotid təkrarı) zəncirdəki muncuqlar kimi təsəvvür etsək, təxmin edə bilərik ki, replikasiya zamanı iki tel nisbi mövqeləri bir qədər sürüşə bilər, lakin yenə də fermuarı muncuqlardan aşağı salmağı bacarır. Bir və ya digər zəncir daha sonra nukleotidlərin əlavə edilməsi və ya kəsilməsi ilə uzadıla və ya qısaldıldı. Nəticə, orijinaldan bir muncuq daha uzun və ya qısa olan təkrar vahiddən ibarət yeni bir "mutasiya" olacaq. Bir təkrar əlavə etmək və ya çıxmaq iki və ya daha çox muncuq əlavə etməkdən və ya çıxmaqdan daha asan olması fikri istifadə etmək üçün əsasdır. Addım-addım mutasiya modeli (SMM) ilə müqayisədə Sonsuz allel modeli (MƏN). SMM-nin üstünlüyü (ən azı nəzəri cəhətdən) ondan ibarətdir ki, ölçü fərqi sonra allellərin filogeniyası haqqında əlavə məlumat verir. IAM altında yalnız iki dövlət "eyni" və "fərqli"dir. SMM altında müxtəlif oxşarlıqların (eyni ölçüdə, ölçüdə oxşar, ölçüdə çox fərqli) potensial davamlılığı var. Bununla belə, SMM tutmursa, onda biz ondan istifadə etməkdən daha pis ola bilərik -- bu, əslində çox yanıltıcı ola bilər. Əsas mutasiya prosesi böyük ölçüdə mərhələli olsa belə, sürüşmənin allel ölçülərinin paylanmasına SMM-i demək olar ki, tamamilə etibarsız edəcək şəkildə necə təsir edə biləcəyini görmək çətin deyil (Mühazirə 6-da Şəkil 6.1 və 6.2-ni araşdıraraq bunu vizuallaşdırın).

    Lokus spesifik (mini peyklər və ya RAPD kimi çox yerli markerlərdən fərqli olaraq)
    Kodominant (heterozigotları homozigotlardan ayırmaq olar, RAPD və AFLP-lərdən fərqli olaraq "binar, 0/1")
    PCR əsaslı (yüksək dərəcədə deqradasiyaya uğramış və ya "qədim" DNT üzərində işləmək üçün bizə çox az miqdarda toxuma lazımdır.)
    Yüksək polimorf ("hiperdəyişən") -- əhəmiyyətli nümunə təmin edir
    Faydalı a tərəzi diapazonu fərdi ID-dən incə miqyaslı filogeniyalara qədər

1) Çıxarış Dokudan DNT (toxuma növündən asılı olaraq mümkün üsulların geniş çeşidi)

2) Fraqment genom. Bizim genomik DNT-ni uyğun ölçüdə parçalara kəsin məhdudlaşdırıcı fermentlər. Ümumiyyətlə, 300-600 bp aralığında orta fraqment ölçüləri yaradan məhdudlaşdırıcı fermentlər arzu olunan məqsəddir.

3) Daxil et. Parçaları içəri daxil edin plazmidlər. Bu addım fraqmentlərin klonlaşdırılmasına imkan verir -- plazmidlərə daxil etdiyimiz 300-600 bp parçaların bir çox nüsxəsini istehsal edir. Plazmidlərin necə hərəkət etdiyi haqqında bir az daha ətraflı fikir əldə etmək üçün vektorların klonlanması, terminlər lüğəti səhifəsində qalın şriftlə yazılmış terminlərə baxın. PUC19 bu cür analiz üçün çox istifadə olunan plazmiddir. Niyə PUC19? The məhdudiyyət saytları in PUC19 məlumdur (bağlanmış DNT fraqmentləri sonradan kəsilə bilsin) və o yaxşı təkrarlayır bakterial mədəniyyətdə.

4) Boşqab neylon membran üzərində plazmidlər.

5) Prob arzu olunan təkrarların etiketli oliqonukleotidləri olan membran (məsələn, AC10).

6) Mədəniyyət müsbət klonlar (oliqo zondları ilə bağlanmış plazmid fraqmentləri).

7) kəsmək məhdudlaşdırıcı fermentləri olan plazmidləri daxil edin və onları agaroz geldə bitirin.

    a) üçün yoxlayın təkrarın olması və
    b) bizə imkan verir ölçüsünü təxmin edin daxildən.
    a) iki primerin "uyğunluğu" (onlar bir-birini tamamlaya bilməz, çünki bu, çarpaz bağlanmaya səbəb ola bilər, onların uzunluqları və ərimə temperaturları çox oxşar olmalıdır),
    b) PCR uğursuzluqlarına səbəb ola biləcək dayanma kodlarından və ya digər ardıcıllıqlardan qaçınmaq,
    c) yaxşı bağlanmayan primer başlanğıc yerlərindən qaçınmaq, palindromlardan (hər iki ucundan eyni ardıcıllığa malik olan ardıcıllıqlar) və bir sıra digərlərindən qaçınmaq.
    d) ümumi gücləndirilmiş məhsul uzunluğu 100-250 bp-dir ki, onlar vizuallaşdırma üçün istifadə edəcəyimiz sekvensləşdirmə gelləri və ya avtomatlaşdırılmış genotiplər üçün mümkün olsun.
    e) ardıcıl regionun sonuna yaxın təkrarlardan qaçınmaq. Ardıcıllaşdırdığımız müsbət klonlardan bəziləri yaxşı təkrar vahidlərinə malik ola bilər, lakin ardıcıllığın sonuna çox yaxın ola bilər. Daha sonra bir primer dizayn etmək üçün kifayət qədər cinah bölgəmiz yoxdur. Qismən buna görə də biz 300-600 bp-lik fraqmentləri istəyirik -- ardıcıllıq üçün mümkün olmaq üçün kifayət qədər qısa, lakin təkrarın "uçurumda asma" olma ehtimalını azaltmaq üçün kifayət qədər uzun.

11) Sifariş verin lokalizasiyaya xas primerlər (ümumiyyətlə bunlar təkrar bölməyə dərhal bitişik olmayan cinah bölgələrinin 20-30 bp hissələri olacaq).

Budur, təkrar vahidi və irəli və tərs primer yerlərini ehtiva edən skrab-jaylar üçün mikrosatellit ardıcıllığına bir nümunə.
SJR3 [FSJ]
GCCAAGCTTGCATGCCTGCAGGTCGACTCT AGAGGATCCCCAAGGTGTATGT GCATACACGTG
CACACACACACACACACACA GAGGGTGTGCACATGTGCATGCACACTCCAAGAGACAGTG
CCTAGTAAAGTGTCTC AGCACCATCTGCAGCAAACAG GTTCTGCAAAAAACCAATCCCAACTGA
TGTTCCCACAGTGACACTGT

İrəli astarın əvvəlindən tərs astarın sonuna qədər yuxarıda göstərilən 131 bp Təkrar CA-dır11
The təkrar vahidi qırmızı rənglə vurğulanır , isə irəlitərs p r i m e r s -də vurğulanır maviyaşıl . Biz primer ardıcıllığı üçün sifariş göndərərdik (bizim vəziyyətimizdə əlavə olaraq 19 bp əlavə edirik MPZR-də gücləndirilmiş məhsulumuza floresan nukleotidləri/dNTP-ləri əlavə etməyə imkan verən 13 quyruq). Sequencer/avtomatlaşdırılmış genotipimizdəki lazer daha sonra flüoresansı aşkar edir, bu da biz vizuallaşdırmaq toplamaq və təhlil etmək ümid etdiyimiz allelik məlumatları təşkil edən lentlər.

1) DNT-ni çıxarın. Biri tez-tez toxumanın bir şəkildə parçalanması ilə başlayır (məsələn, maye azotda üyüdülməklə). Ekstraksiya prosesi üçün alternativlərə klassik fenol-xloroform ekstraksiyaları, duz əsaslı ekstraksiyalar və müxtəlif kommersiya dəstləri daxildir. Bu addımda zülallardan və digər qeyri-DNT toxuma komponentlərindən xilas oluruq. Tipik analizə 30 nəfərdən ibarət yerli populyasiyada olan fərdlərin hər birindən DNT çıxarılması daxil ola bilər.

2) Gücləndirin. Çıxarılan 30 DNT nümunəmizin hər birindən çox az miqdarda bir termosikldə gücləndirmək üçün PCR kokteylinə əlavə edirik. Bu, molekulyar biologiyada inqilab edən "sehrli" bir addımdır. Demək olar ki, heç bir DNT ilə başlayaq və onu bir geldə görə biləcəyimiz kifayət qədər əldə edirik! Müxtəlif "kokteyl" reseptləri mövcuddur - onlar adətən termofilik bakterial fermenti ehtiva edirlər Taq polimeraza (əsas), dNTP qarışığı (hədəf DNT-nin kütləvi surətdə təkrarlanmasına imkan verəcək nukleotidlər), maqnezium xlorid və flüoresan etiketli dNTP-lər (bunlar xüsusi olaraq əlavə edilmiş M13 və ya T3 quyruğuna bağlanacaq və lazerin altında işıqlanacaq və lentlər yaradacaq. DNT allelləri geldə görünür).

3) yük. Biz 30 gücləndirilmiş məhsulumuzu böyük şaquli poliakrilamid geldə ayrı-ayrı zolaqlara yükləyirik. Biz də bir neçə zolağı DNT ilə yükləyirik nərdivan -- məlum kəmiyyət/konsentrasiyada gücləndirilmiş DNT-nin məlum ölçülü fraqmentləri. Ümumi bir nərdivan, bir sıra fraqmentlər əldə etmək üçün məhdudlaşdırıcı fermentlərlə kəsilmiş lambda fagıdır. Daha yeni kapilyar sequencerlər geldən istifadə etmir.

4) Sıralayıcını işə salın. Gücləndirilmiş məhsulu bütün allellər flüoresan nukleotidləri işıqlandıran və gel üzərində işıqlandıran (və ya rəqəmsal-birbaşa kompüterə keçir) lazerlə işləməyə vaxt tapana qədər gücləndirilmiş məhsulu sequencerdən keçiririk. Sekvenser həm analoq təsviri (köhnə, gel əsaslı sekvenserlər üçün), həm də fraqmentlərin ölçüsü ilə bağlı rəqəmsal olaraq saxlanılan məlumatları yaradır.

5) Optimallaşdırın (2-4-cü addımlardakı dəyişikliklər). Primer, DNT, termosikl və sekvenserin müəyyən bir kombinasiyası üçün düzgün PCR şərtlərini əldə etmək çox vaxt çox vaxt tələb edir. Optimallaşdırmada əsas dəyişənlərə aşağıdakılar daxildir:
temperatur (primer ardıcıllığının proqnozlaşdırılan ərimə temperaturu olacaq, lakin əslində işləyən daha yüksək və ya aşağı ola bilər),
denaturasiya, tavlama və addımların uzadılması üçün PCR tərəfindən proqramlaşdırılmış vaxtlar
maqnezium xlorid konsentrasiyası

Vizuallaşdırmanın alternativ üsullarına gümüşlə boyanma, CyberGreen boyama, etidium bromid boyama və ya radioaktiv etiketləmə ilə "əllə qurulmuş" poliakrilamid sekvensiya gelləri daxildir. Bunların bir çoxu zərərli kimyəvi maddələrdən ibarətdir (EtBr) və ya radioaktivlik, buna görə də biz nisbətən təmiz, təhlükəsiz prosedurdan istifadə etdiyimiz üçün özümüzü xoşbəxt hiss edirik.

Şəkil 8.1. Mikropeyklər üçün elektroforetik gelin stilizə edilmiş diaqramı. Bir cərəyan gücləndirilmiş DNT-ni aşağı çəkir
poliakrilamid geldə "zolaqlar". Daha sonra fraqmentlər ölçüyə (bp = əsas cütlər) və fərdlərə görə ayrıla bilər
allel tərkibinə görə genotipləşdirilə bilər (bir və ya bir neçə allel üçün homozigot və ya heterozigot). Budur
sol zolaqda məlum ölçülü fraqmentlərdən ibarət "nərdivan" var, ikinci zolaqda bir fərdin DNT-si var.
(genotip e.ə) və üçüncü zolaqda ikinci bir fərddən (genotip reklam). Çoxlu lokusun işlədilməsi
fərdlər, populyasiyalar və ya növlər haqqında zəngin genetik məlumat verir.

E. Biz allelik məlumatları necə təhlil edirik? Bir az daha ətraflı təsvir üçün Genetik analiz səhifəsinə keçin.
Siz həmçinin Web Genetic proqramında Word sənədimi yükləyə bilərsiniz. Luikart və İngiltərə (1999) yanaşmaların (köhnə) icmalını təqdim edir. Alternativ markerlərdən istifadə üçün Sunnucks (2000), Mueller and Wolfenbarger (1999 AFLP), Campbell et al. (2003 AFLP) və Brumfield et al. (2003 SNPs - tək nukleotid polimorfizmləri).

    1) Ənənəvi populyasiya genetikası vasitələri
      Heterozigotluq (Hobs, Hexp = D)
      Hardy-Weinberg tarazlığı
      Bağlantı tarazlığının pozulması
      FST və digər F-statistika
      Genetik məsafələr (Kavalli-Sforza akkordu, Neisin 1972 və 1978 məsafələri)
      Təxminlər 4Ne m və 4Nem. (mutasiya üçün m, m miqrasiya üçün)

    2) Mikrosatellitə xüsusi tədbirlər (əsasən SMM, Addım-addım Mutasiya Modellərinə əsaslanır)

    (delta mu kvadrat) Goldstein et al. 1995
    DSW Shriver və s. (1995)
    RST Slatkin (1995) tərəfindən həyata keçirildiyi kimi Qudman (1997)
    Michalakis və Excoffier (1996)


    Videoya baxın: Qəbul imtahanı üzrə güzəştlərimiz (Iyul 2022).


Şərhlər:

  1. Ewyn

    Demək istəyirəm ki, səhv edirsən. Mən bunu sübut edə bilərəm. Mənə pm-də yazın, həll edəcəyik.

  2. Udo

    Bu variant mənə yaxınlaşmır.

  3. Taregan

    Əlbəttə. Yuxarıdakıların hamısı həqiqəti söylədi. Bu mövzuda ünsiyyət qura bilərik. Burada və ya PM-də.

  4. Tozuru

    Düşünürəm ki, haqlı deyilsən. Əminəm. Mən mövqeyi müdafiə edə bilərəm. PM-də mənə yazın, müzakirə edəcəyik.

  5. Lar

    Dictate, where can I read about this?

  6. Armon

    Ancaq çox.

  7. Galeel

    Bağışlayın, bu müdaxilə etdi... Mən bu yaxınlarda buradayam.Ancaq bu mövzu mənə çox yaxındır. Kömək etməyə hazırdır.



Mesaj yazmaq