Məlumat

Sahildə tapılan bu sümüyü müəyyənləşdirin

Sahildə tapılan bu sümüyü müəyyənləşdirin



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Türkiyənin Çanaqqala sahilində tapdım. Eni 7,5 sm, hündürlüyü 5 sm. Daxili deşik ölçüləri 2,5 sm x 3 sm-dir.


Bu, böyük ot yeyən heyvandan, keçidən, gənc atdan, maraldan atlas fəqərəsidir. C1 vertebra kimi də bilin ki, bu, ehtimal ki, mechoui partiyasından bir qoyundur.


Tədqiqat: Siçovulların parçalanması

  • Shannan Muskopf tərəfindən töhfə
  • Granite City School District-də Lisey Biologiya Müəllimi
  • Biologiya guşəsindən qaynaqlanır

Giriş

Bu laboratoriya məşqində siçovulun anatomiyası bir qədər təfərrüatlı şəkildə araşdırılacaq. Yadınızdadırsa, birinci kurs biologiya kursunuzda bir ot qurbağası və döl donuzunu parçaladınız. Bu parçalanma zamanı öyrəndiyiniz strukturları tanıya və xatırlaya bilərsiniz. Biologiya 3A-da məməlilərin anatomiyasına daha ətraflı nəzər salınacaq. Bu parçalanma zamanı qorunmuş siçovulunuzu tanıyacaq və sevəcəksiniz.

Siçovulların təsnifatı (Rattus norvegicus)

Kingdom Animalia
Phylum Chordata
Subphylum Vertebrata
Məməlilər sinfi
Rodentia sifariş edin
Muridae ailəsi
Cins Rattus
Növlər norvegicus

Siçovulun bədən boşluğunu açmaq və strukturları müşahidə etmək üçün kəsici alətlərdən istifadə olunacaq. Nəzərə alın ki, parçalamaq "kəsmək" əslində, "görünüşə məruz qoymaq" demək deyil. Bütün strukturları və onların digər strukturlarla əlaqələrini müşahidə etmək üçün diqqətli disseksiya üsulları tələb olunacaq. Neştərdən istifadə etmək lazım olmayacaq. Məşhur inancın əksinə olaraq, skalpel parçalanma üçün ən yaxşı vasitə deyil. Qayçı daha yaxşı xidmət edir, çünki altındakı orqanlara zərər verməmək üçün qayçının ucu yuxarıya doğru yönəldilə bilər. Kəsmədən əvvəl həmişə forseps ilə kəsiləcək strukturları qaldırın ki, altında nə olduğunu və kəsik yerinin harada edilməsini dəqiq görə biləsiniz. Heç vaxt bir hissəni ifşa etmək üçün lazım olandan çox kəsməyin.

Bu laboratoriyada qiymətiniz yoxlanış məntəqələri ilə birlikdə sinifdə iştiraka görə (gündəlik müşahidə edilən) qiymətləndiriləcək.

Dorsal: arxaya doğru / Ventral: qarına doğru
Yanal: yanlara doğru /Media: ortaya yaxın
Anterior: başa doğru / Posterior: arxa uca doğru (quyruq)
Səthi: səthdə və ya yaxınlığında
Dərin: səthdən bir qədər aşağıda məsafə
Sagittal: orta təyyarə ilə əlaqəli, sol və sağ tərəfləri ikiyə bölür
Transvers: anterior və posterioru ayıran müstəviyə aiddir
Horizontal: dorsal və ventral ayıran təyyarə ilə əlaqəli
Proksimal: istinad nöqtəsinə yaxın / Distal: nöqtədən uzaq
Quyruq: quyruq ucuna doğru
Pektoral: sinə və çiyin bölgəsinə aiddir
Çanaq: omba bölgəsinə aiddir
Dermal - dəri ilə əlaqəli
Uzunlamasına - uzununa
Sağ və Sol - nümunənin sağına və soluna aiddir, sizin yox
Qarın boşluğu - qabırğanın altındakı (arxa) sahə ilə əlaqədardır
Torakal boşluq - qabırğanın yuxarısındakı (ön) sahəyə aiddir

Əlinizdə olan laboratoriya kitabları və diaqramlar əlavədir. Bu laboratoriyada təlimatlara əməl etməyiniz gözlənilir. Bütün strukturları tapa bildiyiniz üçün məsuliyyət daşıyacaqsınız. Sizdən kömək istəməzdən əvvəl strukturları tapmaq üçün bütün imkanlarınızı tükətdiyiniz gözlənilir. Mövcud materiallardan, təlimatlardan və diaqramlardan istifadə edərək, əksər tələbələr özləri üçün bir çox strukturların yerini tapa biləcəklər. Əgər ciddi səylərdən sonra struktur tapa bilmirsinizsə, kömək istəyin. Unutmayın ki, bu öyrənmə təcrübəsidir və digər tələbələrin nümunələrini müzakirə etmək və müşahidə etmək olduqca icazəlidir. Disseksiyanızı başqaları ilə müqayisə edin, çünki heyvanlar tez-tez fərqlənirlər, əks cinsdən olan heyvanlara baxdığınızdan əmin olun, laboratoriyada hər iki cins üçün məsuliyyət daşıyacaqsınız.

Alacağınız nümunə konservləşdirilmiş ikiqat inyeksiya edilmiş nümunədir. İkiqat inyeksiya damarların qırmızı latekslə, damarların isə mavi latekslə doldurulmasını nəzərdə tutur. Lateksin vurulduğu siçovulun xarici səthində müxtəlif kəsiklər görəcəksiniz.

Siçovul onurğalı heyvandır, bu o deməkdir ki, onun struktur quruluşunun bir çox aspektləri bütün digər onurğalılar, o cümlədən insanlar üçün ortaqdır. Qohum orqanizmlər arasında strukturların oxşarlığı ortaq əcdadın sübutunu göstərir. Bir növ, siçovulları öyrənmək insanı öyrənmək kimidir. Bu laboratoriyanın aparıcı mövzusu olaraq özünüzdən soruşun: siçovulda müşahidə olunan hər bir quruluş üçün öz bədəninizdə ekvivalent bir quruluş var - quruluş nədir və harada yerləşir.

İkinci aparıcı mövzu olaraq orqanlar və orqan qrupları arasındakı əlaqələrə diqqət yetirin. Struktur hissələri təsadüfi yerlərdə "yalnız orada" deyil. Bədəndə onların xüsusi yerləşməsi müəyyən funksiyaların həyata keçirilməsinə kömək edir. Beləliklə, görünən hər bir quruluş üçün aşağıdakıları təyin etməlisiniz:

  • Hansı orqan sisteminə aiddir
  • Digər komponentlərlə necə əlaqəlidir
  • Onun ümumi funksiyası
  • Onun xüsusi funksiyası (əgər varsa

Siçovulların Xarici Anatomiyası

Prosedur

Siçovulunuzu aldı. Onu su ilə yuyun və ümumi xüsusiyyətlərini müşahidə etmək üçün parçalayıcı qabınıza qoyun. Vurğulanmış sözlərin hər birini bildiyinizə əmin olun.

Siçovulun bədəni altı anatomik bölgəyə bölünür:

  • kəllə bölgəsi &ndash rəhbəri
  • servikal bölgə &ndash boyun
  • pektoral bölgə - ön ayaqların bağlandığı sahə
  • torakal bölgə - sinə bölgəsi
  • qarın - qarın
  • çanaq bölgəsi - arxa ayaqların bağlandığı sahə
  1. Siçovulu örtən tüklü paltoya və siçovulun üzündə yerləşən həssas tüklərə (bığlara) diqqət yetirin. vibrissae.
  2. Ağızın yuxarı dodaqda böyük ön hissəsini ifşa edən böyük bir yarıq var kəsici dişlər. Siçovullar məməliləri dişləyir və bu kəsici dişlər siçovul yaşadığı müddətcə böyüməyə davam edəcək.
  3. Böyük olan gözlərə diqqət yetirin şagirdnictitating membran gözün daxili küncündə tapılır. Bu membran qorunmaq üçün gözün üstündən çəkilə bilər. Göz qapaqları insanlarda olanlara bənzəyir.
  4. Qulaqlar adlanan xarici hissədən ibarətdir pinna.
  5. tapın döşlər siçovulun ventral səthində. Yalnız dişilərin döşləri var.
  6. Yoxlayın quyruq, siçovulların quyruqlarında tük yoxdur. Baxmayaraq ki, bəzi gəmiricilər, məsələn, gerbillər, quyruqlarında tük var.
  7. Nağılın əsasına ventral olan anusu tapın.
  8. Qadında tapın vaginal açılış. Bu, anus arasında, quyruğun dibində və açılış arasında görünəcək uretra, hansı daha çox ventraldır.
  9. Kişilərdə böyük bir cüt tapacaqsınız skrotal kisələr olan testislər. Xaya kisəciklərinin yalnız ön tərəfində penisini əhatə edən dərinin qabarıqlığı olan ön qabıq var.

Siçovulların Əzələ və Skelet Sistemi

Prosedur: Siçovulun dərisinin soyulması

Aşağıdakı əzələləri üzə çıxarmaq üçün siçovulun dərisini diqqətlə çıxaracaqsınız. Bu vəzifə dərinin yumşaq bir şəkildə qaldırıldığı və əzələlərdən kəsildiyi qayçı və forseps ilə ən yaxşı şəkildə yerinə yetirilir. Lateksin vurulduğu kəsik nöqtəsindən başlaya və quyruğa doğru davam edə bilərsiniz. Cinsiyyət bölgəsindən qaçaraq, oxşar nümunəni kəsmək üçün diaqramdakı xətlərdən istifadə edin. Dəriyə yapışan əzələləri sıxmaq üçün qayçı və zonddan istifadə edərək dərini əzələlərdən yumşaq bir şəkildə soyun.

Aşağıdakı əzələləri müəyyənləşdirin və hər birinə fərqli rəngli sancaqlar qoyun.

1. Biceps brachii - humerusun ön səthində yerləşir.
2. Triceps brachii - yuxarı qolun yanlarında və arxasında yerləşir.
3. Spinotrapezius - siçovulun dorsal torakal nahiyəsində yerləşir.
4. Latissimus dorsi - spinotrapezius tərəfindən posterior (və qismən örtülmüş) yerləşir.
5. Biceps femoris - budun yan tərəfində, iki bağlamada yerləşir
6. Tibialis Anterior - ayağın ön hissəsində yerləşir.
7. Gastrocnemius - alt ayağında, baldır əzələsinin əsas hissəsində yerləşir. tərəfindən dabana yapışdırılır Axilles tendonu.
8. Xarici oblik - qarının yan tərəflərində yerləşir.
9. Gluteus Maximus - aşağı arxa və arxa tərəfdə yerləşir.
10. Pektoralis Major/Minor - döş qəfəsində yerləşir

Yuxarıda sadalanan əzələləri dərisi soyulmuş siçovulun üzərinə yapışdırın və hər birini müəyyənləşdirin.

Prosedur: Ayağın sümüklərinin üzə çıxarılması

3 ayağın sümüyünü üzə çıxarmaq üçün biceps femoris və gastrocnemius əzələlərini diqqətlə çıxarın: Tibia, Fibula, və Bud sümüyü və kiçik patella (diz qapağı). Siz də görə bilərsiniz bağlar alt ayağın sümüklərini bud sümüyünə bağlayan diz ətrafında və qastroknemiusu topuğa bağlayan axilles tendonunu.

Qeyd edək ki, bud oynağı top və yuva birləşmə adlanır. Sümüklərin çanaq boşluğuna necə uyğunlaşdığını yoxlayın.

Siçovulun sümüklərini öyrənmək üçün diaqramı öyrənin.

Baş və boyun strukturları

  1. Boyun tərəflərində, əzələlər arasında olan tüpürcək vəzilərini tapın. Bu vəziləri aşkar etmək üçün boyun və üzün dərisini diqqətlə çıxarın. Tüpürcək vəziləri tüpürcək və amilaza (qidanın parçalanmasına kömək edən ferment) ifraz edən yumşaq süngər toxumasıdır. Üç tüpürcək vəzi var - bu dilaltı, submaksiller, və parotid.
  2. tapın limfa vəziləri tüpürcək vəzilərinin qarşısında yerləşir. Limfa vəziləri dairəvidir və çənə əzələlərinə sıxılır. Onlar həmişə siçovulda görünmür.
  3. Boyun əzələlərini üzə çıxarmaq üçün çəkin nəfəs borusu. Traxeyanı dəstəkləyən halqalı qığırdaqları ilə müəyyən etmək olar. The yemək borusu traxeyanın altında yerləşir, baxmayaraq ki, mədəyə daxil olan qarın boşluğunda tapmaq daha asandır.
  4. tapın qırtlaq, traxeyanın yalnız ön tərəfində olan. Qırtlaq səs qutusudur və siçovulların cızıltılı səslər çıxarmasına imkan verir.

Tüpürcək vəziləri, qırtlaq və nəfəs borusu bağlayın.

Yoxlama məntəqəsi
  1. Siçovulun arxa ayağındakı dörd sümük hansılardır? ___________________________
  2. Siçovulun ön ayağındakı üç sümük hansıdır? ___________________________
  3. Traxeya hara aparır? ___________________ Qida borusu? ______________
  4. Qadınlarda hansı xüsusiyyəti tapırsınız, amma kişilərdə yox? ________________
  5. Qastroknemiusu kalkaneusla hansı vətər birləşdirir? ______________
  6. Bud sümüyü ifşa etmək üçün hansı əzələ çıxarıldı? ________________
  7. Siçovulun dorsal tərəfində hansı iki əzələ tapıla bilər? ________________
  8. Qarın, qarın nahiyəsini hansı əzələ əhatə edir? ______________________
  9. Ventral, döş nahiyəsini hansı əzələ əhatə edir? ________________________
  10. Siçovulların səslənməsinə hansı struktur cavabdehdir? ______________________

Siçovulların parçalanması - Torakal orqanlar

Prosedur:

Şəkildəki kəsik işarələrindən sonra siçovulun qarın divarını kəsin. Çox dərindən kəsməməyə və qayçınızın ucunu yuxarıya yönəltməyə diqqət edin. Əsas strukturlara zərər verməyin. Bədən boşluğunu açdıqdan sonra onu lavabonun içində yaxalamaq lazımdır.

  1. tapın diafraqma, döş qəfəsini qarın boşluğundan ayıran əzələ təbəqəsidir.
  2. The ürək mərkəzdə döş qəfəsində yerləşir. Yuxarıdakı iki tünd rəngli kameralar qulaqcıqlar (tək: atrium) və alt kameralar mədəciklər. Ürək nazik bir membranla örtülmüşdür perikard. (Daha sonra ürəyimizə qayıdacağıq.)
  3. tapın timus vəzibirbaşa ürəyin yuxarı hissəsinin üstündə yerləşir. Timus immun sisteminin inkişafında fəaliyyət göstərir və gənc siçovullarda yaşlı siçovullara nisbətən daha böyükdür.
  4. The ağciyərlər ürəyin hər iki tərəfində yerləşən və döş qəfəsinin çox hissəsini tutmalı olan süngərvari orqanlardır.

Qarın Orqanları

  1. The coelom daxili orqanların (daxili orqanların) yerləşdiyi bədən boşluğudur. Boşluq adlanan membranla örtülmüşdür peritonÇox nazik və tor kimi olan , orqanları aydın görmək üçün bu qişanın bir hissəsini çıxarmaq üçün maşadan istifadə etməli ola bilərsiniz.
  2. tapın qaraciyərDiafraqmanın tam altında asılmış tünd rəngli orqandır. Qaraciyərin bir çox funksiyası var, bunlardan biri də yağların həzminə kömək edən safra istehsal etməkdir. Qaraciyər həmçinin tullantıları daha az zərərli maddələrə çevirir. Siçovulların öd kisəsi yoxdur, digər heyvanlarda öd saxlamaq üçün istifadə olunur. Qaraciyər dörd hissədən ibarətdir:
    median və ya kistik lob - yuxarıda yerləşir, açıq-aşkar mərkəzi yarıq var
    sol lateral lob - böyük və qismən mədə ilə örtülmüşdür
    sağ yan lob - ön və arxa lobula qismən bölünmüş, median lob tərəfindən görünməz şəkildə gizlənmişdir.
    kaudat lob - yemək borusu və mədə ətrafında kiçik və qıvrımlar, mədə yuxarı qaldırıldıqda ən asan görünür
  3. The yemək borusu adlı yerdə diafraqmanı deşir fasilə və qidanı ağızdan mədəyə köçürür. Onun mədəyə daxil olduğu yeri tapmaq daha asandır.
  4. tapın mədə sol tərəfdə diafraqmanın yalnız altında. Mədənin funksiyalarına qida saxlama, qidanın fiziki parçalanması və zülalın həzm edilməsi daxildir. Əyri mədənin xarici kənarı adlanır daha böyük əyrilik, daxili kənar adlanır daha az əyrilik. Mədədə bir yarıq yarada və içərisində nə olduğunu görə bilərsiniz. Tərkibinin əksəriyyəti qismən həzm olunmuş siçovul yemi olmalıdır. Mədənin hər bir ucunda (daxili tərəfdə) əzələ qapağı var. Özofagus və mədə arasındakı boşluq adlanır ürək sfinkteri. Mədə ilə bağırsaq arasındakı boşluğa bağırsaq deyilir pilorik sfinkter.
  5. The dalaq qaraciyərlə təxminən eyni rəngdədir və mədənin daha böyük əyriliyinə bağlanır. Bu qan dövranı sistemi və qan hüceyrələrinin məhv edilməsində və qanın saxlanmasında funksiyaları ilə əlaqələndirilir. Bir insan dalaqsız yaşaya bilər, lakin immunitet sisteminin işləməsinə kömək etdiyi üçün xəstələnmə ehtimalı daha yüksəkdir.
  6. The mədəaltı vəzi mədə ilə nazik bağırsaq arasındakı toxumada olan qəhvəyi rəngli, yastı vəzidir. Pankreas kiçik kanallar (pankreas kanalı) vasitəsilə bağırsağa göndərilən həzm fermentləri istehsal edir. Mədəaltı vəzi də qlükoza mübadiləsinin tənzimlənməsində vacib olan insulin ifraz edir.
  7. The nazik bağırsaq mədədən (pilorik sfinkter vasitəsilə) qismən həzm olunmuş qida qəbul edən nazik qıvrımlı borudur. Nazik bağırsağın qıvrımları bir membran adlanan bir membranla bir yerdə tutulur mezenteriya. Nazik bağırsaq üç hissədən ibarətdir: onikibarmaq bağırsaq, jejunumileum, (Mədədən yoğun bağırsağa qədər sıralanır.) Onikibarmaq bağırsaq bağırsağın mədədən çıxan ilk hissəsidir, əsasən düzdür. Jejunum və ileum bağırsağın qıvrım hissələridir, ileum nazik bağırsağın yoğun bağırsağa çevrilməsindən əvvəl sonuncu hissədir.
  8. tapın kolon, nazik bağırsaqdan uzanan və anusa aparan böyük yaşılımtıl borudur. Yoğun bağırsaq kimi də tanınır qalın bağırsaq. İncə bağırsaqdan qalın bağırsağa daxil olan qida, ileoçekal qapaq tərəfindən idarə olunur. Kolon həzm və suyun udulmasının son mərhələlərinin baş verdiyi yerdir və həzmə kömək etmək üçün müxtəlif bakteriyaları ehtiva edir. Kolon beş hissədən ibarətdir:
    qaraciyər - nazik və yoğun bağırsağın qovuşduğu böyük kisə (ileoçekal qapaq materialların keçidini tənzimləyir)
    artan kolon &ndash qida yuxarıya doğru hərəkət edir.
    eninə kolon &ndash diafraqmaya paralel olan qısa bir hissə
    enən kolon &ndash yoğun bağırsağın düz bağırsağa doğru geri dönən hissəsini.
    düz bağırsaq - yoğun bağırsağın anusa aparan qısa, terminal hissəsi. Düz bağırsaqda nəcis bədəndən xaric edilməzdən əvvəl müvəqqəti olaraq saxlanılır.


Həzm boşluğunun orqanlarını bağlayın.

Yoxlama məntəqəsi: Biliklərinizi yoxlayın
  1. Mədənin altında uzanır və insulin ifraz edir ____________________________
  2. Yoğun bağırsağın qalxan və enən kolon arasında olan hissəsi: ________________________
  3. Ağzı mədə ilə birləşdirir: ______________________________________
  4. Ürəyi əhatə edən nazik membran: ______________________________________
  5. Qarın boşluğunu döş qəfəsindən ayıran əzələ: ____________________________
  6. Köhnə qan hüceyrələrini məhv edir və nazik bağırsağın qıvrımlarında yerləşir: _____________________________
  7. Qaraciyərin aşkar mərkəzi yarığı olan lobu: _______________________________________
  8. Yoğun bağırsağın başqa adı: ______________________________________________________
  9. Ürəyin hər iki tərəfində yerləşən tənəffüs sistemi orqanları: _________________________________
  10. Döş qəfəsinin diafraqmanın düz altında (arxasında) yerləşən böyük orqanı: ___________________
  11. Yoğun bağırsağın son bölməsi, nəcisin saxlanması: ___________________________________
  12. Nazik bağırsağın birləşdiyi yerdə olan yoğun bağırsağın kisəsi: _______________________
  13. Qidanın mədədən nazik bağırsağa keçməsini tənzimləyən qapaq: ___________________
  14. Qarın boşluğunun orqanlarını örtən nazik membran: _____________________________
  15. Nazik bağırsağın birinci bölməsi: _________________________________________________
  16. Yoğun bağırsağın diafraqmaya paralel olan hissəsi: ____________________________
  17. İmmunitet sistemi ilə əlaqəli quruluş, ürəyin yuxarı hissəsində yerləşir: _________________________________
  18. Valf materialların nazik bağırsağa keçməsini tənzimləyir: _______________________
  19. Qida borusunun keçdiyi diafraqmadakı açılış: ____________________________
  20. Nazik bağırsağın onikibarmaq bağırsaqdan sonra gələn hissəsi: _________________________________

Sidik-cinsiyyət sistemi

Onurğalıların ifrazat və reproduktiv sistemləri bir-biri ilə sıx bağlıdır və adətən sidik-cinsiyyət sistemi kimi birlikdə öyrənilir. Bununla belə, onların fərqli funksiyaları var: ifrazat sistemi tullantıları çıxarır və reproduktiv sistem gametləri (sperma və yumurtalar) istehsal edir və inkişaf etməkdə olan embrion üçün mühit təmin edir.

İfrazat orqanları

  1. İfrazat sisteminin əsas orqanlarıdır böyrəklər. Onurğanın hər iki tərəfində qarın boşluğunun arxasına doğru yerləşən bu böyük lobya formalı strukturları tapın. Böyrək arteriyaları və damarları böyrəkləri qanla təmin edir.
  2. Bu damarları aorta və vena kava (qarın boşluğunun iki böyük damarı) ilə birləşdiyi yerə qədər izləyin.
  3. Zərif olanı tapın üreterlər ki, böyrəyə yapışır və böyrəklərə aparır sidik kisəsi. Bu kiçik boruların yerini tapmağa kömək etmək üçün böyrəkləri hərəkət etdirin.
  4. Prosedur: Tək böyrəyi (digər orqanlara zərər vermədən) çıxarın və uzununa kəsərək parçalayın. tapın korteks (xarici sahə) və medulla (daxili sahə).
  5. The uretra sidiyi sidik kisəsindən mədəyə aparır uretral ağız (bu ağız erkək və ya dişi siçovulunuz olub-olmamasından asılı olaraq müxtəlif sahələrdə olur).
  6. Böyrəklərin üstündəki yağda yerləşmiş kiçik sarımtıl vəzilərdir böyrəküstü vəzilər.

**Hər iki cinsin strukturlarını bilmək üçün məsuliyyət daşıyırsınız. Öz siçovulunuzdakı strukturları tapın və sonra başqa qrupun siçovulundan əks cinsin strukturlarını müşahidə edin.


Addım 1. Nümunənizin   olub olmadığını müəyyən edinartefakt, fosil, qaya və ya mineral

Əsaslardan başlayaq. Ediləcək ilk şey, nümunənizin bir olub olmadığını müəyyən etməkdir artefakt, fosil, qaya və ya mineral. Campbell Geologiya Muzeyi potensial meteoritlərin müəyyənləşdirilməsini təklif etmir. Meteorit identifikasiyası haqqında məlumat üçün aşağıdakı bölməyə baxın

Artefaktlar müasir və ya tarixdən əvvəlki insanlar tərəfindən hazırlanmış əşyalardır (məsələn, ox ucları və saxsı qablar). Bob Campbell Geologiya Muzeyi artefaktları müəyyən etmir. Cənubi Karolinada artefakt identifikasiyası resursları haqqında daha çox məlumat əldə etmək üçün buraya klikləyin.

Fosillər sümüklər, lələklər, pulcuqlar və yarpaqlar kimi bədən hissələri və ya ayaq izləri, yuvalar və nəcis kimi digər qorunmuş davranış izləri də daxil olmaqla keçmiş həyatın hər hansı sübutudur. Bir fosil nümunəsi   Mammuthus columbi (Yünlü Mamont), Cənubi Karolinanın əyalət fosili də olur. Cənubi Karolina Paleontoloji Resursları haqqında veb səhifəmizi də yoxladığınızdan əmin olun.

Fosillər SC-nin yuxarı hissəsində olduqca nadirdir, lakin əyalətin cənub hissəsinin çox hissəsində olduqca yaygındır. Bununla belə, əlinizdə olan fosildirsə, kuratorumuza aşağıdakı ünvana bir neçə yüksək rezolyusiyaya malik rəqəmsal fotoşəkil göndərə bilərsiniz ([email protected] bütün sorğular doldurulmuş nümunənin şəxsiyyət vəsiqəsi forması ilə müşayiət olunmalıdır) və ya onu buraxa bilərsiniz. identifikasiya üçün fosilinizi muzeydən çıxarın (İdentifikasiya sorğusu formasını buradan endirin). Lütfən, formanı mümkün qədər tam doldurun və nümunənizi şəxsiyyəti təsdiqləmək üçün götürən zaman onu özünüzlə gətirin. Nümunəniz fosil deyilsə, aşağıda oxumağa davam edin. Nümunənizin daşlaşmış sümük və ya ağac ola biləcəyini düşünürsünüzsə, lütfən, fərqi necə müəyyənləşdirmək barədə aşağıdakı təsvirə baxın.

Daşlar iki və ya daha çox mineralın təbii birləşmələridir. Süxurların üç geniş kateqoriyası var: maqmatik, metamorfik və çöküntü. Məsələn, Winnsboro Blue Granite – kvars, feldispat və slyuda minerallarından ibarət maqmatik qayadır ki, bu da Cənubi Karolinanın dövlət daşıdır. Klemson bölgəsində yayılmış qayaların bəzi nümunələrini burada görə bilərsiniz.

Nümunəniz qayadırsa, aşağıdakı mineral identifikasiya təlimatına əməl etməklə onu təşkil edən fərdi mineralları müəyyən etməlisiniz. Daşınızdakı müxtəlif mineralların nisbi bolluğunu müəyyən etdikdən sonra muzeydə ümumi Upstate qayalarının nümunələrini görə bilərsiniz və ya identifikasiya üçün onlayn və ya digər arayışlara müraciət edə bilərsiniz. Siz həmçinin identifikasiya üçün muzeyə öz sirli qayanızı gətirə bilərsiniz  (Şəxsiyyət vəsiqəsi Sorğu formasını buradan endirin).

Minerallar təbii olaraq meydana gələn, qeyri-üzvi, müəyyən kimyəvi formul və atom düzülüşü ilə bərk maddələrdir. Minerallar sərtlik və kristal forması (məsələn, altıbucaqlı, kub) kimi xüsusiyyətlərə görə təsnif edilir. Məsələn,  Kvars – Silikon dioksid (SiO2). Kvars Yer qabığında ən çox yayılmış mineraldır. Məsələn, kvarsın bənövşəyi çeşidi ametist adlanır və Cənubi Karolinanın dövlət mineralıdır. Onun kristal forması altıbucaqlıdır (6 tərəfli) və sərtliyi 7-dir (Moh şkalası üzrə 10-dan, aşağıya baxın).

Geoloqlar 5000-dən çox müxtəlif növ mineralları sənədləşdiriblər! Mineralların əksəriyyəti çox nadirdir və onların identifikasiyası tez-tez mikroskopik və digər analitik üsulların istifadəsi üzrə təhsil almış bir mineralogist tələb edir. Bununla belə, bəzi minerallar (məsələn, kvars və kalsit) çox yayılmışdır. Aşağıdakı bələdçi yalnız Cənubi Karolina ştatında səthdə yayılmış bəzi mineralları müəyyən etməkdə sizə kömək etmək üçün nəzərdə tutulub.


Kompakt və süngər sümük

Əksər sümüklərdə yığcam və süngər sümük toxuması var, lakin onların paylanması və konsentrasiyası sümüyün ümumi funksiyasından asılı olaraq dəyişir. Yığcam və süngər sümük eyni matris materiallarından və hüceyrələrdən hazırlansa da, təşkil olunma üsulu ilə fərqlənir. Kompakt sümük sıxdır ki, sıxıcı qüvvələrə tab gətirə bilsin, süngər sümük isə (həmçinin deyilir) süni sümük) açıq yerlərə malikdir və dəstəkləyicidir, eyni zamanda yüngüldür və dəyişən bədən ehtiyaclarını ödəmək üçün asanlıqla yenidən düzəldilə bilər.


İnsan Appendikulyar Skelet

Appendikulyar skelet insan bədəninin yuxarı və aşağı ətraflarının birləşməsini və funksiyalarını dəstəkləyir.

Öyrənmə Məqsədləri

İnsan appendikulyar skeletinin sümüklərini və funksiyalarını təsvir edin

Əsas Çıxarışlar

Əsas Nöqtələr

  • İnsan appendikulyar skeleti yuxarı ətrafların, aşağı ətrafların, döş qurşağının və çanaq qurşağının sümüklərindən ibarətdir.
  • Pektoral qurşaq yuxarı ətrafların bədənə bağlanma nöqtəsi kimi çıxış edir.
  • Üst ətraf qol, ön qol, bilək və əldən ibarətdir.
  • Çanaq qurşağı bədənin ağırlığını daşımaqdan məsuldur və hərəkətə cavabdehdir, eyni zamanda alt əzaları bədənə bağlamaqdan məsuldur.
  • Budlar, ayaqlar və ayaqlar da daxil olmaqla aşağı ətraflar bədənin bütün ağırlığını dəstəkləyir və hərəkət nəticəsində yaranan qüvvələri udur.

Əsas Şərtlər

  • eksenel skelet: orqanizmin baş və gövdə sümükləri
  • appendikulyar: əza və ya əlavəyə aid və ya ona aid
  • körpücük sümüyü: körpücük sümüyü döş qəfəsinin yuxarı hissəsində çiyin və boyun arasında çıxan çıxıntılı sümük
  • kürək sümüyü: çiyin arxasını təşkil edən iki böyük, yastı sümükdən biri
  • ifadə etmək: birləşmə yaratmaq və ya oynaqlarla birləşdirmək

İnsan Appendikulyar Skelet

İnsan appendikulyar skeleti yuxarı ətrafların (cisimləri tutmaq və manipulyasiya etmək funksiyasını yerinə yetirən) və aşağı ətrafların (hərəkət etməyə imkan verən) sümüklərindən ibarətdir. Buraya həm də müvafiq olaraq yuxarı və aşağı ətrafları bədənə bağlayan döş (və ya çiyin) qurşağı və çanaq qurşağı daxildir.

Appendikulyar skelet: Appendikulyar skelet döş ətraflarının (qol, qol, əl), çanaq üzvlərinin (bud, ayaq, ayaq), döş qurşağı və çanaq qurşağının sümüklərindən ibarətdir.

Pektoral qurşaq

Yuxarı ətrafların eksenel skeletə bağlanma nöqtələrini təmin edən döş qurşağı sümükləri ön hissədə körpücük sümüyündən (və ya körpücük sümüyündən), arxada isə kürək sümüyündən (və ya çiyin bıçaqlarından) ibarətdir. Qolları bədəndə yerləşdirən körpücük sümüyü, S şəkilli sümüklər, birinci qabırğanın bir qədər yuxarısında döş qəfəsinin ön hissəsində (sinə) üfüqi şəkildə uzanır.

Pektoral qurşaq: (a) Primatlarda döş qurşağı körpücük sümüyü və kürək sümüyündən ibarətdir. (b) Arxa görünüşdə əzələnin bağlandığı kürək sümüyü görünür.

Skapula döş qurşağının arxasında yerləşən düz, üçbucaqlı sümüklərdir. Çiyin birləşməsini keçən əzələləri dəstəkləyirlər. Onurğa kürək sümüyünün arxası boyunca uzanır, bu, əzələlərin sümüyə geniş bağlanmasını asanlaşdıran sümük çıxıntısına yaxşı bir nümunədir.

Üst Əzalar

Üst əzalar üç bölgədə 30 sümükdən ibarətdir: qol (çiyindən dirsəyə), ön kol (ulna və radius), bilək və əl. Humerus yuxarı ətrafın ən böyük və ən uzun sümüyü və qolun yeganə sümüyüdür. Çiyində kürək sümüyü ilə və dirsəkdə ön kol ilə oynaqlanır (birləşir). Dirsəkdən biləyə qədər uzanan ön kol iki sümükdən ibarətdir: dirsək sümüyü və radius. Ön kolun yanal (baş barmaq) tərəfi boyunca yerləşən radius, dirsəkdə humerus ilə birləşir. Ön kolun medial tərəfində (çəhrayı-barmaq tərəfində) yerləşən dirsək sümüyü radiusdan daha uzundur. Dirsəkdə humerus ilə artikulyasiya edir. Radius və dirsək sümüyü də karpal sümükləri ilə və bir-biri ilə artikulyasiya edir ki, bu da onurğalılarda ətrafın uzun oxuna görə karpusun dəyişkən dərəcədə fırlanmasını təmin edir. Əl səkkiz sümüyü (biləyin), metakarpusun beş sümüyü (xurma) və falanqların (rəqəmlərin) 14 sümüyündən ibarətdir. Baş barmaq istisna olmaqla, hər bir rəqəm üç falanqdan ibarətdir, mövcud olduqda yalnız ikisi var.

Yuxarı ətraflar: Üst ətraf yuxarı qolun humerus sümüyündən, ön kolun radius və dirsək sümüyündən, səkkiz bilək sümüyündən, metakarpusun beş sümüyündən və falanqların 14 sümüyündən ibarətdir.

Çanaq qurşağı

Çanaq qurşağı eksenel skeletin aşağı ətraflarına yapışır və bədənin ağırlığını daşımaqdan və hərəkət etməkdən məsuldur. Güclü bağlarla ox skeletinə etibarlı şəkildə bağlanır. O, həmçinin bud sümüyünü bədənə etibarlı şəkildə bağlamaq üçün möhkəm bağları olan dərin yuvalara malikdir. Çanaq qurşağı iki böyük bud sümüyü ilə daha da möhkəmlənir. Yetkinlərdə omba sümükləri üç cüt sümüyün birləşməsindən əmələ gəlir: ilium, ischium və pubis. Çanaq bədənin ön hissəsində pubik simfiz oynağı və bədənin arxa hissəsində sakrumun sümükləri ilə birləşir.

Aşağı Əzalar

Aşağı ətraflar bud, ayaq və ayaqdan ibarətdir. Aşağı ətrafın sümükləri bud sümüyü (bud sümüyü), patella (diz qapağı), tibia və fibula (ayaq sümükləri), tarsals (topuq sümükləri) və metatarsal və falanqsdır (ayaq sümükləri). Aşağı ətrafların sümükləri yuxarı ətrafların sümüklərindən daha qalın və güclü olur, çünki hərəkət nəticəsində yaranan qüvvələrlə birlikdə bədənin bütün ağırlığını dəstəkləmək lazımdır.

Aşağı ətraf: Aşağı ətraf bud (femur), diz qapağı (patella), ayaq (tibia və fibula), topuq (tarsals) və ayaq (metatarsals və phalanges) sümüklərindən ibarətdir.

Bud sümüyü və ya bud sümüyü bədəndəki ən uzun, ən ağır və ən güclü sümükdür. Bud sümüyü və çanaq sümükləri proksimal ucunda bud oynağını təşkil edir. Distal ucunda femur, tibia və patella diz eklemini meydana gətirir. Patella və ya diz qapağı, diz ekleminin ön tərəfində yerləşən üçbucaqlı bir sümükdür və bud ekstensorlarının (quadriseps) vətərinə yapışdırılır. Sürtünməni azaldaraq diz uzadılmasını yaxşılaşdırır. Tibia və ya baldır sümüyü, birbaşa dizin altında yerləşən ayağın böyük bir sümüyüdür. Tibia proksimal ucunda bud sümüyü ilə, distal ucunda fibula və tarsal sümükləri ilə birləşir. İnsan bədənində ikinci ən böyük sümük olaraq, bədənin ağırlığını bud sümüyündən ayağa ötürməkdən məsuldur. Fibula və ya dana sümüyü tibia ilə paraleldir və artikulyardır. Ağırlıq daşımır, ancaq ayaq biləyi birləşməsinin yan hissəsini təşkil edərkən əzələlərin bağlanması üçün bir yer kimi çıxış edir.

Tarsallar, bədənin ağırlığını tibia və fibuladan ayağa ötürən topuğun yeddi sümüyüdür. Metatarsallar ayağın beş sümüyü, falanqlar isə barmaqların 14 sümüyüdür.

Ayaq və ayaq biləyi: Bu rəsm insan ayağının və ayaq biləyinin sümüklərini, o cümlədən metatarsal sümükləri və falanqları göstərir.


Dəniz şüşənizi müəyyən edin

Dəniz şüşəsi qırıntılarını və ya digər çimərlik tapıntılarını müəyyən etmək üçün buraya yerləşdirin.

Fotoşəkilsiz identifikasiya çox çətindir və ya qeyri-mümkündür.

Fotoşəkilləri olmayan dəniz şüşəsi və digər çimərlik daranan xəzinələrin müəyyən edilməsi ilə bağlı sualların nadir hallarda cavab aldığını gördük.

  • Sualınızın qəbul edilməsi üçün dəniz şüşəsi qırıntınızın və ya çimərlik tapıntınızın şəklini təqdim etməlisiniz.

Şəkil yükləmək üçün onun eni 1000 pikseldən az olmalıdır.

Şəkilinizin ölçüsünü dəyişmək üçün asan təlimatlar üçün buraya klikləyin.

Dəniz şüşəsinin tapıldığı yer və parçanın ətraflı yazılı təsviri, məsələn, ölçüsü, rəngi, hərfləri və ya rəqəmləri də faydalıdır.


EFossils Production Credits

eFossillər istifadəçilərin mühüm fosil yerlərini tədqiq edə və fosil rəqəmsal kitabxanasına baxa biləcəkləri əməkdaşlıq veb saytıdır. Bu saytdan istifadə ilə bağlı hər hansı probleminiz varsa və ya başqa sualınız varsa, lütfən bizimlə əlaqə saxlayın.

eFossils üçün maliyyə Ostin Texas Universitetində İT idarəetmə strukturunun Tədqiqat və Təhsil Texnologiyaları Komitəsindən (R&E) Longhorn Texnologiya üçün İnnovasiya Fondu (LIFT) Mükafatı tərəfindən təmin edilmişdir.


Konkretlər Qalereyası

Konkresiyalar çöküntü süxurlarına çevrilməzdən əvvəl çöküntülərdə əmələ gələn sərt cisimlərdir. Yavaş kimyəvi dəyişikliklər, bəlkə də mikrobların fəaliyyəti ilə əlaqədar olaraq, mineralların yeraltı sulardan çıxmasına və çöküntüləri bir-birinə bağlamasına səbəb olur. Çox vaxt sementləşdirici mineral kalsitdir, lakin qəhvəyi rəngli, dəmir tərkibli karbonatlı mineral siderit də geniş yayılmışdır. Bəzi konkretləşmələrdə sementləşməni tetikleyen fosil kimi mərkəzi hissəcik var. Digərlərində bir boşluq var, ola bilsin ki, mərkəzi obyekt əriyib, digərlərində isə içəridə xüsusi heç bir şey yoxdur, ola bilsin ki, sementasiya kənardan tətbiq edilib.

Beton, ətrafındakı qaya ilə eyni materialdan, üstəgəl sementləşdirici mineraldan, düyün isə (əhəng daşındakı çaxmaq daşı düyünləri kimi) fərqli materialdan ibarətdir.

Konkresiyalar silindrlər, təbəqələr, demək olar ki, mükəmməl kürələr və onların arasında olan hər şey kimi formalaşa bilər. Əksəriyyəti sferikdir. Ölçülərinə görə, onlar çınqıl kimi kiçikdən yük maşını qədər böyük ola bilər. Bu qalereya ölçüləri kiçikdən böyüyə qədər dəyişən betonları göstərir.

Dəmirli (dəmirli) materialdan ibarət bu çınqıl ölçülü betonlar Sugarloaf Rezervuar Parkından, Viktoriya, Avstraliyadandır.


Alyaskada kəşf edilən sirli yeni balina növləri

Elm adamları kimsəsiz çimərlikdəki ölü balina və orta məktəbin idman zalında asılmış skeletin yeni bir növ olduğunu söyləyirlər. Bununla belə, mütəxəssislər heç vaxt bir nəfəri sağ görməyiblər.

Bir çox yaxşı sirr kimi, bu da cəsədlə başladı, lakin sözügedən cəsədin uzunluğu 24 fut (7,3 metr) idi.

Qalıqlar 2014-cü ilin iyun ayında, Alyaskanın Berinq dənizinin ortasında kiçik qaya və ot oazisi olan St George Pribilof adaları icmasında sahilə çıxdı. Gənc biologiya müəllimi küləkli küləkli sahildə yarı qumda basdırılmış cəsədi gördü. O, əvvəlcə nə tapdıqlarını bildiyini güman edən keçmiş suiti tədqiqatçısını xəbərdar etdi: Berdin dimdikli balinası, iri, boz, dərin dalğıclı bir məxluq, bəzən gelgit ilə ölüləri yuyur.

Lakin sonradan daha yaxından araşdırma göstərdi ki, ət çox tünd, arxa üzgəc çox böyük və disketdir. Heyvan yetkin olmaq üçün çox qısa idi, lakin dişləri yaşla köhnəlmiş və saralmışdı.

Çərşənbə axşamı dərc edilən yeni araşdırmaya görə, məlum oldu ki, bu, ümumiyyətlə, Berdin dimdiyi balinası deyil, tamamilə yeni bir növdür - yapon balıqçılarının çoxdan adlandırdıqları daha kiçik, qəribə formalı qara cetacean. karasu, və ya qarğa.

"We don't know how many there are, where they're typically found, anything," says Phillip Morin, a molecular geneticist at the National Oceanic and Atmospheric Administration's Southwest Fisheries Science Center. "But we're going to start looking."

It’s rare to uncover a new species of whale. Advances in DNA research have helped scientists identify five new cetaceans in the past 15 years but two were dolphins and most were simple category splits between fairly similar species. This animal, in the genus Berardius, looks far different than its nearest relative and inhabits an area of the North Pacific where marine mammal research has been conducted for decades.

It's just so exciting to think that in 2016 we're still discovering things in our world—even mammals that are more than 20 feet long.

"It's a really big deal," says study co-author Paul Wade of NOAA's National Marine Mammal Laboratory. "If you think about it, on land, discovery of new species of large mammals is exceptionally rare. It just doesn't happen very often. It's quite remarkable."

Morin and his team examined the St. George carcass, took bone powder from old museum specimens, and reviewed DNA tests of whales from the Sea of Okhotsk. They studied skulls and beaks and analyzed records from whaling fleets in Japan. They even tracked down a skeleton hanging from the ceiling in a high school gymnasium in the Aleutian Islands.

The scientists conclude in their study published in Dəniz məməliləri elmi that this type of whale, which has not yet been named, is nearly as far removed genetically from the Northern Hemisphere's Baird's beaked whales as it is from its closest known relative, Arnoux's beaked whales, which swim in the Antarctic Ocean. The differences, in fact, are so dramatic that the animal has to be something else, they say.

"It's just so exciting to think that in 2016 we're still discovering things in our world—even mammals that are more than 20 feet long," Morin says.

He is not alone in his enthusiasm. Robert Pitman serves on a taxonomy committee for the Society for Marine Mammalogy, which publishes an annual list of all recognized marine mammal species. He is not among the 16 co-authors on Morin's paper. But at a time when the diversity of marine mammals is shrinking—the Yangtze River dolphin is now functionally extinct and Mexico’s vaquita porpoise is dangerously close—Pitman calls the discovery "heartening."

"It boggles my mind to think that a large, very different-looking whale has gone unnoticed by the scientific community for so long," Pitman says. "It sends a clear message about how little we know about what is in the ocean around us."

The discovery also raises new questions about how well humans are understanding the threats posed by marine activities, from energy exploration to sonar use, given that so few people even knew such a creature existed.

Of the 88 recognized living cetacean species, including orcas and humpbacks, bottlenose dolphins and Dall's porpoises, 22 are beaked whales. The largest of those, Baird's beaked whales, also called giant bottlenose whales, can reach 35 to 40 feet (10.7 to 12 meters) and weigh more than 24,000 pounds (10,900 kilograms). They travel in large groups, may dive 3,000 feet (914 meters), and can be underwater for an hour. While beaked whales are still hunted in Japan, little about them is known. In part that’s because they spend so much time feeding and exploring vast, deep canyons far from shore.

When Christian Hagenlocher on St. George, a 35-square-mile (91-square-kilometer) island inhabited by 100 people, frequented by hundreds of thousands of seals, and visited by 2.5 million birds, pointed out the dead whale in Zapadni Bay to former seal researcher Karin Holser, she thought it was a Baird's beaked whale. But later, as tides and currents revealed more of the animal, Holser realized she didn't recognize it at all. She consulted a colleague's cetacean identification book and sent pictures to other experts in Alaska.

"This dorsal fin was larger, further aft, and had more curvature than that of a Baird's beaked whale," says independent ecologist Michelle Ridgway, who arrived on the island days later. "The jaw structure and the shape of the melon were not quite right, either.” And this whale, while clearly an adult, was just two-thirds the size of full-grown Baird’s beaked whales.

Holser and other island residents measured the whale. Ridgway collected tissue, arranging to ship the slightly fetid samples through intermediaries to Morin's lab in Southern California.

Just nine months earlier, he'd spied new research by Japanese scientists attempting to describe differences between Baird's beaked whales and a rare black form that whalers had whispered about since the 1940s. Groups of these smaller whales were sometime spotted in Japan’s Nemuro Strait, but only between April and June. There was no record of scientists ever seeing one alive.

"They're almost folklore," Morin says.

The Japanese scientists had speculated in fall of 2013 that this may be an unknown species of beaked whale. But they were forced to draw conclusions from DNA taken from just three of the creatures that had stranded off Hokkaido. They concluded more evidence was needed.

Even before receiving the samples from St. George, Morin had been trying to hunt down more specimens.

He went through NOAA's tissue collection, pulling all 50 or so that had previously been identified as a Baird's beaked whale. Using DNA testing he found that two were actually a closer genetic match to the small black whales tested by Japanese scientists in 2013. One of those was from a whale that washed ashore in 2004 and now hangs in a school gym in Dutch Harbor. Scientists there had long assumed it was a younger Baird's beaked whale.

Morin also took the suggestion of one of the Japanese scientists, who had identified a skeleton from 1948 with an unusual shaped head at the Smithsonian Institution. And he tracked down another skeleton from the Los Angeles County Museum of Natural History with body measurements that suggested they were the small black form. Morin took bone powder from both, and tested their DNA. They, too, were a match for karasu.

Along with the whale from St. George, Morin now had found five new specimens that were similar to the three found in Japan.

To describe a new species, however, "you build up lines of evidence, but that's very hard with an animal we've never seen alive," Morin says. But body measurements between Baird's beaked whales and the smaller black creature proved vastly different, as did their DNA.

Baird's beaked whales range throughout the North Pacific from Russia and Japan to Mexico. Genetic variation among Baird’s beaked whales was tiny. But for the five new black specimens Morin tested, all initially from the Bering Sea or the Aleutians, the sequences differed from the Baird's beaked whales significantly.

"The genetic variation within the forms was little, while the divergence between them was much larger," Morin says. "That's our strongest argument."

The whale still needs to be formally described and named, and Morin's findings would have to be accepted by outside experts who track cetacean taxonomy. But Pitman and others say the case is strong that it’s a new species.

"We're doing increasing damage to our environment, and we can't even begin to conserve the biodiversity we know is out there," Morin says. "Yet there's so much more about our world we don't even understand."


Q: Which layer of the epidermis is immediately superficial to the stratum Basale ?

A: Stratum basale is the innermost layer of the epidermal layer and attach the epidermis to the basal l.

Q: 25.Which intermolecular force is responsible for the high surface tension of water? See figure for e.

A: Water is a simple molecule made up of one oxygen atom bonded to two separate hydrogen atoms. Due to.

Q: Please identify the structures of bone with the following key terms: canaliculi central canal lacuna.

A: Canaliculi: They are microscopic canals located between the lacunae the ossified bone. Filopodia (ra.

Q: having issues with organisms that make up a cell

A: Organisms are biotic, or living part of the environment. All living things, from tiny to large are m.

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’A.

Q: Protein kinases activated , ardently Cyclades activated, camp produced, proteins phosphorylation, G .

A: The correct sequence of events is G protein activated, ardently cyclase activated, cAMP (cyclic aden.

Q: Which tree shows what the data would look like if Sample 1 really were Sockeye salmon?

A: The phylogenetic tree is also called the evolutionary tree. It is a diagram with branches that depic.

Q: There are 20 multiple choice about biology.

A: We are authorized to answer one question at a time, since you have not mentioned which question numb.

Q: the fennec fox is classified to which order

A: Fennec fox is a small fox usually found in the Sahara Desert and Arabian desert. It has a large ear .


Videoya baxın: Another timecapsule found in the Berlin woods! (Avqust 2022).