Məlumat

Açıq oxu çərçivələri və kodlaşdırma ardıcıllığı (CDS), bunlar fərqlidirmi?

Açıq oxu çərçivələri və kodlaşdırma ardıcıllığı (CDS), bunlar fərqlidirmi?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Bu iki termin məni uzun müddət çaşdırır. ORF və CDS arasındakı fərq nədir. Bəzi insanlar deyirlər ki, ORF intron ehtiva edə bilər və CDS yoxdur. ORF-nin vikipediya tərifində intron yoxdur. Kimsə iki termini müəyyən edə və fərqlərini qeyd edə bilərmi? Təşəkkürlər!


Bu səhifədə verilən tərifləri (əsasən) bəyənirəm.

ORF başlanğıc kodonu “ATG” ilə başlayan (həmişə deyil) və üç son kodondan (TAA, TAG, TGA) hər hansı biri ilə bitən DNT ardıcıllığıdır. Başlanğıc nöqtəsindən asılı olaraq, genetik koda uyğun olaraq istənilən nukleotid ardıcıllığını amin turşusu ardıcıllığına çevirməyin altı mümkün yolu var (üç irəli zəncirdə və üçü tamamlayıcı zəncirdə). Bunlara oxu çərçivələri deyilir.

Kodlaşdırma ardıcıllığı (CDS) zülalları meydana gətirmək üçün tərcümə olunan DNT-nin faktiki bölgəsidir. ORF-də intronlar da ola bilsə də, CDS ribosomal tərcümə mexanizmi ilə əslində amin turşularına çevrilən kodonlara bölünə bilən nukleotidlərə (birləşdirilmiş ekzonlara) aiddir.

Ancaq mən bu ifadə ilə tam razı deyiləm:

Prokaryotlarda ORF və CDS eynidir.

Bütün CDS-lərin ORF-lərdə olması doğru olsa da, bütün ORF-lər CDS deyil. Siz kodlaşdırmayan RNT elementləri kimi transkripsiya edilmiş ORF-lərə və ümumiyyətlə transkripsiya olunmayan ORF-lərə sahib ola bilərsiniz. CDS xüsusi olaraq transkripsiyadan sonrakı taleyi tərcümə edilməli olan ORF-lərə aiddir.


Açıq Oxu çərçivələri və kodlaşdırma ardıcıllığı (CDS), bunlar fərqlidirmi? - Biologiya

Tərcümə və Açıq Oxu Çərçivə Axtarışı

Zülalları kodlayan DNT bölgələri əvvəlcə messencer RNT-yə, sonra isə zülala çevrilir. Yalnız DNT ardıcıllığını tədqiq etməklə son zülalda görünəcək amin turşularının ardıcıllığını müəyyən edə bilərik. Tərcümə zamanı üç nukleotidin kodonları böyüyən zülal zəncirində növbəti amin turşusunun əlavə olunacağını müəyyənləşdirir. Hansı nukleotidin tərcüməyə başlayacağına və nə vaxt dayandırılacağına qərar vermək vacibdir, buna açıq oxu çərçivəsi deyilir.

Bir gen ardıcıllaşdırıldıqdan sonra düzgün açıq oxu çərçivəsini (ORF) müəyyən etmək vacibdir. DNT-nin hər bölgəsində altı mümkün oxu çərçivəsi var, hər istiqamətdə üçü. İstifadə olunan oxu çərçivəsi hansı amin turşularının bir gen tərəfindən kodlanacağını müəyyənləşdirir. Bir genin tərcüməsində (eukariotlarda) adətən yalnız bir oxu çərçivəsi istifadə olunur və bu, çox vaxt ən uzun açıq oxu çərçivəsidir. Açıq oxu çərçivəsi məlum olduqdan sonra DNT ardıcıllığı onun müvafiq amin turşusu ardıcıllığına çevrilə bilər. Açıq oxu çərçivəsi əksər növlərdə atg (Met) ilə başlayır və dayanma kodonu ( taa , tag və ya tga ) ilə bitir.

Məsələn, aşağıdakı DNT ardıcıllığı altı oxu çərçivəsində oxuna bilər. Üçü irəli, üçü isə əks istiqamətdə. İrəli istiqamətdə üç oxu çərçivəsi hər bir DNT ardıcıllığının altında tərcümə edilmiş amin turşuları ilə göstərilir. Çərçivə 1 " a ", Çərçivə 2 " t " və Çərçivə 3 " g " ilə başlayır. Stop kodonları zülal ardıcıllığında " * " işarəsi ilə göstərilir. Ən uzun ORF 1-ci çərçivədədir.


5' 3'
atg cccaagctgaatagcgtagaggggttttttcatcatttgaggacgatgta taa

1 a tg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag gac gat gta taa
M P K L N S V E G F S F E D D V *
2 t gc cca agc tga ata gcg tag agg ggt ttt pişik pişik ttg agg acg atg tat
C P S * I A * R G F H H L R T M Y
3 g cc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gga cga tgt ata
A Q A E * R R G V F I I * G R C I

DNT ardıcıllığını tərcümə etmək üçün Biology Workbench-də SIXFRAME adlı proqramdan istifadə edirik. Və ya birbaşa http://searchlauncher.bcm.tmc.edu/seq-util/Options/sixframe.html saytına daxil ola bilərsiniz.


1. Biology Workbench-ə daxil olun və Davam edin və ya Yeni Sessiya Yaradın.

2. Nukleik Alətlər seçin və sonra faylın yanındakı qutuyu qeyd etməklə tərcümə etmək istədiyiniz ardıcıllığı seçin.

3. SIXFRAME seçin və sonra Run seçin.

4. Sizə müxtəlif parametrləri seçməyinizi xahiş edən bir qutu veriləcək. Defolt bütün DNT ardıcıllığının bütün altı oxu çərçivəsini tərcümə etməkdir. Əgər siz ``Ən uzun açıq oxu çərçivəsini göstər'i seçsəniz, proqram avtomatik olaraq başlanğıc kodonu (ATG) ilə başlayan və dayanma kodonu (TAA, TAG və ya TGA) ilə bitən ən uzun oxu çərçivəsini seçəcək. Bu, çox əlverişlidir.

5. Parametrlər seçildikdən sonra Göndər seçin.

  1. Bütün altı oxu çərçivəsi göstəriləcək. Stop kodonları ulduz işarəsi (*) ilə göstəriləcək.
  2. Səhifənin aşağı hissəsində siz ``Ən uzun ORF"-ni görəcəksiniz. DNT-nin bu tərcüməsini idxal etmək üçün hər oxu çərçivəsinin yanındakı bütün digər xanaları klikləyin və seçilmiş ən uzun ORF-nin yanındakı xananı buraxın. Sonra Import seçin. Ardıcıllıq.
  3. Tərcümə edilmiş amin turşusu ardıcıllığı ilə yeni fayl Protein Alətləri altında görünəcək.


Fon

Psevdogenlər, çərçivəni pozan mutasiyalar və ya transkripsiyanın susdurulması səbəbindən qüsurlu olduğu düşünülən gen nüsxələridir [1, 2]. İnsan psevdogenlərinin əksəriyyəti (72%) LINE-1 retrotranspozonu ilə kodlanmış zülalların vasitəçiliyi ilə işlənmiş mRNT-lərin retrotranspozisiyasından əldə edilir [3, 4]. Valideyn itkisinə görə cis-tənzimləyici elementlər, işlənmiş psevdogenlər əvvəlcə transkripsiya baxımından səssiz hesab olunurdu [1] və genom üzrə funksional ekranlardan və əksər transkriptom analizlərindən [2] xaric edilirdi. Xərçəngin [5] və normal insan toxumalarının [6] yüksək məhsuldarlıqlı qısa oxu ardıcıllığı ilə transkriptomik tədqiqatları psevdogen transkripsiyasının geniş yayıla biləcəyini göstərir. Bununla belə, psevdogen transkripsiyasının tədqiqatlarına qısa oxunan ardıcıllığın və mikroarray hibridləşməsinin məhdud imkanları mane olur, psevdogenləri çox oxşar ana genlərindən ayırmaq üçün [2, 7]. Bu günə qədər tapılan tam uzunluqlu psevdogen transkriptlərinin əksəriyyəti tam uzunluqlu cDNT kitabxanalarının nisbətən aşağı ötürmə qabiliyyətinə malik kapilyar ardıcıllığı ilə müəyyən edilmişdir [8,9,10]. Nəticədə, əksər məkan-zaman kontekstlərində insan psevdogen transkriptomunun miqyası əsasən həll olunmamış qalır.

Psevdogen transkriptləri rəqabət qabiliyyətli endogen RNT-lər [11] (ceRNA-lar), antisens transkriptləri [12], kiçik müdaxilə edən RNT-lər üçün prekursorlar [13, 14] (siRNA-lar) və piwi-qarşılıqlı RNT-lər [15] kimi çıxış edərək ana genlərinin ifadəsini idarə edə bilirlər. ] (piRNA). Psevdojenlərin əksəriyyətinin kodlaşdırılmayan mexanizmlərlə hərəkət etdiyi güman edilsə də, bəziləri tam uzunluqlu və ya kəsilmiş zülalları kodlaşdırmaq qabiliyyətini saxlayır [16,17,18,19].


Açıq oxu çərçivələri və kodlaşdırma ardıcıllığı (CDS), bunlar fərqlidirmi? - Biologiya

ORF (Open Reading Frame) ən yaxşı şəkildə zülal kodlaşdırma bölgəsinin fərziyyəsi kimi görünür. Bu başlanğıc kodonu ilə növbəti dayanacaq kodonu arasındakı DNT uzantısıdır. Bu, eukariotlarda (intronlara görə) bütün zülal kodlaşdırma bölgəsinin hipotezi deyil. CDS bütün kodlaşdırma bölgəsi olmalıdır.

Hər iki start/stop 'kodonları' sadəcə ola bilər təsadüfi əslində heç bir zülal üçün kodlaşdırmayan intergenik bölgədə tapılır - buna görə də hər ORF zülal demək deyil. Zülal kodlayan genin faktiki başlanğıc kodonu ilə növbəti dayanacaq kodonu arasında ORF tapılacaq. Tamamilə mümkündür ki, bu stop-kodon intronda tapılsın, bu halda ORF-ə ekson və intronun bir hissəsi daxildir. İntronlar əsasən təsadüfi ardıcıllıq olduğundan stop kodonu təsadüfən baş verə bilər. Təsadüfən intronda stop 'kodon' yoxdursa (yəni, eksonla eyni oxu çərçivəsində 3 nukleotid TAA/TAG/TGA), onda ORF stop kodonuna rast gələnə qədər davam edəcək - ya təsadüfi olaraq növbəti intronda, başqa genin sonunda əsl dayanma.

Dayanmadan intron olarsa yox 3 nukleotidin çoxluğu, sonra bir çərçivə dəyişikliyi təqdim edəcək və növbəti dayanma növbəti ekzonda asanlıqla baş verə bilər. Əgər o, 3-ün qatıdırsa, o, introndan və ekzondan keçərək ORF-yə yalançı amin turşularını daxil edəcək. Gen annotasiyasında bu cür səhvlər qeyri-adi deyil, çünki intron aşkarlanması mürəkkəbdir və əgər o, cDNT ardıcıllığı genom ardıcıllığı ilə müqayisə edilənə qədər intron "oxuyarsa" qeyd olunmaya bilər.

Bu fikirlərin nümayişini görmək istəyirsinizsə, GenBank-dan 5'-UTR, ekzonlar, intronlar, 3'UTR ardıcıllığı olan bir gen üçün ardıcıllıq əldə etməyə çalışın. CDS belə şərh ediləcək və sadəcə ekzonik bölgələr olacaq. Bu gen ardıcıllığını götürün və bütün potensial ORF-ləri təsvir edəcək NCBI ORF-Finder istifadə edin. Bunların hamısı deyil, bəziləri faktiki kodlaşdırma hissələri olacaq.


TƏRCÜMƏ : DNT Zülal

SAYTLAR: Bütün altı oxu çərçivələrində tərcümə etməyə imkan verən bir sıra əla saytlar mövcuddur. Ardıcıllığınızdakı genləri müəyyən etməkdə ciddi maraqlanırsınızsa, vizualları və Pipeline və ya GeneMark sayəsində "ORF Finder"-ni tövsiyə edərdim. Son iki proqram uzun ardıcıllıqların təhlilinə icazə verir (qutuda olmayan əlavə ilə təqdim edin).

Frameshift səhvləri:

AMIGen
yol :: zülalın geri tərcüməsi və uyğunlaşdırılması - fərqliliyin çərçivə dəyişikliyi mutasiyalarının və əvəzetmələrinin nəticəsi olduğu uzaq protein homologiyalarının tapılması problemini həll edir. İki giriş zülal ardıcıllığını nəzərə alaraq, metod hər bir zülal üçün ehtimal olunan DNT ardıcıllığının tam dəstinin yaddaşdan səmərəli qrafik təsvirlərini manipulyasiya etməklə onları kodlayan DNT ardıcıllığının bütün mümkün cütlərini gizli şəkildə uyğunlaşdırır. (İstinad: Gîrdea M et al. 2010. Molekulyar Biologiya üçün Alqoritmlər 5:)

Sadə tərcümə vasitələri - DNT-dən zülal ardıcıllığına:

Oxu çərçivə tapıcısını açın (NCBI) - daxil etdiyiniz DNT ardıcıllığında açıq oxu çərçivələrini (ORF) axtarır. Proqram, protein tərcüməsi ilə birlikdə hər bir ORF-nin diapazonunu qaytarır. Potensial zülal kodlaşdırma seqmentləri üçün yeni ardıcıllaşdırılmış DNT-ni axtarmaq üçün ORF tapıcıdan istifadə edin, yeni hazırlanmış SMART BLAST və ya adi BLASTP istifadə edərək proqnozlaşdırılan zülalı yoxlayın.

Altı çərçivəli tərcümələr Tuebingen, Rusiya, Bioline və Science Launcher-də edilə bilər.

EMBOSS Sixpack (EMBL-EBI) - DNT ardıcıllığını oxuyur və vizual şəkildə üç irəli və (istəyə görə) üç tərs tərcüməni çıxarır. Alternativ olaraq EMBOSS Transeq istifadə edin

MBS Tərcüməçi (JustBio Alətləri) - Mükəmməl yeni sayt, çünki xüsusi olaraq ATG-dən tərcümə oluna bilər və nəticələr amin turşusu ardıcıllığını örtən nukleotid ardıcıllığı ilə təqdim olunur. Əlyazmaya Kəsmək/Yapışdırmaq üçün idealdır. Bu pulsuz alətdən istifadə etmək üçün qeydiyyatdan keçməlisiniz. Digər sürətli tərcümə vasitələri burada və buradadır.

Tərcümə etmək (ExPASy, İsveçrə) - nukleotid (DNT/RNT) ardıcıllığının zülal ardıcıllığına çevrilməsinə imkan verən alətdir.

DNT-dən protein tərcüməsi (Bask Ölkəsi Universiteti, İspaniya) və burada.

Çox ardıcıllığın tərcüməsi:

Virtual Ribosom ( İstinad: R. Wernersson. 2006. Nucl. Acids Res. 34 (veb Server Məsələsi): W385-388) - İlk iki saytın çıxışının çoxlu DNT ardıcıllığını tərcümə etmək üçün optimal olduğunu görürəm.

RevTrans 1.4 Server (CBS, Danimarka Texniki Universiteti)

TranslatorX - zülal kodlayan nukleotid ardıcıllığını onların müvafiq amin turşularının tərcümələrinə əsaslanaraq uyğunlaşdırmaq üçün nəzərdə tutulmuş veb serverdir. TranslatorX yeniliklərinə aşağıdakılar daxildir: (i) bütün sənədləşdirilmiş genetik kodların istifadəsi və hər ardıcıllıq üçün müxtəlif genetik kodların təyin edilməsi imkanı (ii) müxtəlif çoxsaylı uyğunlaşdırma proqramlarının batareyası (iii) mümkün olduqda qeyri-müəyyən kodonların tərcüməsi (iv) yenilikçi meyar zülal məlumatlarına əsaslanan GBlocks ilə təmiz nukleotid düzülmələri və (v) zəngin çıxış, o cümlədən düzülmələrin Jalview ilə təchiz edilmiş qrafik vizualizasiyası, uyğun amin turşularına görə rənglənmiş kodon əsaslı düzülmələr, kompozisiya meylinin ölçüləri və birinci, ikinci və üçüncü kodon mövqeyə xüsusi uyğunlaşmalar. (İstinad: Abascal F, et al. (2010) Nucleic Acids Res. 38: W7-13).


Açıq Oxu çərçivələri və kodlaşdırma ardıcıllığı (CDS), bunlar fərqlidirmi? - Biologiya

Yığılmış genomların strukturu, montaj adları və digər meta-məlumatlar, statistik hesabatlar və genomik ardıcıllıq məlumatlarına keçidlər haqqında məlumat verən verilənlər bazası.

Mədəniyyət kolleksiyaları, muzeylər, herbariya və digər təbiət tarixi kolleksiyaları üçün seçilmiş metadata toplusu. Qeydlərdə kolleksiya kodları, kolleksiyaların ev institutları haqqında məlumat və NCBI-da müvafiq məlumatlara keçidlər göstərilir.

Genomika, funksional genomika və genetika tədqiqatlarının toplusu və onların əldə edilən məlumat dəstlərinə keçidlər. Bu resurs layihənin əhatə dairəsini, materialını və məqsədlərini təsvir edir və uyğunsuz annotasiya, çoxsaylı müstəqil təqdimatlar və tez-tez müxtəlif verilənlər bazalarında saxlanılan müxtəlif məlumat növlərinin müxtəlif təbiəti səbəbindən tapmaq çox vaxt çətin olan məlumat dəstlərini əldə etmək mexanizmini təmin edir.

BioSample verilənlər bazası eksperimental analizlərdə istifadə olunan bioloji mənbə materiallarının təsvirlərini ehtiva edir.

Biotibbi ədəbiyyatı, kiçik molekulları və ardıcıllığı bioloji əlaqələr baxımından qruplaşdıran verilənlər bazası.

Birbaşa və ya digər NCBI verilənlər bazalarında əlaqəli məlumatlardan axtarıla bilən biotibbi kitablar toplusu. Kolleksiyada biotibbi dərsliklər, digər elmi adlar, genetik resurslar kimi GeneReviewsvə NCBI yardım kitabçaları.

İnsan dəyişkənliyi və müşahidə olunan sağlamlıq vəziyyəti arasında hesabat edilmiş əlaqələrin ictimai, izlənilən qeydini dəstəkləyici sübutlarla təmin etmək üçün resurs. NIH Genetic Testing Registry (GTR), MedGen, Gene, OMIM, PubMed və digər mənbələrdəki əlaqəli məlumatlara qeydlərdəki hiperlinklər vasitəsilə daxil olmaq mümkündür.

Bütün dünyada aparılan insan iştirakçılarının ictimai və özəl olaraq dəstəklənən klinik tədqiqatlarının reyestri və nəticələri bazası.

NCBI Hesablama Biologiyası Bölməsinin (CBB) Struktur Qrupu tərəfindən hazırlanmış resurslara giriş və keçidləri təmin edən mərkəzləşdirilmiş səhifə. Bu resurslar makromolekulyar strukturların, qorunan domenlərin və zülalların təsnifatının, kiçik molekulların və onların bioloji aktivliyinin, bioloji yolların və sistemlərin öyrənilməsində kömək etmək üçün verilənlər bazası və alətləri əhatə edir.

Ardıcıl olaraq qeyd edilmiş və yüksək keyfiyyətli insan və siçan zülal kodlaşdırma bölgələrinin əsas dəstini müəyyən etmək üçün birgə səy.

Molekulyar təkamüldə qorunan zülal sahələrini təmsil edən ardıcıl düzülmələr və profillər toplusu. O, həmçinin MMDB verilənlər bazasında domenlərin məlum 3 ölçülü protein strukturlarına uyğunlaşdırılmasını da əhatə edir.

dbVar verilənlər bazası geniş miqyaslı genomik variasiya ilə əlaqəli məlumatları arxivləşdirmək üçün hazırlanmışdır, o cümlədən böyük əlavələr, silinmələr, translokasiyalar və inversiyalar. Variasiya kəşfinin arxivləşdirilməsi ilə yanaşı, dbVar həmçinin müəyyən edilmiş variantların assosiasiyalarını fenotip məlumatı ilə saxlayır.

Genotip və fenotipin qarşılıqlı əlaqəsini araşdıran tədqiqatların təsviri və nəticələri üçün arxiv və paylama mərkəzi. Bu tədqiqatlara genom boyu assosiasiya (GWAS), tibbi təkrarlama, molekulyar diaqnostik analizlər, həmçinin genotip və qeyri-klinik əlamətlər arasında əlaqə daxildir.

Tək nukleotid variasiyaları, mikrosatellitlər və kiçik miqyaslı əlavələr və silinmələr daxildir. dbSNP həm neytral variasiyalar, həm də klinik mutasiyalar üçün populyasiyaya xas tezlik və genotip məlumatlarını, eksperimental şərtləri, molekulyar kontekstləri və xəritəçəkmə məlumatlarını ehtiva edir.

NIH genetik ardıcıllıq verilənlər bazası, ictimaiyyətə açıq olan bütün DNT ardıcıllıqlarının şərh edilmiş toplusu. GenBank, Yaponiyanın DNT DataBankı (DDBJ), Avropa Molekulyar Biologiya Laboratoriyası (EMBL) və NCBI-da GenBankdan ibarət Beynəlxalq Nukleotid Ardıcıllığı Verilənlər Bazasının Əməkdaşlığının bir hissəsidir. Bu üç təşkilat gündəlik olaraq məlumat mübadiləsi aparır. GenBank bir neçə bölmədən ibarətdir və onların əksəriyyətinə Nukleotid verilənlər bazası vasitəsilə daxil olmaq olar. İstisnalar müvafiq olaraq Nucleotide EST və Nucleotide GSS verilənlər bazası vasitəsilə əldə edilən EST və GSS bölmələridir.

Tamamilə ardıcıllaşdırılmış genomlara diqqət yetirən və genə xüsusi məlumat vermək üçün aktiv tədqiqat cəmiyyətinə sahib olan genlərin axtarış edilə bilən verilənlər bazası. Məlumata nomenklatura, xromosom lokalizasiyası, gen məhsulları və onların atributları (məsələn, zülallarla qarşılıqlı əlaqə), əlaqəli markerlər, fenotiplər, qarşılıqlı təsirlər və sitatlar, ardıcıllıqlar, variasiya təfərrüatları, xəritələr, ifadə hesabatları, homoloqlar, zülal domeninin məzmunu və xarici verilənlər bazalarına keçidlər daxildir. .

MIAME uyğun məlumat təqdimatını dəstəkləyən ictimai funksional genomik məlumat anbarı. Massiv və ardıcıllığa əsaslanan məlumatlar qəbul edilir və istifadəçilərə eksperimentləri və seçilmiş gen ifadəsi profillərini sorğulamağa və endirməyə kömək etmək üçün alətlər təqdim olunur.

Gen İfadəsi Omnibus (GEO) deposundan yığılmış, seçilmiş gen ifadəsini və molekulyar bolluq DataSetlərini saxlayır. DataSet qeydləri çoxluq alətləri və diferensial ifadə sorğuları da daxil olmaqla əlavə resursları ehtiva edir.

Gene Expression Omnibus (GEO) repozitoriyasından yığılmış fərdi gen ifadəsini və molekulyar bolluq profillərini saxlayır. Gen annotasiyasına və ya əvvəlcədən hesablanmış profil xüsusiyyətlərinə əsaslanan xüsusi maraq profillərini axtarın.

Xüsusi irsi şərtləri olan xəstələrin və ailələrin diaqnostikası, idarə edilməsi və genetik məsləhəti üçün genetik testi tətbiq edən NCBI Bookshelf-də ekspert tərəfindən yazılmış, ekspert tərəfindən nəzərdən keçirilmiş xəstəlik təsvirləri toplusu.

Əsas mutasiya(lar)ın və klinik xüsusiyyətlərin müzakirəsi ilə seçilmiş genetik pozğunluqlar üçün məlumatların xülasəsi, həmçinin əlaqəli verilənlər bazası və təşkilatlara keçidlər.

Nə ölçüldüyü, analitik və klinik etibarlılıq kimi testlər haqqında ətraflı məlumatla birlikdə genetik testlərin və laboratoriyaların könüllü reyestri. GTR həmçinin genetik şərtlər haqqında məlumat üçün əlaqədir və təcrübə təlimatları, nəşr olunmuş ədəbiyyat və genetik məlumat/məlumat da daxil olmaqla müxtəlif resurslara kontekstdə xüsusi bağlantılar təqdim edir. GTR-nin ilkin əhatə dairəsinə Mendel pozğunluqları üçün tək gen testləri, həmçinin massivlər, panellər və farmakogenetik testlər daxildir.

1000-dən çox orqanizmin bütün genomlarından ardıcıllıq və xəritə məlumatlarını ehtiva edir. Genomlar həm tam ardıcıllaşdırılmış orqanizmləri, həm də ardıcıllığı davam edən orqanizmləri təmsil edir. Həyatın hər üç əsas sahəsi (bakteriyalar, arxeyalar və eukariotalar), həmçinin bir çox viruslar, faqlar, viroidlər, plazmidlər və orqanoidlər təmsil olunur.

Genom Referans Konsorsiumu (GRC) insan və siçan istinad genomları üçün məsuliyyət daşıyır. Üzvlər Vaşinqton Universitetindəki Genom Mərkəzi, Wellcome Trust Sanger İnstitutu, Avropa Bioinformatika İnstitutu (EBI) və Milli Biotexnologiya İnformasiya Mərkəzindən (NCBI) ibarətdir. GRC yanlış təqdim edilmiş yerləri düzəltmək və qalan montaj boşluqlarını bağlamaq üçün işləyir. Bundan əlavə, GRC kompleks və ya struktur variantlı genomik lokuslar üçün alternativ birləşmələr təmin etməyə çalışır. GRC saytında (http://www.genomereference.org) ictimaiyyət hazırda nəzərdən keçirilən genomik bölgələrə baxa, genomla bağlı problemləri bildirə və GRC ilə əlaqə saxlaya bilər.

Qlikoinformatika və qlikobiologiya ilə əlaqəli mənbələrə giriş və bağlantılar təmin edən mərkəzləşdirilmiş səhifə.

HİV-1 zülallarının insan sahiblərinin zülalları ilə məlum qarşılıqlı əlaqəsi haqqında məlumat bazası. O, müvafiq PubMed qeydlərinə və ardıcıllıq məlumatlarına bağlantılar ilə zülal qarşılıqlı təsirləri haqqında dərc edilmiş hesabatların şərh edilmiş biblioqrafiyalarını təqdim edir.

GenBank və RefSeq-də şərh edilmiş kodlaşdırma bölgələrində, həmçinin SwissProt və PDB zülal ardıcıllıqlarında müəyyən edilmiş zülalları təsvir edən konsolidasiya edilmiş qeydlər toplusu. Bu resurs tədqiqatçılara daha çox hədəflənmiş axtarış nəticələri əldə etməyə və maraq doğuran zülalı tez müəyyən etməyə imkan verir.

NIAID Qrip Genomu Sequencing Layihəsi və GenBank-dan məlumatların toplusu. O, qrip ardıcıllığının təhlili, annotasiya və GenBank-a təqdim etmək üçün alətlər təqdim edir. Bu resursda həmçinin digər qrip ardıcıllığı resurslarına, qrip virusları haqqında nəşrlərə və ümumi məlumatlara keçidlər var.

PubMed abstraktları da daxil olmaqla NCBI verilənlər bazası qeydlərində istinad edilən jurnallar haqqında məlumat verən NLM Kataloq verilənlər bazasının alt çoxluğu. Bu alt dəst jurnalın adı, MEDLINE və ya ISO abbreviaturası, ISSN və ya NLM Kataloq ID-si ilə axtarıla bilər.

MeSH (Medical Subject Headings) ABŞ Milli Tibb Kitabxanasının MEDLINE/PubMed üçün məqalələrin indeksləşdirilməsi üçün idarə olunan lüğətidir. MeSH terminologiyası eyni anlayışlar üçün müxtəlif terminologiyadan istifadə edə bilən məlumatları əldə etmək üçün ardıcıl bir yol təqdim edir.

Tibbi genetika haqqında məlumat portalı. MedGen bir çox mənbələrdən termin siyahılarını ehtiva edir və onları konsepsiya qruplarına və iyerarxiyalara uyğunlaşdırır. Linklər həmçinin NIH Genetic Testing Registry (GTR), ClinVar, Gene, OMIM, PubMed və digər mənbələrdə həmin anlayışlarla bağlı məlumatlara təqdim olunur.

NCBI C++ alətlər dəsti üzrə hərtərəfli təlimat, o cümlədən onun dizayn və inkişaf çərçivəsi, C++ kitabxanasına istinad, proqram nümunələri və demolar, Tez-tez verilən suallar və buraxılış qeydləri. Təlimat onlayn olaraq axtarıla bilər və onu bir sıra PDF sənədləri kimi yükləmək olar.

Dərsliklərə və təlim materiallarına, o cümlədən PowerPoint slaydlarına və çap materiallarına keçidlər təmin edir.

NCBI Təlimatının bir hissəsi olan bu lüğətdə NCBI alətləri və akronimlərinin təsviri, bioinformatika terminləri və məlumat təqdimetmə formatları var.

NCBI verilənlər bazası və proqram təminatı haqqında geniş məqalələr toplusu. Təcrübəsiz istifadəçi üçün nəzərdə tutulmuş hər bir məqalədə resursun ümumi icmalı və onun dizaynı, həmçinin mövcud analiz alətlərinin axtarışı və istifadəsi üçün məsləhətlər təqdim olunur. Bütün məqalələri onlayn axtarmaq və PDF formatında yükləmək olar, kitabçaya NCBI Bookshelf vasitəsilə daxil olmaq olar.

NCBI Bookshelf vasitəsilə əldə edilən Yardım Təlimatında PubMed, PubMed Central, Entrez sistemi, Gene, SNP və LinkOut daxil olmaqla bir çox NCBI resursları üçün sənədlər var. Bütün fəsilləri PDF formatında yükləmək olar.

Qida, ətraf mühit və xəstə təcridlərindən yaranan bakterial patogen genomik ardıcıllıqların toplanması və təhlilini əhatə edən layihə. Hal-hazırda, avtomatlaşdırılmış boru kəməri qida yoluxucu xəstəliklərin epidemiyalarının araşdırılmasına kömək etmək və qida çirklənməsinin potensial mənbələrini aşkar etmək üçün ilk növbədə ictimai səhiyyə laboratoriyaları tərəfindən təmin edilən ardıcıllıqları birləşdirir və müəyyən edir.

Kitabxananın fondunda olan bütün jurnallar, kitablar, audiovizuallar, kompüter proqramları, elektron resurslar və digər materiallar üçün biblioqrafik məlumatlar.

GenBank, RefSeq, Üçüncü Tərəf Annotasiyası (TPA) verilənlər bazası və PDB daxil olmaqla bir neçə mənbədən nukleotid ardıcıllıqlarının toplusu. Nukleotidlər Bazasının axtarışı onun komponent verilənlər bazalarının hər birindən mövcud nəticələr verəcəkdir.

İnsan genləri və genetik pozğunluqların məlumat bazası. NCBI cari məzmunu saxlayır və axtarışını və digər NCBI verilənlər bazası ilə inteqrasiyasını dəstəkləməyə davam edir. Bununla belə, OMIM-in indi omim.org saytında yeni evi var və istifadəçilər tam rekord nümayişlər üçün bu sayta yönləndirilir.

Müqayisəli tədqiqatlardan yaranan əlaqəli DNT ardıcıllığının verilənlər bazası: filogenetik, populyasiya, ətraf mühit və daha az dərəcədə mutasiya. Verilənlər bazasındakı hər bir qeyd DNT ardıcıllığı toplusudur. Məsələn, populyasiya çoxluğu orqanizm daxilində genetik variasiya haqqında məlumat verir, filogenetik dəst isə bir neçə əlaqəli orqanizmdən alınmış tək genin ardıcıllığını və onların düzülməsini ehtiva edə bilər.

Tam prokaryotik və orqanel plazmidlər və genomlar tərəfindən kodlanmış Referans Ardıcıllıq zülallarından ibarət əlaqəli zülal ardıcıllıqları (klasterlər) toplusu. Verilənlər bazası annotasiya məlumatlarına, nəşrlərə, domenlərə, strukturlara, xarici keçidlərə və təhlil alətlərinə asan girişi təmin edir.

GenPept, RefSeq, Swiss-Prot, PIR, PRF və PDB daxil olmaqla müxtəlif mənbələrdən protein ardıcıllığı qeydlərini ehtiva edən verilənlər bazası.

Ümumi funksiyalı homoloji zülalları təmsil edən modellər toplusunu ehtiva edən verilənlər bazası. Buraya konservləşdirilmiş domen arxitekturası, gizli Markov modelləri və BlastRules daxildir. Bu modellərin bir hissəsi Prokaryotik Genom Annotasiya Boru Kəməri (PGAP) tərəfindən proqnozlaşdırılan zülallara adlar və digər atributlar təyin etmək üçün istifadə olunur.

Depozit edilmiş bioaktivlik məlumatlarından və PubChem Maddələr bazasında olan kimyəvi maddələrin skrininqi üçün istifadə edilən bioaktivlik analizlərinin təsvirlərindən, o cümlədən skrininq proseduruna xas olan şərtlərin və oxunuşların (bioaktivlik səviyyələrinin) təsvirlərindən ibarətdir.

Adlar, sinonimlər və ya açar sözlərdən istifadə etməklə axtarıla bilən unikal, təsdiqlənmiş kimyəvi strukturları (kiçik molekullar) ehtiva edir. Fərqli əmanətçilər eyni strukturu təmin edərsə, mürəkkəb qeydlər birdən çox PubChem Substance qeydinə bağlana bilər. Bu Mürəkkəb qeydlər PubChem Maddəsindəki maddələri təsvir etmək üçün təqdim edilən təsdiqlənmiş kimyəvi təsvir məlumatlarını əks etdirir. PubChem Compounds daxilində saxlanılan strukturlar əvvəlcədən qruplaşdırılıb və eynilik və oxşarlıq qrupları tərəfindən çarpaz istinad edilir. Bundan əlavə, kimyəvi strukturların axtarışı və filtrasiyası üçün hesablanmış xassələr və deskriptorlar mövcuddur.

PubChem Maddə qeydləri əmanətçilər tərəfindən PubChem-ə elektron şəkildə təqdim edilən maddə məlumatlarını ehtiva edir. Buraya təqdim edilən hər hansı kimyəvi struktur məlumatı, həmçinin kimyəvi adlar, şərhlər və əmanətçinin veb saytına keçidlər daxildir.

MEDLINE və əlavə həyat elmi jurnallarından biotibbi ədəbiyyat üçün sitatlar və abstraktlar bazası. Məqalələrin tam mətn versiyaları PubMed Central (aşağıda təsvir edilmişdir) və ya digər internet saytları vasitəsilə mövcud olduqda keçidlər verilir.

Klinik tibb və ictimai səhiyyə daxil olmaqla, tam mətnli biotibbi və həyat elmləri jurnal ədəbiyyatının rəqəmsal arxivi.

RefSeqGene İnsan geninə xas istinad genomik ardıcıllıqlarının toplusu. RefSeq geni NCBI-nin RefSeq verilənlər bazasının alt çoxluğudur və lokalizasiyaya aid verilənlər bazası kuratorlarının və genetik test icmasının rəyi əsasında müəyyən edilir. Onlar mutasiyalar barədə məlumat vermək, ardıcıl intron və ekzon nömrələmə konvensiyalarını qurmaq və digər bioloji əhəmiyyətli variasiyaların koordinatlarını təyin etmək üçün sabit əsas yaradır. RefSeqGene Locus Reference Genomik (LRG) Əməkdaşlığının bir hissəsidir. İstinad ardıcıllığı (RefSeq)

NCBI tərəfindən hazırlanmış, seçilmiş, lazımsız genomik DNT, transkript (RNT) və zülal ardıcıllıqlarının toplusu. RefSeqs genom annotasiyası, gen identifikasiyası və xarakteristikası, mutasiya və polimorfizm təhlili, ekspressiya tədqiqatları və müqayisəli təhlillər üçün sabit istinad təmin edir. RefSeq kolleksiyasına Nukleotid və Protein verilənlər bazası vasitəsilə daxil olmaq mümkündür.

Sorğu ardıcıllığının genotipini müəyyən etmək üçün BLAST alqoritmindən istifadə edən genotipləmə aləti, çoxsaylı ardıcıllığın qlobal uyğunlaşdırılması üçün uyğunlaşdırma aləti, HİV-1 avtomatik ardıcıllıqla annotasiya aləti və annotasiya edilmiş xəritələr daxil olmaqla retrovirusların tədqiqini dəstəkləmək üçün xüsusi hazırlanmış resurslar toplusu GenBank, FASTA və qrafik formatlarda görünə bilən çoxsaylı retroviruslar, əlaqəli ardıcıllıq qeydlərinə keçidlər.

SARS koronavirusu (CoV) üçün məlumatların xülasəsi, o cümlədən ən son ardıcıllıq məlumatlarına və nəşrlərə bağlantılar, SARS ilə əlaqəli digər mənbələrə keçidlər və müxtəlif izolatlardan genom ardıcıllığının əvvəlcədən hesablanmış uyğunlaşdırılması.

Sequence Read Arxive (SRA) Roche 454 GS System®, Illumina Genome Analyzer®, Life Technologies AB SOLiD System®, Helicos Biosciences Heliscope®, Complete Genomics® və Pacific SMRT®ence daxil olmaqla, növbəti nəsil ardıcıllıq platformalarından ardıcıllıq məlumatlarını saxlayır. .

Zülal Məlumat Bankından əldə edilən makromolekulyar 3D strukturları, həmçinin onların vizuallaşdırılması və müqayisəli təhlili üçün alətləri ehtiva edir.

NCBI verilənlər bazasında molekulyar məlumatları olan 160.000-dən çox orqanizmin adlarını və filogenetik nəsillərini ehtiva edir. Yeni taksonlar Taksonomiya verilənlər bazasına əlavə olunur, çünki onlar üçün məlumatlar saxlanılır.

GenBank-da mövcud ilkin ardıcıllıq məlumatlarından qurulmuş ardıcıllıqları ehtiva edən verilənlər bazası. Ardıcıllıqlar və müvafiq qeydlər eksperimental olaraq dəstəklənir və nəzərdən keçirilən elmi jurnalda dərc edilmişdir. TPA qeydləri Nukleotidlər Bazası vasitəsilə əldə edilir.

Müxtəlif geniş miqyaslı ardıcıllıq layihələrindən tək keçidli oxunuşlar üçün DNT ardıcıllığı xromatoqramlarının (izlərinin), əsas çağırışların və keyfiyyət təxminlərinin deposu.

Virusların biologiyasının qısa xülasəsi, Entrez Genome-də viral genom ardıcıllığına keçidlər və minlərlə viral genom üçün istinad ardıcıllıqlarının toplusu olan viral Referans Ardıcıllıqları haqqında məlumat daxil olmaqla geniş çeşidli resurslar.

Qrip Virus Resursunun digər orqanizmlər üçün genişləndirilməsi, seçilmiş virusların ardıcıl dəstlərini, analiz alətlərini, o cümlədən virusa məxsus BLAST səhifələrini və genom annotasiya boru kəmərlərini yükləmək üçün interfeys təmin edir.

Yükləmələr

Yerli istifadə üçün BLAST icra sənədləri Solaris, LINUX, Windows və MacOSX sistemləri üçün təmin edilmişdir. Əlavə məlumat üçün ftp qovluğunda README faylına baxın. BLAST nukleotid, zülal və tərcümə edilmiş axtarışlar üçün əvvəlcədən formatlaşdırılmış verilənlər bazaları da db alt kataloqu altında yükləmək üçün mövcuddur.

Müstəqil BLAST proqramları ilə istifadə etmək üçün verilənlər bazalarını sıralayın. Bu kataloqdakı fayllar BLAST ilə istifadəyə hazır olan əvvəlcədən formatlaşdırılmış verilənlər bazalarıdır.

Bu sayt CDD üçün tam məlumat qeydlərini, fərdi Mövqe Xüsusi Qiymətləndirmə Matrisləri (PSSMs), mFASTA ardıcıllıqları və qorunan hər bir domen üçün annotasiya məlumatları ilə birlikdə təmin edir. Tam təfərrüatlar üçün README faylına baxın.

Bu sayt XML-də tam məlumat çıxarılmasını və VCF formatında xülasə məlumatları təqdim edir. O, ClinVar, MedGen və GTR-də istifadə olunan standart şərtlər haqqında məlumatı ehtiva edən fayllardan ibarətdir.

Müstəqil BLAST proqramları ilə istifadə üçün FASTA formatında verilənlər bazalarını sıralayın. Bu verilənlər bazaları BLAST ilə istifadə edilməzdən əvvəl formatdb istifadə edərək formatlaşdırılmalıdır.

Bu saytda standart düz fayl formatında GenBank-da bütün ardıcıllıq qeydləri üçün fayllar var. Fayllar GenBank bölməsi tərəfindən təşkil edilir və tam məzmun README.genbank faylında təsvir olunur.

GenBank-da kodlaşdırma ardıcıllığının (CDS) tərcümələrinə uyğun zülal ardıcıllıqları hər GenBank buraxılışı üçün toplanır.. Əlavə məlumat üçün kataloqda README faylına baxın.

Bu saytda üç kataloq var: DATA, GeneRIF və alətlər. DATA kataloqu Gen qeydləri üçün ASN.1 məlumatını ehtiva edən alt kataloqlarla yanaşı, GeneID-lərlə əlaqəli bütün məlumatları siyahıya alan faylları ehtiva edir. GeneRIF (Funksiyaya Gen İstinadları) kataloqu tək bir genin funksiyasını və ya iki genin məhsulları arasında qarşılıqlı əlaqəni təsvir edən məqalələr üçün PubMed identifikatorlarını ehtiva edir. Gen məlumatlarını manipulyasiya etmək üçün nümunə proqramlar alətlər kataloqunda təqdim olunur. Təfərrüatlar üçün README faylına baxın.

Bu sayt iki formatda GEO məlumatlarını ehtiva edir: SOFT (Mətn Formatında Sadə Omnibus) və MINiML (İşarələmə Dilində MIAME Notasiyası). Xülasə mətn faylları və əlavə məlumatlar da mövcuddur. Əlavə məlumat üçün README.TXT faylına baxın.

Bu sayt Entrez Genomunda olan orqanizmlər üçün genom ardıcıllığı və xəritəçəkmə məlumatlarını ehtiva edir. Məlumatlar tək növlər və ya növlər qrupları üçün kataloqlarda təşkil edilir. Xəritəçəkmə məlumatları MapView kataloqunda toplanır və növlərə görə təşkil edilir. Ətraflı məlumat üçün kök kataloqdakı README faylına və növ alt kataloqlarındakı README fayllarına baxın.

Bu genomun cari və əvvəlki quruluşları üçün mövcud xəritələşdirmə məlumatlarını ehtiva edən hər bir genom üçün kataloqları ehtiva edir.

Bu saytda nukleotid və zülal ardıcıllığı qeydlərini onların taksonomiya identifikatorları ilə əlaqələndirən fayllarla birlikdə tam taksonomiya verilənlər bazası var. Ətraflı məlumat üçün taxdump_readme.txt və gi_taxid.readme fayllarına baxın.

Bu sayt ftp vasitəsilə yükləmək üçün PubChem Substance, Compound və Bioassay verilənlər bazalarından məlumatları təqdim edir. Verilənlər bazalarının tam yükləmələri Substance və Compound üçün gündəlik, həftəlik və aylıq yeniləmələrlə birlikdə mövcuddur. Maddə və Mürəkkəb məlumatlar ASN.1, SDF və XML formatlarında təqdim olunur. Əlavə məlumat üçün README fayllarına baxın.

Bu sayt Referans Sequence (RefSeq) kolleksiyasındakı bütün nukleotid və zülal ardıcıllığı qeydlərini ehtiva edir. Seçilmiş orqanizmlər (insan, siçan və siçovul kimi) üçün məlumatlar ayrı-ayrı kataloqlarda olduğu halda, ""release"" kataloqu tam kolleksiyanın ən son buraxılışını ehtiva edir. Məlumatlar FASTA və düz fayl formatlarında mövcuddur. Ətraflı məlumat üçün README faylına baxın.

Bu sayt ASN.1, XML və EasySKYCGH formatlarında SKY-CGH məlumatlarını ehtiva edir. Əlavə məlumat üçün skycghreadme.txt faylına baxın.

SNP üçün endirilə bilən məlumatlar.

Bu sayt təqdim edilmiş ardıcıllıq layihəsi tərəfindən təşkil edilmiş növbəti nəsil ardıcıllıq məlumatlarını ehtiva edir.

NCBI verilənlər bazası, alətlər və kommunal proqramlar üçün FTP yükləmə saytı.

Bu sayt VAST uyğunlaşdırma məlumatları və lazımsız PDB (nr-PDB) məlumat dəstləri ilə birlikdə MMDB-dəki bütün qeydlər üçün ASN.1 datasını ehtiva edir. Əlavə məlumat üçün README faylına baxın.

Bu sayt növlər üzrə təşkil edilmiş iz xromatoqramma məlumatlarını ehtiva edir. Məlumatlara xromatoqramma, keyfiyyət balları, avtomatik əsas zənglərdən FASTA ardıcıllıqları və nişanla ayrılmış mətndə, eləcə də XML formatlarında digər köməkçi məlumatlar daxildir. Ətraflı məlumat üçün README faylına baxın.

Bu saytda FASTA formatında UniVec və UniVec_Core verilənlər bazası var. Ətraflı məlumat üçün README.uv faylına baxın.

Bu sayt 4 rəqəmli layihə kodu ilə təşkil edilmiş bütün genom ov tüfəngi ardıcıllığı məlumatlarını ehtiva edir. Məlumatlara GenBank və GenPept düz faylları, keyfiyyət balları və ümumi statistika daxildir. Əlavə məlumat üçün README.genbank.wgs faylına baxın.

Açıq giriş məlumatlarına ümumiyyətlə genotip/fenotip assosiasiyası tədqiqatlarının xülasəsi, ölçülən dəyişənlərin təsvirləri və protokol və sorğu vərəqləri kimi tədqiqat sənədləri daxildir. Fərdi səviyyəli məlumatlara, o cümlədən fenotipik məlumat cədvəllərinə və genotiplərə giriş müxtəlif səviyyələrdə icazə tələb edir.

NLM MEDLINE/PubMed-i ABŞ fərdlərinə və ya təşkilatlarına icarəyə verir.

ASN.1 və ya DTD formatında NCBI məlumatları üçün spesifikasiyalar data_specs İndeksi səhifəsində mövcuddur. "NCBI_data_conversion.html" çevrilmə alətinə keçid verir.

Jurnal məqalələrinin müəllifi və arxivləşdirilməsi, habelə jurnal məqalələrinin nəşriyyatlardan arxivlərə və arxivlər arasında ötürülməsi üçün etiket dəstləri dəsti. Dörd teq dəsti var: Arxivləşdirmə və Mübadilə Teqləri Seti - Arxivin mövcud çap edilmiş və etiketlənmiş jurnal materialının struktur və semantik komponentlərini mümkün qədər rahat şəkildə ələ keçirmək üçün yaradılmışdır. və onların məzmununa nəzarət edin, hər hansı xüsusi naşir tərəfindən onlara təqdim olunan ardıcıllığı və nizamı qəbul etməmək üçün Məqalə Müəllifi Etiket Seti - Yeni jurnal məqalələrinin müəllifi üçün nəzərdə tutulub.

Bu xidmət istifadəçilərə əl ilə və ya mətn faylı vasitəsilə təmin edilə bilən PubChem identifikatorları dəstinə uyğun olan birləşmə və ya maddə qeydlərini endirməyə imkan verir. SDF, XML və SMILES daxil olmaqla çoxsaylı yükləmə formatları mövcuddur.

PMC Open Access Subset PMC-dəki məqalələrin ümumi kolleksiyasının nisbətən kiçik bir hissəsidir. PMC-dəki məqalələrin əksəriyyəti ənənəvi müəllif hüquqları məhdudiyyətlərinə məruz qaldığı halda, bu məqalələr müəllif hüquqları ilə qorunur, lakin Creative Commons və ya oxşar lisenziya əsasında təqdim olunur ki, bu da adətən ənənəvi müəllif hüququndan daha liberal yenidən bölüşdürülməyə və təkrar istifadəyə imkan verir. Xüsusi istifadə şərtləri üçün hər bir məqalədəki lisenziya bəyanatına baxın.

NCBI resursları haqqında yeniliklər üçün Veb/RSS lentlərinə abunə olun.

Təqdimatlar

Tədqiqatçılar, konsorsiumlar və təşkilatlar üçün BioLayihələrini qeydiyyatdan keçirmələri üçün interfeys təqdim edən onlayn forma. Bu, tədqiqat üçün genomik və genetik məlumatların təqdim edilməsi üçün başlanğıc nöqtəsi kimi xidmət edir. BioProject qeydiyyatı zamanı məlumatların təqdim edilməsinə ehtiyac yoxdur.

İnsan genetik variantlarının patogenliyi haqqında iddiaların təqdim edilməsi üçün təlimatlar və təlimatlar. Bu təqdimatlar işlənmə mərhələsində olan variant (variant səviyyəsi/məcmu data) üzrə hər bir iş üzrə variantlar üçün dəstək (iş səviyyəsi) haqqında xülasə məlumatları daxil edə bilər.

Genotip və fenotip assosiasiya məlumatlarını dbGaP-ə təqdim etmək üçün təlimatlar və tələblər.

GenBank verilənlər bazasına bir və ya bir neçə təqdimetmə üçün veb-əsaslı ardıcıllıqla təqdimetmə vasitəsi, təqdimetmə prosesini tez və asan etmək üçün nəzərdə tutulmuşdur.

Növlərin identifikasiyasında istifadə üçün standart genetik lokusdan Barkod qısa nukleotid ardıcıllığının GenBank məlumat bazasına təqdim edilməsi üçün alət.

İctimai ardıcıllıq verilənlər bazalarına (GenBank, EMBL və ya DDBJ) daxiletmələrin təqdim edilməsi və yenilənməsi üçün NCBI tərəfindən hazırlanmış müstəqil proqram aləti. O, tək qısa mRNT ardıcıllığını, uzun ardıcıllıqları, çoxlu annotasiyaları, seqmentlərə bölünmüş DNT dəstlərini, həmçinin filogenetik və populyasiya tədqiqatlarının ardıcıllıqlarını düzülmə ilə ehtiva edən sadə təqdimatları idarə etməyə qadirdir. Sadə təqdim etmək üçün əvəzinə onlayn təqdimetmə aləti BankIt istifadə edin.

Sequin ilə eyni funksiyalardan istifadə edərək GenBank-a təqdim etmək üçün ardıcıllıq qeydlərinin yaradılmasını avtomatlaşdıran komanda xətti proqramı. O, ilk növbədə tam genomların və ardıcıllığın böyük partiyalarının təqdim edilməsi üçün istifadə olunur.

NCBI Gene Expression Omnibus (GEO) verilənlər bazasına mikroarray, SAGE və ya kütləvi spektrometriya verilənlər bazası kimi ifadə məlumatlarını təqdim edin.

GeneRIF elm adamlarına Gen verilənlər bazasında genlərin funksional annotasiyasına əlavə etmək üçün sadə mexanizm təqdim edir.

Laboratoriyaların qeydiyyatı və germline və ya somatik test hədəfləri üçün klinik və tədqiqat testləri daxil olmaqla, genetik test məlumatlarının təqdim edilməsi üçün təlimatlar və təlimatlar. GTR Mendel pozğunluqları, farmakogenetik fenotiplər və kompleks panellər üçün sitogenetik, biokimyəvi və molekulyar testlərin qeydiyyatını alqışlayır.

NIH Əlyazma Təqdimatı (NIHMS) Sistemi NIH İctimai Giriş Siyasətinə və onun həyata keçirdiyi qanuna uyğun olaraq NIH-nin maliyyələşdirməsindən yaranan əlyazmaları PubMed Mərkəzi rəqəmsal arxivinə təqdim etmək üçün istifadə olunur. Qanun və İctimai Giriş Siyasəti ictimaiyyətin NIH tərəfindən maliyyələşdirilən tədqiqatın dərc edilmiş nəticələrinə çıxışını təmin etmək məqsədi daşıyır.

Bu sayt istifadəçilərə kimyəvi strukturlar, eksperimental bioloji fəaliyyət nəticələri, annotasiyalar, siRNA məlumatları və s. daxil olmaqla PubChem Substance və BioAssay verilənlər bazalarına məlumat təqdim etməyə imkan verir. Bundan əvvəl təqdim edilmiş qeydləri yeniləmək üçün də istifadə edilə bilər.

SNP verilənlər bazası alətləri səhifəsi ümumi təqdimetmə qaydalarına və təqdimetmə dəstəyi sorğusuna keçidlər təqdim edir. Səhifədə həmçinin İnsan Genomu Variasiya Cəmiyyətinin nomenklaturasından istifadə edərək insan variasiyası məlumatlarının tək və ya toplu təqdim edilməsi üçün iki xüsusi keçid var.

Bu link SRA məlumatlarını təqdim edənlərin öz məlumatları üçün təhlükəsiz NCBI FTP saytını necə əldə edə biləcəyini təsvir edir, həmçinin icazə verilən məlumat formatlarını və kataloq strukturlarını təsvir edir.

Təqdimatçılar üçün NCBI-da bütün məlumat təqdimetmə prosesləri ilə əlaqə yaratmaq və məlumat tapmaq üçün vahid giriş nöqtəsi. Hazırda bu, BioProjects və BioSamples-ın qeydiyyatı və WGS və GTR üçün məlumatların təqdim edilməsi üçün interfeys kimi xidmət edir. Bu sayta gələcək əlavələr planlaşdırılır.

Bu keçid iz məlumatlarını təqdim edənlərin öz məlumatları üçün təhlükəsiz NCBI FTP saytını necə əldə edə biləcəyini təsvir edir, həmçinin icazə verilən məlumat formatlarını və kataloq strukturlarını təsvir edir.

Alətlər

İstifadəçilərə 1000 Genom Layihəsi tərəfindən hazırlanmış variant zənglərini, genotip çağırışlarını və dəstəkləyici sübutları (məsələn, düzülmüş ardıcıllıq oxunuşları) araşdırmaq imkanı verən interaktiv qrafik görüntüləyici.

Bu alət istifadəçilərə amin turşularının struktur və kimyəvi xassələrini müqayisə etməklə, mutasiyaların səbəb olduğu zülal ardıcıllığında dəyişiklikləri proqnozlaşdırmaqla, ümumi əvəzetmələrə baxmaqla və qorunan domenlərdə verilmiş qalıqların funksiyalarına baxmaqla onların xüsusiyyətlərini araşdırmaq imkanı verir.

Seçilmiş tam eukaryotik və prokaryotik genomlardan oxşar ardıcıllıqlar üçün BLAST axtarışını həyata keçirir.

RefSeqGene/LRG dəstindəki genomik ardıcıllıqların BLAST axtarışını həyata keçirir. Standart displey Qrafik displeydə düzülmələri nəzərdən keçirmək üçün hazır naviqasiya təmin edir.

Bu səhifə BLAST alqoritmləri üçün seçim bələdçisi, BLAST çıxış formatlarının təsviri, müstəqil BLAST üçün parametrlərin izahı, yerli maşınlarda müstəqil BLAST qurmaq üçün göstərişlər və BLAST ilə əlaqəli bir sıra təlimatlara keçid verir. BLAST URL API istifadə edərək.

Bioloji ardıcıllıqlar arasında yerli oxşarlıq bölgələrini tapır. Proqram nukleotid və ya zülal ardıcıllığını ardıcıl verilənlər bazası ilə müqayisə edir və uyğunluqların statistik əhəmiyyətini hesablayır. BLAST ardıcıllıqlar arasında funksional və təkamül əlaqələri haqqında nəticə çıxarmaq, həmçinin gen ailələrinin üzvlərini müəyyən etmək üçün istifadə edilə bilər.

Nukleotid və ya Zülal verilənlər bazalarından GI və ya qoşulma nömrələri faylını və ya digər Entrez verilənlər bazalarından unikal identifikatorlar faylını yükləməklə bir çox Entrez verilənlər bazasından qeydləri əldə etməyə imkan verir. Axtarış nəticələri müxtəlif formatlarda birbaşa kompüterinizdə yerli faylda saxlanıla bilər.

Zülal ardıcıllıqlarını təsnif etmək və onların təkamül əlaqələrini araşdırmaq üçün müstəqil proqram. CDTree mövcud Conserved Domain (CDD) qeydlərini və iyerarxiyalarını idxal edə, təhlil edə və yeniləyə bilər, həmçinin istifadəçilərə özlərini yaratmağa imkan verir. CDTree, Entrez CDD və Cn3D ilə sıx inteqrasiya olunub və istifadəçilərə zülal domenlərinin düzülmələrini yaratmağa və yeniləməyə imkan verir.

COBALT RPS-BLAST, BLASTP və PHI-BLAST istifadə edərək qorunmuş domen verilənlər bazasından, zülal motivləri verilənlər bazasından və ardıcıllıq oxşarlığından əldə edilən ikili məhdudiyyətlər toplusunu tapan çoxlu zülal ardıcıllığının uyğunlaşdırılması vasitəsidir.

NCBI-nin Entrez axtarış xidmətindən 3 ölçülü strukturlara baxmaq üçün müstəqil proqram. Cn3D Windows, Macintosh və UNIX sistemlərində işləyir və ən məşhur veb-brauzerlərdən məlumat almaq üçün konfiqurasiya edilə bilər. Cn3D eyni vaxtda strukturu, ardıcıllığı və düzülməni göstərir və güclü annotasiya və hizalama redaktə xüsusiyyətlərinə malikdir.

NCBI Bookshelf-in bir hissəsi olan Coffee Break, NCBI alətlərinin istifadəsi ilə son biotibbi kəşflər haqqında hesabatları birləşdirir. Hər bir hesabatda NCBI bioinformatika vasitələrinin tədqiqat prosesinin bir hissəsi kimi necə istifadə edildiyini göstərən interaktiv dərsliklər var.

Verilmiş zülal ardıcıllığını təşkil edən funksional domenləri göstərir. O, oxşar domen arxitekturasına malik zülalları sadalayır və müəyyən domen birləşmələrini ehtiva edən zülalları əldə edə bilir.

Zülal ardıcıllığında mövcud olan qorunan domenləri müəyyən edir. CD-Axtarış, Sorğu ardıcıllığını Qorunan Domen Verilənlər Bazasında (CDD) mövcud olan qorunmuş domen düzülmələrindən hazırlanmış mövqe-xüsusi hesab matrisləri ilə müqayisə etmək üçün RPS-BLAST (Tərs Mövqe-Xüsusi BLAST) istifadə edir.

Adi veb sorğu interfeysindən kənarda NCBI-nin Entrez sistemi daxilində məlumatlara çıxışı təmin edən alətlər. Onlar proqram təminatı daxilində Entrez tapşırıqlarının avtomatlaşdırılması metodunu təmin edirlər. Hər bir yardım proqramı xüsusi axtarış tapşırığını yerinə yetirir və sadəcə olaraq xüsusi formatlaşdırılmış URL yazmaqla istifadə edilə bilər.

İstifadəçilərə onlayn formadan istifadə edərək E-kommunal analiz boru kəməri qurmağa imkan verən alət və sonra boru kəmərini icra etmək üçün Perl skripti yaradır.

Sorğu ardıcıllığını (nukleotid və ya protein) GEO verilənlər bazasında mikroarray və ya SAGE platformalarına daxil edilmiş GenBank ardıcıllığına uyğunlaşdırmaq üçün alət.

Taksonomiya verilənlər bazasında orqanizmlər üçün genetik kodları cədvəllərdə və taksonomik ağacda göstərir.

Bu alət nukleotid və ya zülal ardıcıllığını genomik ardıcıllıq verilənlər bazası ilə müqayisə edir və Əsas Yerli Alignment Axtarış Aləti (BLAST) alqoritmindən istifadə edərək uyğunluqların statistik əhəmiyyətini hesablayır.

Gen, ifadə, variasiya və digər qeydlərin hərtərəfli təftişi ilə eukaryotik RefSeq genom birləşmələrinin interaktiv naviqasiyası üçün genom brauzeri. GDV asan yükləməli analitik trek konfiqurasiyalarını, asan nümayiş etdirmək və fərdiləşdirmək üçün məlumat yolları menyusunu təklif edir və istifadəçi məlumatlarının yüklənməsini və təhlilini dəstəkləyir. Bu brauzer həmçinin nəşr üçün displeylərin istehsalına imkan verir.

İdeoqramma və ya montajın ardıcıl təsviri üzrə annotasiyaların jurnal keyfiyyət rəqəmlərinin istehsalına kömək edən onlayn alət.

NCBI-nin Remap aləti istifadəçilərə annotasiya məlumatlarını layihələndirməyə və xüsusiyyətlərin yerlərini bir genomik məclisdən digərinə və ya baza analizi vasitəsilə baza vasitəsilə RefSeqGene ardıcıllığına çevirməyə imkan verir. Remappingin sərtliyini tənzimləmək üçün seçimlər təmin edilir və xülasə nəticələri veb-səhifədə göstərilir. Tam nəticələr NCBI-nin Genome Workbench qrafik görüntüləyicisində baxmaq üçün endirilə bilər və yenidən qurulmuş funksiyalar üçün annotasiya məlumatları, habelə xülasə məlumatları da yükləmək üçün mövcuddur.

Ardıcıllıq məlumatlarına baxmaq və təhlil etmək üçün inteqrasiya olunmuş proqram. Genome Workbench ilə siz NCBI-də ictimaiyyətə açıq olan ardıcıllıq verilənlər bazalarında məlumatlara baxa və bu məlumatları öz məlumatlarınızla qarışdıra bilərsiniz.

Üçüncü tərəflərə birbaşa PubMed və digər Entrez verilənlər bazası qeydlərindən Entrez sistemindən kənarda müvafiq veb-əlçatan resurslara keçid imkanı verən xidmət. LinkOut resurslarına misal olaraq tam mətnli nəşrlər, bioloji məlumat bazaları, istehlakçıların sağlamlığı haqqında məlumatlar və tədqiqat alətləri daxildir.

Orqanizmlərin alt çoxluğu üçün xəritələrin və yığılmış ardıcıllıqların xüsusi gözdən keçirilməsi imkanlarını təmin edir. Siz orqanizmin tam genomuna baxa və axtarış edə, xəritələri göstərə və maraq dairəsi üçün ardıcıllıq məlumatlarına qədər tədricən daha yüksək səviyyələrə yaxınlaşdıra bilərsiniz.

İstifadəçilərə verilənlər bazası axtarış nəticələri və ya digər proqram proqramları tərəfindən yaradılmış çoxsaylı düzülmələri vizuallaşdırmağa imkan verən interaktiv veb tətbiqi. MSA Viewer istifadəçilərə düzülmə yükləməyə və əsas ardıcıllığı təyin etməyə və böyütmə və rəngin dəyişdirilməsi kimi funksiyalardan istifadə edərək məlumatları araşdırmaq imkanı verir.

Yeni və yenilənmiş resurslar və NCBI tədqiqat və inkişaf layihələri haqqında məlumat verir. Xəbərlər saytında xidmətlər, resurs xüsusiyyətləri və alətləri işıqlandıran bədii məqalələr, həmçinin istifadəçi icmasını maraqlandıran əsas məlumat dəstləri və xidmətlərlə bağlı mühüm elanları təsvir edən tez-tez dərc olunan məqalələr var. NCBI-nin sosial media saytlarına bağlantılar və mövcud RSS lentlərinin siyahısı və E-poçt siyahıları təqdim olunur.

Molekulyar biologiya üçün portativ, modul proqram təminatı istehsal etmək üçün NCBI tərəfindən istifadə olunan proqram təminatı və məlumat mübadiləsi spesifikasiyaları toplusu. Alətlər qutusundakı proqram təminatı ilk növbədə Beynəlxalq Standartlar Təşkilatının (ISO) məlumat təqdimat formatı olan Abstract Syntax Notation 1 (ASN.1) formatında qeydləri oxumaq üçün nəzərdə tutulmuşdur.

Laboratoriya üçün xüsusi protokollar əsasında multipleks qısa tandem təkrar (STR) DNT profillərinin qiymətləndirilməsini asanlaşdıran ictimai domen keyfiyyət təminatı proqram paketi. OSIRIS müstəqil əldə edilmiş riyazi əsaslı ölçü alqoritmindən istifadə edərək xam elektroforez məlumatlarını qiymətləndirir. O, iki yeni yüksək keyfiyyət ölçüləri təklif edir - uyğunluq səviyyəsi və ölçü qalığı. O, fon səs-küyü parametrləri, fərdiləşdirilmiş adlandırma konvensiyaları və əlavə daxili laboratoriya nəzarətləri kimi laboratoriyaya xas imzaları yerləşdirmək üçün fərdiləşdirilə bilər.

İstifadəçi ardıcıllığında və ya verilənlər bazasında olan ardıcıllıqla bütün açıq oxu çərçivələrini tapan qrafik analiz aləti. On altı müxtəlif genetik koddan istifadə edilə bilər. Çıxarılan amin turşusu ardıcıllığı müxtəlif formatlarda saxlanıla və BLAST istifadə edərək zülal verilənlər bazasında axtarıla bilər.

İstifadəçilərə ya CDD qeydlərindən, ya da Mövqe Xüsusi İterasiyalı (PSI)-BLAST zülal axtarışlarından mövqeyə məxsus xal matrislərini (PSSM) göstərməyə, çeşidləməyə, alt qrupa və yükləməyə imkan verir. Alət həmçinin sorğu zülalını PSSM-ə uyğunlaşdıra və yüksək qorunma mövqelərini vurğulaya bilər.

Fenotip, xromosom yeri, gen və SNP identifikatorlarına görə sorğularla insan fenotip/genotip əlaqələrini tapmağı dəstəkləyir. Hazırda dbGaP, NHGRI GWAS Kataloqu və GTeX-dən məlumatlar daxildir. Nəticələri genomda, ardıcıllıqla və ya yükləmək üçün cədvəllərdə göstərir.

Primer-BLAST aləti PCR primerlərini ardıcıllıq şablonuna dizayn etmək üçün Primer3-dən istifadə edir. Potensial məhsullar daha sonra nəzərdə tutulan hədəfin spesifikliyini yoxlamaq üçün istifadəçi tərəfindən müəyyən edilmiş verilənlər bazalarına qarşı BLAST axtarışı ilə avtomatik təhlil edilir.

Zülalların genomik nukleotid ardıcıllığına uyğunlaşdırılmasının hesablanması üçün bir yardım proqramı. O, Needleman Wunsch qlobal hizalama alqoritminin dəyişikliyinə əsaslanır və xüsusilə intronlar və birləşmə siqnalları üçün hesablanır. Bu alqoritm sayəsində ProSplign birləşmə yerlərinin müəyyən edilməsində dəqiqdir və ardıcıllıq xətalarına dözümlüdür.

PUG proqram interfeysi vasitəsilə PubChem xidmətlərinə çıxışı təmin edir. PUG istifadəçilərə məlumatları endirməyə, kimyəvi struktur axtarışlarına başlamağa, kimyəvi strukturları standartlaşdırmağa və E-utilities ilə qarşılıqlı əlaqə yaratmağa imkan verir. PUG-ə ya standart URL-lərdən istifadə etməklə, ya da SOAP vasitəsilə daxil olmaq olar.

Standartlaşdırma, PubChem terminologiyasında, töhfə verənlərin orijinal strukturlarından PubChem Compound qeydlərini yaratmaq üçün istifadə edilən eyni üsulla kimyəvi strukturların emalıdır. Bu xidmət istifadəçilərə PubChem-in təqdim etmək istədikləri istənilən strukturu necə idarə edəcəyini görməyə imkan verir.

PubChem Struktur Axtarışı PubChem Mürəkkəb Verilənlər Bazasını kimyəvi quruluşa və ya kimyəvi quruluş nümunəsinə görə sorğulamağa imkan verir. PubChem Sketcher sorğunun əl ilə çəkilməsinə imkan verir. İstifadəçilər həmçinin PubChem Mürəkkəb İdentifikatoru (CID), SMILES, SMARTS, InChI, Molekulyar Formula və ya dəstəklənən struktur fayl formatını yükləmək yolu ilə struktur sorğu daxiletməsini təyin edə bilərlər.

Klinisyenler və sağlamlıq xidmətləri tədqiqatçıları üçün nəzərdə tutulmuş xüsusi PubMed axtarış forması. Səhifə klinik tədqiqat kateqoriyası üzrə axtarışı, sistematik rəylərin tapılmasını və tibbi genetik ədəbiyyatın axtarışını asanlaşdırır.

PubMed axtarışı və əlaqələndirilməsi, axtarışların MyNCBI-də saxlanması, MeSH və digər PubMed xidmətlərindən istifadə üzrə veb və flash dərsliklər toplusu.

Əlaqədar strukturlar aləti istifadəçilərə Molekulyar Modelləşdirmə Verilənlər Bazasından (MMDB) ardıcıllıqla sorğu zülalına oxşar 3D strukturları tapmağa imkan verir. Sorğu zülalının hələ həll edilmiş strukturu olmasa da, oxşar zülal ardıcıllığının 3D forması sorğu zülalının ehtimal olunan formasına və bioloji funksiyasına işıq sala bilər.

SNP verilənlər bazasında axtarış aparmaq üçün BLAST istifadə edərək genotip, metod, populyasiya, təqdim edən, markerlər və ardıcıllıq oxşarlığı üzrə axtarışa imkan verən müxtəlif alətlər mövcuddur. Bunlar dbSNP əsas səhifəsinin sol tərəfindəki ""Axtarış"" altında əlaqələndirilir.

Sequence Cytogenetic Conversion Service İnsan, siçovul, siçan və meyvə milçəklərinin genomik birləşmələri üçün ardıcıllığı və sitogenetik koordinatları çevirən onlayn alətdir. Sequence Viewer

Nukleotid və ya zülal ardıcıllığının konfiqurasiya edilə bilən qrafik görüntüsünü və həmin ardıcıllıqla şərh edilmiş xüsusiyyətləri təmin edir. NCBI ardıcıllığı verilənlər bazası səhifələrində istifadə etməklə yanaşı, bu görüntüləyici daxil edilə bilən veb səhifə komponenti kimi mövcuddur. Təfərrüatlı sənədlər, o cümlədən API İstinad bələdçisi, izləyicini öz səhifələrində yerləşdirmək istəyən tərtibatçılar üçün mövcuddur.

cDNA-to-Genomik ardıcıllığın uyğunlaşdırılmasını hesablamaq üçün bir yardım proqramı. O, Needleman-Wunsch qlobal hizalama alqoritminin dəyişikliyinə əsaslanır və xüsusi olaraq intronlar və birləşmə siqnalları üçün hesablanır. Bu alqoritm sayəsində Splign birləşmə yerlərini təyin etməkdə dəqiqdir və ardıcıllıq səhvlərinə dözümlüdür.

Qismən taksonomik adlar, ümumi adlar, vəhşi kartlar və fonetik cəhətdən oxşar adlardan istifadə edərək taksonomiya ağacının axtarışını dəstəkləyir. Hər bir taksonomik qovşaq üçün alət həmin qovşaq üçün Entrez-dəki bütün məlumatlara keçidlər təqdim edir, nəsli göstərir və qovşaqla əlaqəli xarici saytlara keçidlər təqdim edir.

Seçilmiş orqanizmlər qrupu üçün taksonomik ağac yaradır. İstifadəçilər taksonomiya identifikatorları və ya adlar faylını yükləyə və ya adları və ya şəxsiyyətləri birbaşa daxil edə bilərlər.

Verilən rütbə və daxil olma tarixi üçün verilənlər bazasında taksonomik qovşaqların sayını göstərir.

Taksonomik qovşaqların və ya identifikatorların cari vəziyyətini göstərir.

Filogenetik ağac məlumatlarını yaratmaq və göstərmək üçün alət. Tree Viewer öz ardıcıllıq məlumatlarınızı təhlil etməyə imkan verir, PDF kimi çap edilə bilən vektor şəkilləri istehsal edir və veb səhifəyə daxil edilə bilər.

Variasiya Baxıcısı dbSNP, dbVar və ClinVar verilənlər bazalarında sadalanan genomik variasiyaları axtarmaq və görmək üçün genomik brauzer. Axtarışlar dbSNP və dbVar-dan xromosom yeri, gen simvolu, fenotip və ya variant identifikatorlarından istifadə etməklə həyata keçirilə bilər. Brauzer nəticələrin dinamik qrafik ardıcıllığı görüntüləyicisində şərh edilmiş variasiya cədvəlləri ilə araşdırılmasına imkan verir. VecScreen

Vektor mənşəli ola bilən nuklein turşusu ardıcıllığının seqmentlərini tez müəyyən etmək üçün sistem. VecScreen ixtisaslaşdırılmış qeyri-ehtiyatsız vektor verilənlər bazasında (UniVec) istənilən ardıcıllıqla uyğun gələn seqmentlər üçün sorğu ardıcıllığını axtarır.

Oxşar zülal 3 ölçülü strukturları müəyyən edən kompüter alqoritmi. MMDB-dəki hər bir struktur üçün struktur qonşuları əvvəlcədən hesablanır və MMDB Struktur Xülasə səhifələrindəki keçidlər vasitəsilə əldə edilə bilər. Bu qonşular yalnız ardıcıllıq müqayisəsi ilə tanınmayan uzaq homologları müəyyən etmək üçün istifadə edilə bilər.

Bu vasitə bir viral ardıcıllığın genotipini müəyyən etməyə kömək edir. Pəncərə sorğu ardıcıllığı boyunca sürüşdürülür və hər bir pəncərə BLAST vasitəsilə müəyyən bir virus üçün istinad ardıcıllığının hər biri ilə müqayisə edilir.


7.2. Fərdi genlərin funksiyalarının müəyyən edilməsi

Yeni gen bir genom ardıcıllığında yerləşdikdən sonra onun funksiyası məsələsi həll edilməlidir. Bu, genomik tədqiqatların vacib bir sahəsinə çevrilir, çünki tamamlanan ardıcıllıq layihələri fərdi genomların məzmunu haqqında düşündüyümüzdən daha az bildiyimizi ortaya qoydu. E. coliS. cerevisiae, məsələn, ardıcıllıq layihələrinin ortaya çıxmasından əvvəl adi genetik analizlə intensiv şəkildə tədqiq edilirdilər və genetiklər bir vaxtlar onların genlərinin çoxunun müəyyən edildiyinə kifayət qədər əmin idilər. Genom ardıcıllığı, əslində bizim biliklərimizdə böyük boşluqların olduğunu ortaya qoydu. 4288 protein kodlayan gendən E. coli genom ardıcıllığı, əvvəllər yalnız 1853 (ümumi genomun 43%) müəyyən edilmişdir (Blattner və b., 1997). üçün S. cerevisiae bu rəqəm cəmi 30% təşkil edirdi (Dujon, 1996).

Gen yerində olduğu kimi, naməlum genlərin funksiyalarını təyin etmək cəhdləri kompüter analizi və eksperimental tədqiqatlar vasitəsilə həyata keçirilir.

7.2.1. Gen funksiyasının kompüter analizi

Biz artıq görmüşük ki, kompüter analizi DNT ardıcıllığında genlərin müəyyən edilməsində mühüm rol oynayır və bu məqsədlə mövcud olan ən güclü vasitələrdən biri tədqiq olunan DNT ardıcıllığını bütün digər DNT ardıcıllıqları ilə müqayisə edərək genlərin yerini təyin edən homoloji axtarışdır. verilənlər bazalarında. Homologiya axtarışının əsası ondan ibarətdir ki, əlaqəli genlər oxşar ardıcıllığa malikdir və buna görə də yeni bir gen fərqli bir orqanizmdən olan ekvivalent, artıq ardıcıllaşdırılmış genlə oxşarlığı sayəsində kəşf edilə bilər. İndi biz homoloji analizə daha yaxından baxacağıq və onun yeni genə funksiya təyin etmək üçün necə istifadə oluna biləcəyini görəcəyik.

Homologiya təkamül münasibətlərini əks etdirir

Homoloji genlər ümumi təkamül əcdadını paylaşan genlərdir və genlər arasında ardıcıl oxşarlıqlarla aşkar edilir. Bu oxşarlıqlar, 16-cı Fəsildə görəcəyimiz kimi, molekulyar filogeniyaların əsaslandığı məlumatları təşkil edir. Homoloji genlər iki kateqoriyaya bölünür:

Bir cüt homoloji gen adətən eyni nukleotid ardıcıllığına malik olmur, çünki iki gen mutasiya yolu ilə müxtəlif təsadüfi dəyişikliklərə məruz qalır, lakin onların oxşar ardıcıllığı var, çünki bu təsadüfi dəyişikliklər eyni başlanğıc ardıcıllığı, ümumi əcdad geni üzərində işləyir. Homoloji axtarış bu ardıcıllıq oxşarlıqlarından istifadə edir. Təhlilin əsası ondan ibarətdir ki, əgər yeni ardıcıllıqla salınmış gen əvvəllər ardıcıllaşdırılmış genə bənzəyirsə, onda təkamül əlaqəsi çıxarıla bilər və yeni genin funksiyası eyni və ya ən azı oxşar ola bilər. məlum genin funksiyası.

Sözləri qarışdırmamaq vacibdir homologiyaoxşarlıq. Əgər onların ardıcıllığı 80% nukleotid eyniliyinə malikdirsə, bir-biri ilə əlaqəli bir cüt genin �% homolog’ kimi təsvir edilməsi düzgün deyil (Şəkil 7.9). Bir cüt gen ya təkamüllə əlaqəlidir, ya da onlar arasında heç bir vəziyyət yoxdur və buna görə də homologiyaya faiz dəyəri təyin etmək mənasızdır.

Şəkil 7.9

80% ardıcıllığı olan iki DNT ardıcıllığı.

Homoloji analiz bütöv bir genin və ya onun daxilindəki seqmentlərin funksiyası haqqında məlumat verə bilər

Homologiya axtarışı DNT ardıcıllığı ilə aparıla bilər, lakin axtarış aparılmazdan əvvəl adətən şərti gen ardıcıllığı amin turşusu ardıcıllığına çevrilir. Bunun bir səbəbi zülallarda 20 müxtəlif amin turşusunun, DNT-də isə yalnız dörd nukleotidin olmasıdır, buna görə də bir-biri ilə əlaqəsi olmayan genlərin amin turşusu ardıcıllığı müqayisə edildikdə adətən bir-birindən daha fərqli görünür (Şəkil 7.10). Ona görə də amin ardıcıllığından istifadə edilərsə, homoloji axtarışın saxta nəticələr vermə ehtimalı azdır. Homologiya axtarışının praktikliyi heç də qorxulu deyil. Bu analiz növü üçün bir neçə proqram proqramı mövcuddur, ən populyarı BLAST (Basic Local Alignment Search Tool Altschul) və b., 1990). Təhlil sadəcə olaraq DNT verilənlər bazalarından birinin veb saytına daxil olaraq və ardıcıllığı onlayn axtarış alətinə daxil etməklə həyata keçirilə bilər.

Şəkil 7.10

İki ardıcıllıq arasında homologiyanın olmaması çox vaxt amin turşusu səviyyəsində müqayisələr aparıldıqda daha aydın görünür. İki nukleotid ardıcıllığı, qırmızı ilə verilmiş iki ardıcıllıqda eyni olan nukleotidlər və mavi rəngdə qeyri-identifikasiyalar göstərilmişdir. (daha çox.)

Artıq verilənlər bazasında olan bir genlə müsbət uyğunluq yeni genin funksiyasının aydın göstəricisini verə bilər və ya uyğunluğun nəticələri daha incə ola bilər. Xüsusilə, açıq-aydın təkamül əlaqəsi olmayan genlərin bir-birinə bənzər qısa seqmentləri ola bilər. Bunun izahı tez-tez olur ki, genlər bir-biri ilə əlaqəsi olmasa da, onların zülalları oxşar funksiyalara malikdir və paylaşılan ardıcıllıq hər bir zülal daxilində həmin paylaşılan funksiyanın mərkəzi olan domeni kodlayır. Genlərin özlərinin ortaq əcdadı olmasa da, domenlər var, lakin onların ortaq əcdadı çox qədim zamanlara təsadüf edir, homoloji domenlər sonradan tək nukleotid dəyişiklikləri ilə deyil, həm də öz daxilində yeni genlər yaradan daha mürəkkəb yenidən təşkillərlə təkamülləşmişdir. domenlərin tapıldığı (Bölmə 15.2.1). Maraqlı bir nümunə, ilk dəfə ardıcıllıqla müəyyən edilmiş təxminən 120 amin turşusu motivi olan tudor sahəsi ilə təmin edilir. Drosophila melanogaster adlı gen tudor (Pontinq, 1997). tərəfindən kodlanmış protein tudor funksiyası bilinməyən gen bir-birinin ardınca tudor sahəsinin on nüsxəsindən ibarətdir (Şəkil 7.11). Test olaraq tudor domenindən istifadə edən homoloji axtarış bir neçə tanınmış zülalın bu domeni ehtiva etdiyini ortaya qoydu. Bu zülalların ardıcıllığı bir-birinə çox bənzəmir və onların əsl homolog olduğuna dair heç bir əlamət yoxdur, lakin onların hamısı tudor sahəsinə malikdir. Bu zülallar zamanı RNT nəqlində iştirak edən zülallar daxildir Drosophila oogenez, RNT mübadiləsində rolu olan insan zülalı və fəaliyyətləri bu və ya digər şəkildə RNT ilə əlaqəli görünən digərləri. Ona görə də homologiya təhlili göstərir ki, tudor ardıcıllığı zülal və onun RNT substratı arasında qarşılıqlı təsirdə müəyyən rol oynayır. Kompüter təhlilindən əldə edilən məlumatlar özlüyündə natamamdır, lakin o, tudor sahəsinin funksiyası haqqında daha dəqiq məlumat əldə etmək üçün aparılmalı olan təcrübə növlərinə yol göstərir.

Şəkil 7.11

Tudor sahəsi. Üst rəsm strukturunu göstərir Drosophila tudor domeninin on nüsxəsini ehtiva edən tudor proteini. Domen də bir saniyədə tapılır Drosophila protein, evsiz, və insan A-kinaz anker proteinində (AKAP149), (daha çox.)

Maya genomu layihəsində homoloji analiz

The S. cerevisiae genom layihəsi yeni genlərə funksiyaların təyin edilməsi vasitəsi kimi homoloji analizin həm potensialını, həm də məhdudiyyətlərini təsvir etmişdir. Maya genomunda təxminən 6000 gen var ki, bunların 30%-i sekvensləşdirmə layihəsi başlamazdan əvvəl adi genetik analizlə müəyyən edilib. Qalan 70% homoloji analizlə öyrənilmiş və aşağıdakı nəticələr verilmişdir (Şəkil 7.12 Dujon, 1996):

Şəkil 7.12

Maya genomunda gen kateqoriyaları.

7.2.2. Eksperimental analizlə gen funksiyasının təyin edilməsi

Aydındır ki, homologiya təhlili bütün yeni genlərin funksiyalarını müəyyən edə biləcək bir panacea deyil. Buna görə də homologiya tədqiqatlarının nəticələrini tamamlamaq və genişləndirmək üçün eksperimental üsullara ehtiyac var. Bu, genomika tədqiqatlarında ən böyük problemlərdən biri olduğunu sübut edir və əksər molekulyar bioloqlar razılaşırlar ki, hazırda istifadə olunan metodologiya və strategiyalar sekvensləşdirmə layihələri ilə kəşf edilən çoxlu sayda naməlum genlərə funksiyaların təyin edilməsi üçün tamamilə adekvat deyil. Problem ondadır ki, məqsəd - gendən funksiyaya bir kurs çəkmək - başlanğıc nöqtəsinin fenotip olduğu və əsas gen və ya genləri müəyyən etmək olan genetik analiz tərəfindən normal olaraq qəbul edilən marşrutun əksidir. Hal-hazırda həll etdiyimiz problem bizi əks istiqamətə aparır: yeni bir gendən başlayaraq və ümid edirəm ki, əlaqəli fenotipin müəyyənləşdirilməsinə gətirib çıxarır.

Gen inaktivasiyası ilə funksional analiz

Adi genetik analizdə fenotipin genetik əsasları adətən fenotipin dəyişdiyi mutant orqanizmlərin axtarışı ilə öyrənilir. Mutantlar eksperimental olaraq, məsələn, orqanizmlərin populyasiyasını (məsələn, bakteriya mədəniyyəti) ultrabənövşəyi şüalanma və ya mutagen kimyəvi (bax. Bölmə 14.1.1) ilə müalicə etməklə əldə edilə bilər və ya mutantlar təbii populyasiyada mövcud ola bilər. Daha sonra mutant orqanizmdə dəyişdirilmiş gen və ya genlər genetik xaçlarla öyrənilir (Bölmə 5.2.4), bu, genomda genin mövqeyini təyin edə və həmçinin genin artıq mövcud olan ilə eyni olub olmadığını müəyyən edə bilər. səciyyələndirilmişdir. Daha sonra gen klonlaşdırma və ardıcıllıq kimi molekulyar biologiya üsulları ilə daha da öyrənilə bilər.

Bu şərti analizin ümumi prinsipi ondan ibarətdir ki, fenotip üçün cavabdeh olan genlər, fenotipin mutant versiyasını göstərən orqanizmlərdə hansı genlərin təsirsiz hala salındığını müəyyən etməklə müəyyən edilə bilər. Başlanğıc nöqtəsi fenotip deyil, gendirsə, ekvivalent strategiya geni mutasiya etmək və nəticələnən fenotipik dəyişikliyi müəyyən etmək olardı. Bu, naməlum genlərə funksiyalar təyin etmək üçün istifadə olunan texnikaların əksəriyyətinin əsasını təşkil edir.

Fərdi genlər homoloji rekombinasiya ilə təsirsiz hala gətirilə bilər

Müəyyən bir geni təsirsiz hala gətirməyin ən asan yolu onu əlaqəsiz DNT seqmenti ilə pozmaqdır (Şəkil 7.13). Bu, genin xromosom nüsxəsi və hədəf gen ilə müəyyən ardıcıllıq eyniliyini paylaşan ikinci DNT parçası arasında homoloji rekombinasiya yolu ilə əldə edilə bilər. Homoloji (və digər növ) rekombinasiya mürəkkəb hadisələrdir və biz onları Bölmə 14.3.1-də ətraflı şəkildə nəzərdən keçirəcəyik. Hazırkı məqsədlər üçün bilmək kifayətdir ki, əgər iki DNT molekulunun oxşar ardıcıllığı varsa, rekombinasiya molekulların seqmentlərinin mübadiləsi ilə nəticələnə bilər.

Şəkil 7.13

Homoloji rekombinasiya ilə gen inaktivasiyası. Hədəf genin xromosom nüsxəsi klonlama vektoru tərəfindən daşınan genin pozulmuş versiyası ilə rekombinasiya olunur. Nəticədə hədəf gen inaktivləşir. Rekombinasiya haqqında ətraflı məlumat üçün (daha çox.)

Gen inaktivasiyası praktikada necə həyata keçirilir? İki nümunəni nəzərdən keçirəcəyik, birincisi ilə S. cerevisiae. 1996-cı ildə genom ardıcıllığını tamamladıqdan sonra, maya molekulyar bioloqları mümkün qədər çox yetim genin funksiyalarını müəyyən etmək üçün əlaqələndirilmiş, beynəlxalq səylərə başladılar (Oliver, 1996b). İstifadə olunan texnikalardan biri Şəkil 7.14-də göstərilmişdir (Wach və b., 1994). Mərkəzi komponent antibiotiklərə qarşı müqavimət genini daşıyan �letion kaset’”dur. Bu gen maya genomunun normal komponenti deyil, lakin maya xromosomuna köçürüldükdə işləyəcək və antibiotik genetikinə davamlı olan transformasiya olunmuş maya hüceyrəsinə səbəb olacaq. Silinmə kasetindən istifadə etməzdən əvvəl DNT-nin yeni seqmentləri hər iki ucuna quyruq kimi yapışdırılır. Bu seqmentlər maya geninin təsirsiz hala gətiriləcək hissələri ilə eyni ardıcıllığa malikdir. Dəyişdirilmiş kaset maya hüceyrəsinə daxil edildikdən sonra, DNT quyruğu ilə maya geninin xromosom nüsxəsi arasında homoloji rekombinasiya baş verir və sonuncunu antibiotikə davamlılıq geni ilə əvəz edir. Dəyişdirilməyə məruz qalmış hüceyrələr buna görə də kulturanın genetikini ehtiva edən agar mühitinin üzərinə qoyulması yolu ilə seçilir. Yaranan koloniyalarda hədəf gen aktivliyi yoxdur və onların fenotipləri genin funksiyası haqqında müəyyən fikir əldə etmək üçün araşdırıla bilər.

Şəkil 7.14

Maya silmə kasetinin istifadəsi. Silinmə kaseti mayada ifadə üçün lazım olan promotor ardıcıllığından əvvəl gələn və iki məhdudlaşdırıcı sahə ilə bitişik olan antibiotik müqavimət genindən ibarətdir. Hədəf genin başlanğıc və son seqmentləri (daha çox. )

Gen inaktivasiyasının ikinci nümunəsi analoji prosesdən istifadə edir, lakin maya deyil, siçanlar ilə. Siçan tez-tez insanlar üçün model orqanizm kimi istifadə olunur, çünki siçan genomu insan genomuna bənzəyir və eyni genlərin çoxunu ehtiva edir. Buna görə də naməlum insan genlərinin funksiyalarını müəyyən etmək, əsasən, siçandakı ekvivalent genləri təsirsiz hala gətirməklə həyata keçirilir, bu təcrübələr insanlar üçün etik cəhətdən ağlasığmazdır. Prosedurun homoloji rekombinasiya hissəsi maya üçün təsvir edilənlə eynidir və bir daha hədəf genin təsirsiz hala salındığı hüceyrə ilə nəticələnir. Problem ondadır ki, biz yalnız bir mutasiyaya uğramış hüceyrə deyil, bütöv bir mutant siçan istəyirik, çünki yalnız tam orqanizmlə gen inaktivasiyasının fenotipə təsirini tam qiymətləndirmək olar. Buna nail olmaq üçün xüsusi tipli siçan hüceyrəsindən istifadə etmək lazımdır, an embrion kök və ya ES hüceyrəsi (Evans və b., 1997). Əksər siçan hüceyrələrindən fərqli olaraq, ES hüceyrələri totipotentdir, yəni onlar tək inkişaf yoluna sadiq deyillər və buna görə də bütün növ diferensiallaşmış hüceyrələrə səbəb ola bilərlər. Mühəndisləşdirilmiş ES hüceyrəsi buna görə də inkişaf etməyə davam edən siçan embrionuna yeridilir və nəticədə ximeranı, hüceyrələri mühəndis ES hüceyrələrindən əldə edilən mutantların və mutant olmayanların qarışığından ibarət olan siçanı əmələ gətirir. embrionun bütün digər hüceyrələri. Bu hələ də istədiyimiz kimi deyil, ona görə də kimerik siçanların bir-biri ilə cütləşməsinə icazə verilir. Nəsillərin bəziləri iki mutant gametin birləşməsi nəticəsində yaranır və buna görə də qeyri-kimerik olacaqlar, çünki onların hər bir hüceyrəsi təsirsizləşdirilmiş geni daşıyacaq. Bunlar nokaut siçanlar, və xoşbəxtlikdən onların fenotipləri tədqiq olunan genin funksiyası haqqında istədiyiniz məlumatı verəcəkdir. Bu, bir çox gen inaktivasiyası üçün yaxşı işləyir, lakin bəziləri öldürücüdür və buna görə də homozigot nokaut siçanında öyrənilə bilməz. Əvəzində, siçanın hələ də tədqiq olunan genin bir düzgün nüsxəsinə malik olmasına baxmayaraq, genin inaktivasiyasının fenotipik təsirinin aydın olacağı ümidi ilə bir normal və bir mutant gamet arasında birləşmənin məhsulu olan heterozigot siçan əldə edilir.

Homoloji rekombinasiya olmadan gen inaktivasiyası

Homoloji rekombinasiya genin funksiyasını öyrənmək üçün onu pozmağın yeganə yolu deyil. Alternativlərdən biri transpozon etiketləməsindən istifadə etməkdir ki, bu zaman inaktivasiya transpozisiya elementinin genə daxil edilməsi ilə əldə edilir. Əksər genomlarda transpozisiya edilə bilən elementlər var (Bölmə 2.4.2) və bunların əsas hissəsi qeyri-aktiv olsa da, adətən bir neçəsi transpozisiya qabiliyyətini saxlayır. Normal şəraitdə transpozisiya nisbətən nadir hadisədir, lakin bəzən xarici stimula cavab olaraq öz mövqeyini dəyişən dəyişdirilmiş transpozonlar yaratmaq üçün rekombinant DNT üsullarından istifadə etmək mümkündür. Bunu etməyin bir yolu, maya retrotranspozonunu əhatə edir Ty1, Şəkil 7.15-də göstərilmişdir.

Şəkil 7.15

Transpozisiyanın süni induksiyası. Rekombinant DNT üsulları qalaktoza cavab verən promotor ardıcıllığı (Bölmə 3.2.2) yerləşdirmək üçün istifadə edilmişdir. Ty1 maya genomunun elementi. Qalaktoza olmadıqda, Ty1 element deyil (daha çox.)

Transpozon etiketləmə genetik ayaq izi adlanan texnikanın mərkəzidir (Smith və b., 1995), bu, bir çox maya yetimlərinin funksiyalarını qiymətləndirmək üçün ilk addım kimi təsirsiz hala gətirmək üçün istifadə edilmişdir. Transpozon etiketlənməsi endogendən istifadə edərək meyvə milçək genomunun təhlilində də vacibdir Drosophila transpozon adlanır P element (Engels, 2000). Transpozon işarələməsinin zəif tərəfi odur ki, fərdi genləri hədəfə almaq çətindir, çünki transpozisiya az-çox təsadüfi bir hadisədir və transpozon sıçradıqdan sonra onun hara bitəcəyini təxmin etmək mümkün deyil. Əgər məqsəd müəyyən bir geni təsirsiz hala gətirməkdirsə, o zaman əhəmiyyətli sayda transpozisiyaya səbəb olmaq və sonra düzgün daxil edilmiş birini tapmaq üçün yaranan orqanizmləri yoxlamaq lazımdır. Transpozon etiketləmə buna görə də genlərin təsadüfi olaraq təsirsiz hala gətirildiyi və maraqlı fenotip dəyişiklikləri üçün nəslin araşdırılması ilə müəyyən edilmiş oxşar funksiyaları olan gen qruplarının genom funksiyasının qlobal tədqiqatlarına daha çox tətbiq edilir.

RNT müdaxiləsi ilə gen inaktivasiyasına tamamilə fərqli bir yanaşma təmin edilir. Bu texnikada genin özünü pozmaq əvəzinə, onun mRNT-si məhv edilir. Bu, ardıcıllığı hədəf alınan mRNT-nin ardıcıllığına uyğun gələn qısa cüt zəncirli RNT molekullarının hüceyrəyə daxil edilməsi ilə həyata keçirilir. İki zəncirli RNT-lər mRNT-nin deqradasiyasına səbəb olan daha qısa molekullara parçalanır (Şəkil 7.16). Prosesin qurdda effektiv işlədiyi göstərilib Caenorhabditis elegans (Yanğın və b., 1998), onun genomu tam ardıcıllıqla (Cədvəl 2.1-ə bax) və yüksək eukariotlar üçün mühüm model orqanizm kimi baxılır (Bölmə 12.3.2). I xromosomda proqnozlaşdırılan 2769 gendən təxminən 2500-ü C. elegans ayrı-ayrılıqda RNT müdaxiləsi ilə, sadəcə olaraq, qurdları ikiqat zəncirli RNT olan məhlulda yerləşdirməklə və normal qəbul proseslərinin molekulların hüceyrələrə daşınmasına imkan verməklə təsirsiz hala gətirilmişdir (Fraser). və b., 2000). Oxşar layihələr digərinə də yönəldilir C. elegans xromosomları.

Şəkil 7.16

RNT müdaxiləsi. İki zəncirli RNT molekulu Dicer ribonukleaz tərəfindən 21 bp uzunluğunda "qısa müdaxilə edən RNT"lərə (siRNA) parçalanır. Hər bir siRNA bazasından bir zəncir hədəf mRNT-yə cütləşir və bu da daha sonra parçalanır (daha çox).

RNT müdaxiləsinin təbii olaraq bir sıra eukariotlarda baş verdiyi bilinir, lakin onun məməlilərin hüceyrələrinə tətbiq edilməsinin çətin olacağı gözlənilirdi, çünki bu orqanizmlər zülal sintezinin ümumiyyətlə inhibə olunduğu və hüceyrə ölümü ilə nəticələnən ikiqat zəncirli RNT-yə paralel reaksiya göstərirlər ( Bas, 2001). Bununla belə, bu narahatlıqlar əsassız idi, çünki indi sübut edilmişdir ki, liposomlarla füzyon yolu ilə mədəni insan hüceyrələrinə ikiqat zəncirli RNT daxil edilməsi (Şəkil 7.17) ümumi protein sintezində ölçülə bilən azalma olmadan hədəf mRNT-nin inaktivasiyası ilə nəticələnir (Elbəşir və b., 2001). Bu texnikanı məməlilərlə istifadə etməyin mənfi cəhəti odur ki, bütöv orqanizmlərlə deyil, yalnız tək hüceyrələrlə işləmək mümkündür, çünki ikiqat zəncirli RNT-lərin hüceyrə daxilində məhdud ömürləri var və zəruri olanlar kimi qalıcı dəyişiklikləri hazırlamaq üçün istifadə edilə bilməz. nokaut siçanlarının tikintisində.

Şəkil 7.17

Liposomlarla birləşmə insan hüceyrəsinə ikiqat zəncirli RNT çatdırmaq üçün istifadə edilə bilər.

Gen həddindən artıq ifadəsi funksiyanı qiymətləndirmək üçün də istifadə edilə bilər

İndiyə qədər biz tədqiq olunan genin inaktivasiyası ilə nəticələnən texnikalar üzərində cəmləşmişik (funksiya itkisi). Tamamlayıcı yanaşma, test geninin normaldan çox daha aktiv olduğu bir orqanizmin mühəndisliyi (funksiya qazanması) və bunun fenotipdə hansı dəyişikliklərin olduğunu müəyyən etməkdir. Bu eksperimentlərin nəticələrinə ehtiyatla yanaşmaq lazımdır, çünki həddindən artıq ifadə edilmiş genin spesifik funksiyası ilə əlaqədar olan fenotip dəyişikliyi ilə tək bir gen məhsulunun olduğu vəziyyətin anormallığını əks etdirən daha az spesifik fenotip dəyişikliyi arasında fərq qoyulmalıdır. həddindən artıq miqdarda, ola bilsin ki, genin normal olaraq qeyri-aktiv olduğu toxumalarda sintez olunur. Bu keyfiyyətə baxmayaraq, həddindən artıq ifadə gen funksiyası haqqında bəzi vacib məlumatları təmin etdi.

Bir geni həddindən artıq ifadə etmək üçün klonlanmış genin mümkün qədər çox protein sintezini idarə etməsini təmin etmək üçün nəzərdə tutulmuş xüsusi bir klonlama vektorundan istifadə edilməlidir. Buna görə vektor çoxkopiyalıdır, yəni o, ev sahibi orqanizmin daxilində hüceyrə başına 40 nüsxəyə qədər çoxalır, buna görə də test geninin çoxlu nüsxəsi var. Vektorda həmçinin yüksək aktiv promotor (Bölmə 9.2.2) olmalıdır ki, test geninin hər bir nüsxəsi böyük miqdarda mRNT-yə çevrilsin və mümkün qədər çox zülal hazırlansın. Siçan genləri ilə istifadə edilən texnikanın nümunəsi Şəkil 7.18-də göstərilmişdir (Simonet və b., 1997). Bu layihədə öyrəniləcək genlər seçildi, çünki onların ardıcıllığı qana ifraz olunan zülalları kodlamağı təklif edirdi. İstifadə edilən klonlama vektorunda yalnız qaraciyərdə ifadə olunan yüksək aktiv promotor var idi, ona görə də hər bir transgen siçan öz qaraciyərində test genini həddindən artıq ifadə etdi və sonra əldə edilən proteini qana ifraz etdi. Hər bir transgen siçanın fenotipi klonlanmış genlərin funksiyaları ilə bağlı ipucuların axtarışında araşdırıldı. Bir transgen siçanın normal siçanlardan əhəmiyyətli dərəcədə daha sıx sümüklərə sahib olduğu aşkar edildikdə maraqlı bir kəşf edildi. Bu, iki səbəbə görə vacib idi: birincisi, müvafiq genin sümük sintezində iştirak etdiyini müəyyən etməyə imkan verdi, ikincisi, sümük sıxlığını artıran zülalın kəşfi kövrək sümük xəstəliyi olan insan osteoporozunun müalicəsinin inkişafına təsir göstərir. .

Şəkil 7.18

Gen həddindən artıq ifadəsi ilə funksional analiz. Məqsəd tədqiq olunan genin həddindən artıq ifadəsinin transgen siçanın fenotipinə təsir edib-etmədiyini müəyyən etməkdir. Beləliklə, genin cDNT-si yüksək (daha çox) daşıyan klonlama vektoruna daxil edilir.

Haşiyə 7.1

I xromosomunun təhlili Caenorhabditis elegans RNT müdaxiləsi ilə. 339 genə funksiyalar təyin edilmişdir C. elegans RNT müdaxilə üsulu ilə fərdi inaktivasiyadan sonra xromosom I. C. elegans kiçik nematod qurdudur (Şəkilə baxın (daha çox.)

7.2.3. Naməlum bir gen tərəfindən kodlanmış bir zülalın fəaliyyətinin daha ətraflı tədqiqatları

Gen inaktivasiyası və həddindən artıq ekspressiya genom tədqiqatçılarının yeni genin funksiyasını təyin etmək üçün istifadə etdiyi əsas üsullardır, lakin bunlar gen fəaliyyəti haqqında məlumat verə bilən yeganə prosedurlar deyil. Digər üsullar inaktivasiya və həddindən artıq ifadənin nəticələrini genişləndirə və inkişaf etdirə bilər. Bunlardan gen funksiyasının identifikasiyasına kömək edəcək əlavə məlumat vermək üçün istifadə oluna bilər və ya geni artıq səciyyələndirilmiş zülalın fəaliyyətinin daha əhatəli müayinəsinin əsasını təşkil edə bilər.

İstiqamətləndirilmiş mutagenez gen funksiyasını ətraflı araşdırmaq üçün istifadə edilə bilər

İnaktivasiya və həddindən artıq ifadə bir genin ümumi funksiyasını təyin edə bilər, lakin gen tərəfindən kodlanmış zülalın fəaliyyəti haqqında ətraflı məlumat verə bilməz. Məsələn, genin bir hissəsinin zülal məhsulunu hüceyrədəki müəyyən bir bölməyə yönləndirən və ya zülalın kimyəvi və ya fiziki siqnala cavab vermək qabiliyyətinə cavabdeh olan amin turşusu ardıcıllığını kodladığından şübhələnmək olar.Bu fərziyyələri yoxlamaq üçün gen ardıcıllığının müvafiq hissəsini silmək və ya dəyişdirmək, lakin zülalın hələ də sintez olunaraq fəaliyyətinin əsas hissəsini saxlaması üçün kütləni dəyişmədən saxlamaq lazımdır. Müxtəlif prosedurlar sayta yönəldilib və ya in vitro mutagenez (Texniki Qeyd 7.1) bu incə dəyişiklikləri etmək üçün istifadə edilə bilər. Bunlar, tətbiqləri yalnız gen fəaliyyətinin öyrənilməsi ilə deyil, həm də sənaye və ya klinik şəraitdə istifadə üçün daha uyğun olan xüsusiyyətlərə malik yeni zülallar yaratmaq olan protein mühəndisliyi sahəsində olan mühüm texnikalardır.

Haşiyə 7.1

Sahəyə yönəldilmiş mutagenez. Zülalın strukturunu və bəlkə də aktivliyini dəyişdirmək üçün gen ardıcıllığında dəqiq dəyişiklik etmək üsulları. Zülal strukturunda dəyişikliklər sahəyə yönəldilmiş mutagenez üsulları ilə hazırlana bilər ki, bu da (daha çox. )

Mutagenezdən sonra gen ardıcıllığı ana hüceyrəyə daxil edilməlidir ki, homoloji rekombinasiya genin mövcud nüsxəsini dəyişdirilmiş versiya ilə əvəz edə bilsin. Bu, problem yaradır, çünki hansı hüceyrələrin homoloji rekombinasiyaya uğradığını bilmək üçün bir yolumuz olmalıdır. Hətta maya ilə bu, cəminin yalnız bir hissəsi olacaq və siçanlar üçün bu hissə çox az olacaq. Normalda biz bu problemi mutasiyaya uğramış genin yanına bir marker geni (məsələn, antibiotik müqavimətini kodlayan) yerləşdirməklə və bu markerin verdiyi fenotipi alan hüceyrələri axtarmaqla həll edərdik. Əksər hallarda, marker geni öz genomuna daxil edən hüceyrələr də yaxından birləşmiş mutasiyaya uğramış geni daxil edir və bizim istədiyimiz də belədir. Problem ondadır ki, sahəyə yönəldilmiş mutagenez təcrübəsində biz əmin olmalıyıq ki, tədqiq olunan genin fəaliyyətindəki hər hansı dəyişiklik, onun mühitinin dəyişməsinin dolayı nəticəsi deyil, genə daxil edilmiş spesifik mutasiyanın nəticəsidir. genomun yanına bir marker geni daxil etməklə. Cavab daha mürəkkəb iki mərhələli gen dəyişdirilməsindən istifadə etməkdir (Şəkil 7.19). Bu prosedurda hədəf gen əvvəlcə öz-özünə marker geni ilə əvəz olunur, bu rekombinasiyanın baş verdiyi hüceyrələr marker gen fenotipi üçün seçilməklə müəyyən edilir. Bu hüceyrələr daha sonra genin dəyişdirilməsinin ikinci mərhələsində, marker geni mutasiyaya uğramış gen ilə əvəz edildikdə istifadə olunur, müvəffəqiyyət indi marker gen fenotipini itirmiş hüceyrələrin axtarışı ilə izlənilir. Bu hüceyrələr mutasiyaya uğramış geni ehtiva edir və onların fenotipləri zülal məhsulunun fəaliyyətinə yönəlmiş mutasiyanın təsirini müəyyən etmək üçün araşdırıla bilər.

Şəkil 7.19

İki mərhələli gen dəyişdirilməsi. Təfərrüatlar üçün mətnə ​​baxın.

Reportyor genlər və immunositokimya, genlərin harada və nə vaxt ifadə edildiyini tapmaq üçün istifadə edilə bilər

Bir genin funksiyasına dair ipuçları çox vaxt genin harada və nə vaxt aktiv olduğunu təyin etməklə əldə edilə bilər. Əgər gen ifadəsi çoxhüceyrəli orqanizmin xüsusi orqanı və ya toxuması ilə və ya orqan və ya toxuma daxilindəki tək hüceyrələr dəsti ilə məhdudlaşırsa, bu mövqe məlumatından gen məhsulunun ümumi rolunu çıxarmaq üçün istifadə edilə bilər. Eyni şey, genin ifadə olunduğu inkişaf mərhələsi ilə bağlı məlumatlara da aiddir. Bu tip analizlər, inkişafın ən erkən mərhələlərində iştirak edən genlərin fəaliyyətini başa düşmək üçün xüsusilə faydalı olmuşdur. Drosophila (Bölmə 12.3.3) və məməlilərin inkişafının genetikasını açmaq üçün getdikcə daha çox istifadə olunur. Bu, həyat dövrlərində fərqli inkişaf mərhələləri olan maya kimi birhüceyrəli orqanizmlərə də şamil edilir.

Orqanizm daxilində gen ifadə modelini təyin etmək müxbir gen ilə mümkündür. Bu, ifadəsi rahat şəkildə izlənilə bilən gendir, ideal olaraq vizual müayinə (Cədvəl 7.1), reportyor genin mavi rəngə çevrilməsini, flüoresan və ya başqa görünən siqnal verməsini ifadə edən hüceyrələrdir. Müxbir geninin test geninin harada və nə vaxt ifadə olunduğuna dair etibarlı göstərici verməsi üçün reportyor test geni ilə eyni tənzimləyici siqnallara tabe olmalıdır. Bu, test geninin ORF-ni reportyor genin ORF ilə əvəz etməklə əldə edilir (Şəkil 7.20). Gen ifadəsini idarə edən tənzimləyici siqnalların əksəriyyəti ORF-dən yuxarı DNT bölgəsində yerləşir, buna görə də reportyor geni test geni ilə eyni ifadə modelini göstərməlidir. Buna görə də ifadə nümunəsi məruzəçi siqnalı üçün orqanizmi tədqiq etməklə müəyyən edilə bilər.

Cədvəl 7.1

Müxbir genlərinin nümunələri.

Şəkil 7.20

Bir müxbir geni. Reportyor geninin açıq oxu çərçivəsi tədqiq olunan genin açıq oxu çərçivəsini əvəz edir. Nəticə odur ki, reportyor geni adətən ifadə modelini diktə edən tənzimləyici ardıcıllığın nəzarəti altında yerləşdirilir (daha çox. )

Bir genin hansı hüceyrələrdə ifadə olunduğunu bilməklə yanaşı, genin kodlaşdırdığı zülalın olduğu hüceyrə daxilindəki mövqeyi tapmaq çox vaxt faydalıdır. Məsələn, gen funksiyası ilə bağlı əsas məlumatlar protein məhsulunun mitoxondridə, nüvədə və ya hüceyrə səthində yerləşdiyini göstərməklə əldə edilə bilər. Reportyor genlər burada kömək edə bilməz, çünki genin yuxarı axınında olan DNT ardıcıllığı - reportyor genin bağlı olduğu ardıcıllıq - protein məhsulunun düzgün hüceyrədaxili yerinin hədəflənməsində iştirak etmir. Bunun əvəzinə vacib olan zülalın özünün amin turşusu ardıcıllığıdır. Buna görə zülalın harada olduğunu təyin etməyin yeganə yolu onu birbaşa axtarmaqdır. Bu, maraq doğuran zülal üçün spesifik olan və bu zülala bağlanan antikordan istifadə edən immunositokimya ilə edilir. Antikor etiketlənmişdir ki, onun hüceyrədəki mövqeyi və deməli, hədəf zülalın mövqeyi vizuallaşdırıla bilsin (Şəkil 7.21). Alternativ olaraq aşağı rezolyusiyaya malik tədqiqatlar üçün flüoresan etiketləmə və işıq mikroskopiyası istifadə olunur, yüksək ayırdetmə immunositokimyası kolloid qızıl kimi elektron sıx etiketdən istifadə edərək elektron mikroskopiya ilə həyata keçirilə bilər.

Şəkil 7.21

İmmunositokimya. Hüceyrə mavi floresan markerlə işarələnmiş bir antikorla müalicə olunur. Hüceyrənin tədqiqi göstərir ki, flüoresan siqnal daxili mitoxondrial membranla əlaqələndirilir. Buna görə işləyən bir fərziyyə (daha çox.)


ORF nədir?

Açıq oxu çərçivəsi və ya ORF başlanğıc kodonu ilə başlayan və dayanma kodonu ilə bitən nukleotid ardıcıllığının davamlı uzanmasıdır. Sadə sözlə, ORF başlanğıc və dayanma kodonları arasında yerləşən nukleotid ardıcıllığının bölgəsinə aiddir. Arada ORF-ni kəsən heç bir dayanma kodonu yoxdur. Başlanğıc və dayanma kodonu arasındakı nukleotid ardıcıllığı amin turşularını kodlayır. Ümumiyyətlə, başlanğıc kodonu ATG, dayanma kodonları isə TAG, TAA və TGA-dır. ORF transkripsiya və tərcümə zamanı funksional zülal verir. Beləliklə, ORF bir başlanğıc kodonu, orta bölgədəki bir neçə kodon və dayanma kodonu ehtiva edir. Maraqlıdır ki, ORF üçə bölünə bilən uzunluğa malikdir.

Şəkil 02: Oxu çərçivəsini açın

Prokaryotlarda intronlar olmadığı üçün ORF birbaşa mRNT-yə transkripsiya edən genin kodlaşdırma ardıcıllığıdır. Buna görə də, CDS və PRF prokaryotlarda eynidir. Prokaryotlarda genləri axtararkən, ORF-ni aşkar etmək və prokaryotlarda bir gen tapmaq asandır. Eukariotlarda, intronlar olduğundan, ORF emaldan və ya RNT-nin birləşdirilməsindən sonra əmələ gələn kodon ardıcıllığıdır. ORF, uzun ORF bir genin bir hissəsi ola biləcəyi üçün gen proqnozlaşdırılmasına kömək edən bir sübutdur.


Açıq Oxu çərçivələri və kodlaşdırma ardıcıllığı (CDS), bunlar fərqlidirmi? - Biologiya

Nəzərə alın ki, bu Lüğətdir işlər davam edir. Çatışmayan terminlərlə qarşılaşırsınız və ya təriflər təklif etmək istəyirsiniz, zəhmət olmasa bizə bildirin.

  • 3'qaydası bütün təsvirlər üçün istinad ardıcıllığının mümkün olan ən çox 3' mövqeyi özbaşına dəyişdirilmiş kimi təyin edilir. ATTTG ATTG HGVS-ə dəyişdikdə bunu 4-cü mövqedə T-nin dəyişməsi kimi təsvir edir (2 və ya 3-cü mövqedə T deyil)
  • eyni genin allel variant formaları (MESH) HGVS: bir xromosomda bir sıra variantlar. təsvirlər Tövsiyələrə baxınDNT, RNT və ya protein.
  • amin turşusu zülal kodunun hərfi (Standartlara baxın).
  • xüsusi dəyişdirilmiş nukleotidin əlavə olunduğu transkriptin (5' ucu) birinci nükleotidi.
  • qırılma nöqtəsi genomik yenidən qurulma nəticəsində istinad ardıcıllığında müxtəlif mövqelərdə olan iki ardıcıllığın birləşdirildiyi yer (Struktur Variant)
  • cDNA cDNA, "nüsxə DNT" və ya "tamamlayıcı DNT", əks transkriptaza fermenti (Wikipedia, MESH) istifadə edərək sintez edilmiş tək zəncirli RNT molekulunun DNT surətidir. QEYD: cDNA “kodlayan DNT” ilə eyni deyil (aşağıya bax).
  • CDS kodlayan DNT ardıcıllığı, amin turşusu ardıcıllığına (zülal) çevrilmiş ardıcıllıq.
  • kimerizm müxtəlif ardıcıllıqla (MESH əsasında) müxtəlif ziqotlardan törəmiş iki və ya daha çox hüceyrə populyasiyasının bir fərdində meydana gəlməsi. Mozaizmin əksi. təsvirlər Ümumi/İstifadə olunan simvollara baxın.
  • cis iki variantdır "cis-də" eyni alleldə olduqda (DNT molekulu, xromosom).
  • CNV nüsxə nömrəsi variantı (CNV), genomdakı bir variant, burada DNT-nin böyük bir hissəsinin nüsxələrinin sayı istinad genomunda bir nüsxənin olmaması (silinməsi) və ya bir dəfədən çox ola biləcəyi (dublikat, üçqat, ..., və ya gücləndirilmiş). QEYD: "böyük uzanma" dəqiq müəyyən edilmir, lakin adətən ən azı bir genin ekzonunu və ya 1000 nukleotidi və ya daha çoxunu əhatə edir. ləqəb CNP (nüsxə nömrəsi polimorfizmi)
  • DNT-ni kodlayan bir genomun seqmentləri və ya bir zülalı kodlayan bir transkript (RNT molekulu) seqmenti.
  • DNT istinad ardıcıllığını kodlayan DNT istinad ardıcıllığı (İstinad ardıcıllığına baxın), "c" istifadə edərək nukleotidlərin nömrələnməsi üçün istifadə edilə bilən bir genin zülal kodlayan transkriptinə əsaslanır. prefiks. Belə bir istinad ardıcıllığına kodlaşdırma DNT ardıcıllığı (CDS) və 5' və 3' UTR bölgələri daxildir. QEYD: kodlayan DNT istinad ardıcıllığıdır yox cDNA ardıcıllığı (yuxarıya bax)
  • kompleks HGVS: istinad ardıcıllığı ilə müqayisədə əsas variant növlərindən biri kimi təsvir edilə bilməyən bir sıra dəyişikliklərin baş verdiyi ardıcıllıq dəyişikliyi (əvəzetmə, silmə, təkrarlama, daxil etmə, çevirmə, inversiya, silmə-yerləşdirmə və ya təkrar ardıcıllıq) .
  • hallarda istifadə edilən mürəkkəb heterozigot autosomal resessiv müəyyən bir lokusda hər iki alleldə xəstəliyə səbəb olan variantların olduğu xəstəlik eyni deyil (əksinə homozigot)
  • çevrilmə HGVS-DNT: istinad ardıcıllığı ilə müqayisədə bir sıra nukleotidlərin genomun başqa yerindən bir ardıcıllıqla əvəz edildiyi ardıcıllıq dəyişikliyi. QEYD: çevirmə variantları Silinmə-Daxiletmə kimi təsvir edilir (bax DNT və ya RNT).
  • Crick strand bax plus (+) strand.
  • silinmə
    • DNT kodunun bir və ya bir neçə hərfi yoxdur (silinmişdir). Silinmə a istifadə edərək göstərilir "del"
    • HGVS-DNT: istinad ardıcıllığı ilə müqayisədə bir və ya daha çox nukleotidin olmadığı (silinmiş) ardıcıllığın dəyişməsi. təsvirlər Tövsiyələrə baxınDNT, RNT və ya protein.
    • DNT kodunda bir və ya bir neçə hərf yoxdur və bir neçə yeni hərflə əvəz olunur
    • HGVS-DNT: istinad ardıcıllığı ilə müqayisədə bir və ya bir neçə nukleotidin bir və ya bir neçə digər nukleotidlə əvəz edildiyi və əvəzetmə, inversiya və ya çevrilmə olmayan ardıcıllığın dəyişməsi. Tövsiyələrə baxınDNT, RNT və ya protein.
    • DNT kodunun bir və ya daha çox hərfi iki dəfə mövcuddur (ikiqat, dublikat)
    • HGVS-DNT: istinad ardıcıllığı ilə müqayisədə bir və ya daha çox nukleotidin nüsxəsinin həmin ardıcıllığın orijinal nüsxəsinin birbaşa 3'-ə daxil edildiyi ardıcıllıq dəyişikliyi. QEYD: diaqnostik analizlər (MLPA kimi) adətən aşkar edir əlavə surəti müəyyən bir ardıcıllıqla. Əlavə nüsxənin dublikat və ya əlavə olub-olmaması hələ müəyyən edilməkdədir. təsvirlər Tövsiyələrə baxınDNT, RNT və ya protein.
    • DNT, RNT və ya amin turşusu kodunda bir və ya bir neçə hərf yenidir (daxil edilmişdir)
    • HGVS-DNT: istinad ardıcıllığı ilə müqayisədə bir və ya daha çox qalığın daxil edildiyi və daxiletmənin dərhal yuxarıdakı ardıcıllığın surəti olmadığı ardıcıllıq dəyişikliyi. təsvirlər Tövsiyələrə baxınDNT, RNT və ya protein.
    • kodonun fərqli bir amin turşusunun daxil olmasını yönləndirən birinə dəyişdirildiyi variant (MESH əsasında).
    • HGVS: istinad ardıcıllığı ilə müqayisədə bir amin turşusunun digər amin turşusu ilə əvəz olunduğu zülal ardıcıllığında bir variant.
    • HGVS: çaşdırıcı termin, istifadə etmə, istifadə variant (Əsaslara baxın)
    • biologiya: ardıcıllığın dəyişməsi
    • dərman: ardıcıllıq variantı əlaqəli xəstəlik fenotipi ilə.
    • amin turşusunu təyin edən kodonu dayanma kodonuna dəyişdirən variant (MESH-ə əsaslanan son kodon).
    • HGVS: istinad ardıcıllığı ilə müqayisədə bir amin turşusunun translyasiya dayandırıcı kodonu (xitam kodonu) ilə əvəz edildiyi zülal ardıcıllığında bir variant.
    • polimorfizm QEYD: xahiş edirəm bu termindən istifadə etməyin Terminologiyaya baxın.
      • HGVS: çaşdırıcı termin, istifadə etmə, istifadə variant (Əsaslara baxın)
      • biologiya: populyasiyada 1% və ya daha yüksək tezlikdə mövcud olan ardıcıllıq variantı
      • dərman: ardıcıllıq variantı əlaqəli deyil xəstəlik fenotipi ilə
      • kodlanmış zülalın amin turşusu ardıcıllığını dəyişməyən DNT ardıcıllığında bir variant (MESH əsasında).
      • HGVS: istinad ardıcıllığı ilə müqayisədə DNT ardıcıllığının dəyişdiyi, lakin kodlaşdırılmış amin turşusunun olmadığı zülal ardıcıllığında amin turşusu qalığı.
      • DNT, RNT və ya amin turşusu kodunun bir hərfi başqa bir hərflə əvəz olunur (əvəz edilir).
      • HGVS-DNT: istinad ardıcıllığı ilə müqayisədə bir qalığın digər bir qalıq ilə əvəz edildiyi ardıcıllığın dəyişməsi. təsvirlər Tövsiyələrə baxınDNT, RNT və ya protein.
      • xromosomun qırılması və parçalanmış hissəsinin qeyri-homoloji xromosoma köçürülməsi ilə xarakterizə olunan xromosom anomaliyası (MESH əsasında)
      • HGVS: istinad ardıcıllığı ilə müqayisədə, spesifik nukleotid mövqeyindən (qırılma nöqtəsi) yuxarıdakı bütün nukleotidlərin başqa bir xromosomdan, sonra aşağı axından əmələ gəldiyi ardıcıllığın dəyişməsi QEYD: iki xromosom qırıldığında və fraqmentlər homoloji olmayan xromosomla yenidən birləşdikdə translokasiya baş verir. (Qarşılıqlı) translokasiyanın tam təsviri 2 hissədən ibarətdir, biri birinci qovşağı, ikincisi digər birləşməni (məsələn, 4X xromosom qovşağı və X4 xromosom qovşağı) təsvir edir.
      • translokasiya, DNT ardıcıllığının bərabər mübadiləsi ilə və heç bir seqment silinməmiş və ya təkrarlanmayan translokasiyanı balanslaşdırılmışdır
      • translokasiya, DNT ardıcıllığının və seqmentlərinin qeyri-bərabər mübadiləsi ilə balanssız translokasiya silinir və ya təkrarlanır

      Tarix

      Versiyalaşdırma

      Xarici linklər

      • İnsan Genomu Variasiya Cəmiyyəti
      • İnsan Variome Layihəsi
      • İnsan Genom Təşkilatı

      Bizimlə əlaqə saxlayın

        HGVS nomenklaturası ilə bağlı müzakirələr onları daha da təkmilləşdirmək üçün zəruridir. Bu səhifələrdə sadalananlar tövsiyələrin cari konsensusunu əks etdirir. Biz hər kəsi bizə sual, şərh və ya hələ əhatə olunmamış hallara dair nümunələr göndərməyə dəvət edirik və bunları necə təsvir etmək təklifi ilə ( E-poçt:VarNomen @ HGVS.org). Xüsusi suallar üçün qeyd etməyi unutmayın istinad ardıcıllığı istifadə!
        Bizi Facebook-da izləyin

      Kodon və Antikodon arasındakı fərq

      Məkan

      Kodon: Kodon mRNT molekulunda yerləşir.

      Antikodon: Antikodon tRNT molekulunda yerləşir.

      Tamamlayıcı Təbiət

      Kodon: Kodon DNT-dəki nukleotid üçlüyü üçün tamamlayıcıdır.

      Antikodon: Antikodon kodonu tamamlayır.

      Davamlılıq

      Kodon: Kodon mRNT-də ardıcıl olaraq mövcuddur.

      Antikodon: Antikodon tRNA-larda fərdi olaraq mövcuddur.

      Funksiya

      Kodon: Kodon amin turşusunun yerini təyin edir.

      Antikodon: Antikodon müəyyən edilmiş amin turşusunu kodon vasitəsilə gətirir.

      Nəticə

      Kodon və antikodon, tərcümə zamanı funksional zülal sintez etmək üçün amin turşularının düzgün ardıcıllıqla yerləşdirilməsində iştirak edir. Onların hər ikisi nukleotid üçlüyüdür. Bir polipeptid zəncirinin sintezi üçün lazım olan iyirmi əsas amin turşusunu təyin edən altmış bir fərqli kodon tapıla bilər. Beləliklə, altmış bir kodon ilə tamamlayıcı əsas cütü yaratmaq üçün altmış bir fərqli tRNA tələb olunur. Lakin yırğalanan baza cütləşməsinin olması səbəbindən tələb olunan tRNA-ların sayı otuz birə endirilir. Kodonla antikodon tamamlayıcı əsas cütləri universal xüsusiyyət kimi qəbul edilir. Buna görə kodon və antikodon arasındakı əsas fərq onların tamamlayıcı təbiətidir.

      İstinad:
      "Genetik kod". Vikipediya, pulsuz ensiklopediya, 2017. Əldə edilib 03 mart 2017
      “Transfer RNT”. Vikipediya, pulsuz ensiklopediya, 2017. Əldə edilib 03 mart 2017

      Şəkil Nəzakət:
      “Reading Frame” Hornung Ákos tərəfindən – Commons Wikimedia vasitəsilə öz işi (CC BY-SA 3.0)
      “RNA-codon” Orijinal yükləyici İngilis Vikipediyasında Sverdrup olub – en.wikipedia-dan Commons., Public Domain) Commons Wikimedia vasitəsilə köçürülüb
      Commons Wikimedia vasitəsilə NIH tərəfindən 󈫶 chart pu” – (İctimai Sahə)
      “Ribosome” Pluma tərəfindən – Commons Wikimedia vasitəsilə öz işi (CC BY-SA 3.0)
      “TRNA-Phe maya 1ehz” Yikrazuul tərəfindən – Commons Wikimedia vasitəsilə öz işi (CC BY-SA 3.0)

      Müəllif haqqında: Lakna

      Molekulyar Biologiya və Biokimya üzrə məzun olan Lakna, Molekulyar Bioloqdur və təbiətlə əlaqəli şeylərin kəşfinə geniş və böyük maraq göstərir.



Şərhlər:

  1. Kek

    Mesajı səlahiyyətli :), idraklı ...

  2. Izaak

    I know how to act ...

  3. Mazujas

    Üzr istəyirəm, amma fikrimcə, səhv idilər. Bunu sübut edə bilərəm.

  4. Gerrit

    I know what to do)))

  5. Senna

    Çox maraqlı bir mövzu



Mesaj yazmaq