Məlumat

Traxeyanın bu elektron mikroskop görüntüsündə qığırdaq lövhəsi haradadır?

Traxeyanın bu elektron mikroskop görüntüsündə qığırdaq lövhəsi haradadır?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Həm də necə deyə bilərdiniz? Sizə yalnız qığırdaq şəklinin göstərildiyini fərz etsək, onu necə müəyyən edərdiniz?


SEM şəkillərinin kəmiyyət fotoqrammetrik analizi və keyfiyyət stereoskopik analizi

Bu məqalə elektron mikroskop (SEM) görüntülərindən üçölçülü (3D) məlumat əldə etmək üsullarına aiddir. Təəccüblü ola bilər ki, bu mövzu ayrıca müzakirəyə layiqdir, çünki ikincili elektron emissiya rejimindən istifadə edən kobud səthin hər bir SEM görüntüsünün aydın 3D məlumat verdiyi ümumiyyətlə qəbul edilir. Bu, müəyyən dərəcədə doğrudur, çünki SEM təsvirləri bir istiqamətdən gələn işıqla işıqlandırılan kobud səthlərin fotoşəkilləri ilə müqayisə oluna bilər, lakin burada bizim əsas narahatlığımız stereoskopik görüntü cütlərinin 3D vizuallaşdırılması olacaq. Bununla belə, hətta SEM-də 3D məlumatı əldə etməyin başqa yolları var və bunlar ilk növbədə nəzərdən keçirilir. Məqalənin qalan hissəsi əsasən stereoskopik paralaksların istifadəsi ilə əlaqədardır, onlar vizual olaraq göstərilib-görünməsə də. Stereo-cütlərə baxmaq üçün ümumi istifadə edilən üsullar, sonra isə stereoskopik paralaksların ölçülməsi üçün sadə üsullar təsvir edilmişdir. İki fotoşəkildə xətti ölçüləri real hündürlük fərqlərinə endirmək üçün düsturlar verilmişdir.


Ağciyərin embriologiyası və histologiyası

Bu təqdimat ağciyərlərin inkişafını və histologiyasını anlamaq məqsədi ilə hazırlanmışdır.

Əlaqədar Kitablar

Scribd-dən 30 günlük sınaq ilə pulsuz

Əlaqədar Audiokitablar

Scribd-dən 30 günlük sınaq ilə pulsuz

Bronxlar və bronxiollar ümumiyyətlə eyni budaqlanan ağac quruluşunu izləyən qan damarları ilə əlaqələndirilir. Arteriyalara, o cümlədən etiketlənmiş arteriyanın solunda olan kiçik arteriyaya, həmçinin sağ altda bronxiolun altından keçən arteriolaya diqqət yetirin. Unutmayın ki, alveolları ayıran nazik divarlara kapilyarlar şəbəkəsi daxildir.

Qan damarlarda saxlanılıb, buna görə də qırmızı qan hüceyrələrinin nəzərə çarpan olması alveolyar kapilyarların yerini aşkar etməyə xidmət edir.

Hər bir alveol divarı hər bir açıq səthi əhatə edən sadə skuamöz epitelə malikdir, nazik kapilyar stroma və aralarında sıxışdırılmış zərif dəstəkləyici birləşdirici toxuma. Bu təsvirdə bu detallar aydın şəkildə həll edilə bilməz.
Alveol divarındakı düz nüvələr ya I tip pnevmositləri (skuamöz hüceyrələr) və ya kapilyar endoteli təmsil edir. Dəyirmi nüvələr Tip II pnevmositləri (səthi aktiv maddə ifraz edən böyük alveolyar hüceyrələr) təmsil edə bilər.
Dolaşan qanın monositləri alveol kapilyarlarından sürünərək alveol epitelini keçərək alveolyar hava boşluğuna daxil ola bilər.


NƏTİCƏLƏR

Transgen siçanların hazırlanması

Üçün hədəflənmiş alleli olan transgen siçanların bir xətti Col11a2 (Liu et al., 1996) ES hüceyrələrində homoloji rekombinasiya yolu ilə, 8-dən 41-ə qədər intronu əhatə edən konstruksiyadan istifadə etməklə hazırlanmışdır. Col11a2 gen (Şəkil 1). neomisin geni (neo) fosfogliserat kinaz promotoru tərəfindən idarə olunan 27 və 28-ci eksonlarda iki məhdudlaşdırma yeri arasında əks istiqamətə daxil edildi ki, o, iki ekzondan ardıcıllıqla birləşdirildi. Null allel üçün heterozigot siçanlar Southern blot analizi ilə göstərildiyi kimi homozigot siçan yaratmaq üçün yetişdirildi (Şəkil 2A). Homoziqot siçanların xifoid qığırdaqından təcrid olunmuş xondrositlərdən mRNT-nin Northern blot analizi tam uzunluqlu mRNT-nin olmadığını nümayiş etdirdi. Col11a2 (Şəkil 2B). Bununla belə, 4.2 kb və 3.8 kb-lik ən azı iki qısa RNT transkriptinin 62-ci eksondan 65-ə qədər olan ardıcıllıqlarını ehtiva edən zondla hibridləşdirilmişdir. Col11a2 gen. Transkripsiya, buna görə də, icad edilmiş vasitəsilə davam edə bilər neo, lakin mRNT qeyri-sabitdir, ehtimal ki, ters çevrilmiş daxil olması səbəbindən neo transkriptlər daxilində ardıcıllıq (Culbertson, 1999). Əks transkriptaza-polimeraza zəncirvari reaksiyası (RT-PCR) bud sümüyü epifiz qığırdaqından olan ümumi RNT-də irəli primer 23-cü ekzona və əks primer ekson 29-a yönəldildi. Ölçüləri 1,0 kb-dan 1,4 kb-a qədər dəyişən dörd zolaq , təqribən 1,5 kb gözlənilən ölçüdə tək bir zolaqdan daha çox PCR-dən sonra əldə edilmişdir. Dörd bandın hamısı klonlandı və tamamilə ardıcıllıqla sıralandı. Nəticələr göstərdi ki, ekzon 26-nın 3′-ucu ardıcıl olaraq neomisinə davamlı genin 3′-ucunun 71-bp aşağı axınında yerləşən eyni A/B sərhədinə birləşmişdir (Şəkil 3-də A ilə işarələnmişdir). Bununla belə, dörd transkriptdən üçünün ters çevrilmiş neomisinə davamlı gen daxilində ardıcıllığın əlavə daxili birləşməsinə məruz qaldığı aşkar edilmişdir (H2, H3 və H4 kimi təyin edilmişdir Şəkil 3). Bütün birləşmə hadisələri GT/AG konsensus dinukleotidləri arasında yerləşirdi. Bütün dörd transkript hər üç çərçivədə ya G ilə işarələnmiş ardıcıllıqda, ya da aşağı axın polilinker ardıcıllığında vaxtından əvvəl bitirmə kodonlarını ehtiva edirdi. Buna görə də tərcümə tərsinə çevrilmişdən kənara çıxa bilmir neo daxil edilməsi. olduğuna dair heç bir dəlil tapmadıq neo ardıcıllıq transkriptlərdən və ya əvvəllər üçün təsvir edildiyi kimi digər birləşmə hadisələri üçün tamamilə birləşdirilə bilər neo ardıcıllıqlar (Forsberg et al., 1996).

Müvafiq bölgənin sxemi Col11a2 gen, hədəf vektor və mutant Col11a2 homoloji rekombinasiyadan sonra gen. Hədəfləndirici vektor üçün genomik fraqment intron 8-dən intron 41-ə yayıldı. TK, herpes simplex timidin kinaz geni neo, neomisinə davamlı gen E, X və B, məhdudlaşdırma saytları EkoRI, Xol, və Bamsalam.

A: Heterozigot və homozigot transgen siçanları müəyyən edən Southern blot analizi. Prob bir idi Ekoİntron 41-dən intron 49-a qədər uzanan RI fraqmenti (Şəkil 1 və mətnə ​​baxın). B: Vəhşi tipli və homozigot siçanlardan qığırdaq RNT-nin Northern blot analizi. Xiphoid qığırdaq siçanlardan parçalandı və xondrositlər toxumanın enzimatik həzmi ilə əldə edildi. Ümumi RNT hasil edildi və a istifadə edərək Northern blot analizi ilə təhlil edildi HindIII/Bam62-65 eksonları kodlayan HI cDNA fraqmenti.

23 və 29-cu ekzonlarda yerləşən primerlərdən istifadə etməklə homozigot siçanların qığırdaq mRNA-sında əks transkriptaza polimeraza zəncirvari reaksiyası ilə əldə edilən nəticələrin sxematik təsviri. 1,0-1,4 kb arasında dörd zolaq aşkar edildi və bu zolaqların hamısı subklonlaşdırıldı və ardıcıllıqla sıralandı. Homoziqot siçanların bütün Col11a2 transkriptlərində, 26-cı ekzonun 3′-ucunun ters çevrilmiş neomisinə davamlı genin 3′-ucundan (H1-H4 təyin olunur) təxminən 71 nukleotidin aşağı axınında akseptor sahəsinə birləşdiyi aşkar edilmişdir. . Transkriptlərin üçündə ters çevrilmiş neomisinə davamlı genin (H2, H3 və H4) kodlaşdırma ardıcıllığının daxili birləşməsi də var idi.

Bunu təsdiqləmək üçün Col11a2 allel təsirsizləşdirildi, qabırğa qığırdaqları 1 aylıq vəhşi tipli və homozigot transgen siçanlardan parçalandı, toxuma pepsinlə həzm olundu və kollagen komponentlər natrium dodesil sulfat poliakrilamid gel elektroforezi (SDS-PAGE) ilə yoxlanıldı. XI tip kollagen. Şəkil 4, B zolağında göstərildiyi kimi, V/XI tipli kollagenin α1(XI) və ya α1(V) zənciri hələ də mövcud idi. Lakin α2(XI) zənciri yox idi. α3(XI) zənciri normal miqdarda sintez edilmiş kimi görünən bol α1(II) zəncirindən ayrılmadı.

Natrium dodesil sulfat-poliakrilamid gel elektroforezi 1 aylıq vəhşi tipli qabırğa qığırdaqından pepsinə davamlı kollagenin (sol) və homozigot siçanlar (sağ). Gelə bərabər miqdarda nümunə tətbiq olundu. II və XI tip kollagenlərin α-zəncirlərini müəyyən etmək üçün zülal zolaqları Coomassie mavi rəngləmə ilə vizuallaşdırıldı. Homoziqot qabırğa ekstraktında α2(XI) zəncirinin zolağı aşkar edilə bilməz.

Siçanların Fenotipi

Doğuş zamanı heterozigot siçanlar adi balalardan fərqlənmirdi. Homoziqot siçanlar normal balalardan təxminən 25% kiçik idi (8,51 g ± 1,87 SD [n = 14] və 11,1 q ± 0,85 SD [n = 6] P = 0,005). Homoziqot siçanlar da nəzarət və heterozigot balalardan tanınırdı ki, onların burnu daha qısa və alnı bir qədər qabarıq idi (Şəkil 5A). Onlar 2 yaşa qədər bir qədər kiçik bədən ölçülərində olmağa davam etdilər və daha üçbucaqlı üzləri ilə asanlıqla müəyyən edilə bilərdilər. Bu fərqləndirici xüsusiyyətlər ən çox ləkələnmiş skeletlərdə görünürdü (şək. 5B). Bununla belə, tədqiq edilmiş 200-dən çox yeni doğulmuş homozigot siçanın heç birində OSMED xəstələrində adətən müşahidə edildiyi kimi yarıq damaq yox idi (Melkoniemi et al., 2000). 4 aylıq ikən müayinə edildikdə, homozigot siçanlar yüksək səs-küyə reaksiya vermədilər, müşahidə onların eşitmə çatışmazlığı olduğunu göstərir. Sonradan, kliklə səslənən eşitmə beyin sapı cavab testi bunu təsdiqlədi və çatışmazlığın struktur əsasının tektorial membranın qeyri-mütəşəkkil kollagen fibrillərindən yarandığı görünürdü (McGuirt et al., 1999). Gözün və ya digər əsas orqanların açıq-aşkar anormallıqları yox idi.

A: Üz fərqlərini göstərmək üçün normal və homozigot siçanların fotoşəkilləri. B: Yeni doğulmuş vəhşi tip (+/+), heterozigot (+/-) və homozigot siçanların (-/-) boyanmış skeletləri. Homoziqot siçanın üz fərqlərinə diqqət yetirin. C: Vəhşi tipli və homozigot siçanların kəllələrinin görünüşü. Homoziqot siçanın kəllə sümüyünün daha dik yamacına və burun sümüklərindəki girintilərə (ox) diqqət yetirin. D: 1 yaşlı vəhşi tip (+/+) və homozigot (-/-) siçanların kəllələrinin dorsal tərəflərində sümüklərin uzunluq-enlik nisbətlərinin müqayisəsi. Hər bir məlumat nöqtəsi yeddi kəllədən orta ± SEM-i təmsil edir. Sümüklər arxadan (INT) önə (NAS) düzülür. Burun sümüyü üçün nisbət fərqi əhəmiyyətlidir P ≤ 0,001 və homozigot kəllədəki sümüyün daha qısa uzunluğundan yaranır. INT, interparietal sümük PAR, parietal sümük FRO, frontal sümük PRE, premaxillae NAS, burun sümüyü.

Kraniofasiyal morfologiya

1 yaşlı siçanların kəllə sümüklərinin ümumi anatomik müşahidəsi homozigot siçanların burun sümüklərinin daha maili və onların medial səthlərinin tez-tez depressiyaya uğradığını aşkar etdi (Şəkil 5C ox). Beləliklə, in situ, iki bitişik burun sümüyü nəzərə çarpan bir depressiya yaratdı. Homoziqot siçanların burun sümüyünün uzunluğu və eni nisbətləri vəhşi tiplə müqayisədə əhəmiyyətli fərq göstərdi, lakin kəllənin digər sümükləri (interparietal, parietal, frontal və premaxillae sümükləri) əhəmiyyətli dərəcədə təsirlənmədi (Şəkil 5D).

1 yaşlı siçanların kəllə sümüyünün tac hissələrində burun sümüklərinin girinti və formasındakı fərq aydın şəkildə tanınırdı (Şəkil 6A,C). Homoziqot yenidoğulmuşların tac hissələrində (Şəkil 6D), burun sümükləri, xüsusilə də vəhşi tip siçanların kəsikləri ilə müqayisədə inkişaf edən burun septumundan yaranan Y-şəkilli qığırdaqlara doğru dərindən oyaqlanmışdır (Şəkil 6B). Burun sümüyü membrandaxili ossifikasiya ilə inkişaf edir, lakin onun forması bitişik qığırdaq tərəfindən müəyyən edilir (Şəkil 6B,D). Homoziqot siçanlarda burun sümüyünün uzunluğu, yamacı və girintisindəki fərqlər, buna görə də, burun sümüklərinin formalaşması üçün şablon rolunu oynayan qığırdaq şəklindəki fərqlərlə izah edilə bilər (Şəkil 6B, D).

A,C: 1 yaşında vəhşi tipli və homozigot siçanların ön kəllə sümüyünün tac hissəsi. Homoziqot siçanda iki burun sümüyünün (N) əmələ gətirdiyi açıq depressiya görünür, ön çənə sümüyü (P) isə təsirsiz görünür. B,D: Yenidoğulmuş siçanlarda burun sümüklərinin (N) inkişafı, burada septal qığırdaq (S) şablon kimi çıxış edir. Qeyd edək ki, burun sümükləri homozigot siçanda daha aşağı proyeksiya edir. NA, burun boşluğu.

Uzun sümüklərin morfologiyası

Doğuşdan 1 ay sonra yabanı tipli və homozigot siçanlardan diz oynaqlarının parafinlə gömülü bölmələri hazırlanmışdır. Bu bölmələrin tədqiqi homozigotda xondrositlərin sütunlarda düzülməməsi ilə birlikdə dərin nizamsız böyümə lövhəsini göstərdi (Şəkil 7B,D). Oxşar nəticələr araşdırılan bütün digər böyümə lövhələri üçün də tapıldı. Vəhşi tipdə böyümə plitələri xondrositlərin uzununa sütunlarda düzülməsi ilə yaxşı təşkil edilmişdir ki, fərdi istirahət, çoxalma və hipertrofik zonalar asanlıqla tanınsın (Şəkil 7A, C). Bunun əksinə olaraq, α2(XI) olmayan homozigot siçanların böyümə lövhəsi tamamilə qeyri-mütəşəkkil göründü və daha yaxından araşdırıldıqda bəzi xondrositlərin nüvələri piknotik göründü. Bununla belə, hipertrofik xondrositlər tez-tez proliferasiya edən təbəqənin bir az altında müşahidə edilə bilər ki, bu da xondrositlərin terminal diferensiasiyasının normal davam edə bildiyini göstərir. Tibial oynaq qığırdaqları vəhşi tipdən orta hesabla daha nazik idi (Şəkil 7E, F ilə müqayisə edin). Eyni 1 aylıq bütün oynaq qığırdaqları üçün müşahidə edildi (bax. Şəkil 9). Bundan əlavə, homozigot siçanların oynaq qığırdaqının xondrositləri daha təsadüfi şəkildə təşkil edilmişdir (Şəkil 7E və 7F ilə müqayisə edin). Böyümə boşqabının ötürülməsi elektron mikroskopiyası həm vəhşi tipli, həm də homozigot transgen siçanlarda hüceyrələrin sütunları arasında tez-tez düzülmüş incə kollagen liflərinin mövcudluğunu göstərdi (Şəkil 8A, B). Homoziqot siçanın kollagen fibrilləri daha əvvəl tektorial membranda müşahidə edildiyi kimi vəhşi tipli siçana nisbətən yanal massivlərdə daha az təşkil edilmişdi (McGuirt et al., 1999). Proliferativ zonanın bəzi sahələrində fibrillər bir-biri ilə sıx əlaqəyə girərək elektron sıx bağlamalar əmələ gətirir (şəkil 8C). Ancaq fibrilyar kollagenin böyük aqreqatlarının meydana gəlməsi üçün izah edildiyi kimi cho/cho siçan baş vermədi (Li et al., 1995).

Vəhşi tipdən 1 aylıq postpartum tibial epifizlərin histoloji təhlili (A, C, E) və homozigot siçanlar (B,D,F). Vəhşi tipli siçanda (+/+) yaxşı təşkil olunmuş böyümə lövhəsində istirahət, çoxalma və hipertrofik təbəqələr var. Homoziqot (-/-) siçanda xondrositlərin sütunları düzgün uyğunlaşa bilmir və hüceyrələr qeyri-mütəşəkkil görünür və çox vaxt təsadüfi çoxluqlar əmələ gətirir. E və F: Oynaq qığırdaqlarında xondrositlərin təşkilindəki fərqə diqqət yetirin. Vəhşi tip yaxşı təşkil olunmuş matris əmələ gətirir, homozigot heyvanda isə oynaq qığırdaqları daha incədir və hüceyrələr bir qədər qeyri-mütəşəkkil görünür. Ölçək çubuqları = B-də 125 μm (A,B-yə aiddir), D-də 50 μm (C,D-yə aiddir), E-də 25 μm (E,F-ə aiddir).

Vəhşi tipdə (+/+) bud sümüyü böyümə plitəsinin ötürülmə elektron mikroskopiyası (doğuşdan sonrakı 1 ay)A) və homozigot (-/-) transgen siçan (B,C). A və B xondrositlərin iki sütunu arasında böyümə plitəsinin proliferativ zonasında yerləşən müqayisəli bölgələri göstərir. A-da fibrillərin paralel düzülməsinə və B-də bir qədər daha az sifarişli fibrillərə diqqət yetirin. C, xondrositlərin yüksək dərəcədə nizamsız olduğu proliferativ zonanın nümayəndəsi sahəsidir. Diqqət yetirin ki, fibrillər tez-tez elektron sıx paketlər yaratmaq üçün yan tərəfdən sıx bağlıdırlar. Ölçək çubuqları = 500 nm

Biz əlavə olaraq siçanların bud sümüyü hissələrini 15,5 gün, 17,5 gün, yenidoğulmuşda və doğumdan sonra 1 həftə, 2 həftə və 4 həftədə araşdırdıq. Fərqli bir böyümə plitəsinin meydana gəlməsindən əvvəl, xondrositlər sütunlarda düzülmür və vəhşi tip və homozigot müqayisə edildikdə nəzərəçarpacaq dərəcədə nizamsız deyildi. Bununla belə, doğumdan sonra 1, 2 və 4-cü həftələrdə xondrositlərin təşkilinin olmaması daha aydın şəkildə tanınmağa başladı və 4 həftədə böyümə plitəsinin tam formalaşmasından sonra ən çox nəzərə çarpdı (nəticələr təqdim edilmir). Bir əza daxilində, bütün böyümə plitələri homozigotlarda oxşar nizamsızlıq göstərdi. Buna görə də, görünür ki, α2(XI) zənciri hər bir böyümə plitəsinin kollagen fibrillərinin düzgün təşkili üçün tələb olunur, lakin xondrogenezin erkən mərhələlərində kritik rol oynaya bilməz.

Xondrositlərin differensiasiyasını qiymətləndirmək üçün biz yeni doğulmuş tibia üzərində in situ hibridləşdirmə apardıq. Col1a1, Col2a1, Col10a1, Col11a1, və Col5a1. Bu kollagen genləri üçün tədqiq edilmiş bütün problar vəhşi tipli və ya homozigot siçanların tibiasında eyni ifadə nümunələrini göstərdi, α1(V) kollagen zənciri qığırdaqda deyil, inkişaf edən sümük və sümük yaxasında ifadə edildi (Şəkil 9H, J). Tip X kollagen yalnız hipertrofik qığırdaqda ifadə edildi (Şəkil 9C,F). Əlavə olaraq, II tip kollagenə və X tip kollagenə qarşı antikorlarla immunohistokimyəvi boyanma həyata keçirdik. Tip II kollagen böyümə plitəsinin qığırdaqlı bölgəsində aşkar edilmişdir, lakin X tipli kollagen həm vəhşi tipli, həm də homozigot siçanlarda yalnız hipertrofik təbəqədə aşkar edilmişdir (məlumatlar təqdim edilmir). Beləliklə, böyümə plitəsi nəzərəçarpacaq dərəcədə qeyri-mütəşəkkil olsa da, xondrositlər, buna baxmayaraq, hipertrofiyaya doğru gedirlər.

Tibial böyümə lövhəsində bir neçə kollagen mRNA-nın yerində hibridləşməsi. Col1a1 (A, D) və Col5a1 (H,J) yalnız sümük yaxasında və inkişaf edən sümükdə aşkar edilir. Col2a1 (B, E) və Col11a1 (G, İ) inkişaf etməkdə olan qığırdaqların həm istirahət edən, həm də proliferasiya edən təbəqələrində aşkar edilir, lakin hipertrofik qığırdaqda deyil. Col10a1 (C,F) yalnız hipertrofik xondrositlərdə aşkar edilir. Həm vəhşi tipli, həm də homozigot siçanlarda beş kollagen mRNA üçün ifadə nümunələrində heç bir fərq tanınmadı. Ölçək çubuqları = F-də 250 μm (A-F-ə aiddir), J-də (G-J-yə aiddir).

Artikulyar qığırdaq

Biz bir neçə uzun sümükdən epifizlərin qalınlığını ölçdük, çünki ilkin müşahidələr onların homozigotlarda daha nazik olduğunu göstərirdi (Şəkil 7E və 7F ilə müqayisə edin). Bütün tədqiq edilmiş oynaq qığırdaqları (proksimal və distal femur, asetabulum, proksimal və distal humerus, glenoid fossa, proksimal dirsək və proksimal radius) homozigot siçanlarda doğuşdan 1 ay sonra orta hesabla əhəmiyyətli dərəcədə incə olmuşdur (Şəkil 10). İstər vəhşi tip, istərsə də homozigot siçanlarda oynaq səthlərinin əhəmiyyətli dərəcədə eroziyası əlamətləri yox idi. Bununla belə, homozigot siçanların oynaq qığırdaqları tez-tez xondrositlərin sütunlu şəkildə uyğunlaşmaması ilə fərqlənə bilər (Şəkil 7E, F). Bundan əlavə, homozigotların xondrositləri tez-tez təhrif olunmuş formalara malikdir. Oynaqlar 1 yaşa qədər araşdırıldı, lakin vəhşi tiplə müqayisədə homozigotlarda artroz artrozu üçün heç bir dəlil tapılmadı, bu, əvvəlki araşdırma ilə razılaşdı (Lapveteläinen et al., 2001).

1 aylıq siçanlarda oynaq qığırdaqlarının qalınlığının müqayisəsi. Homoziqot (-/-) siçanların bütün oynaq qığırdaqları vəhşi tipli (+/+) oynaqlara nisbətən daha nazik idi. Dörd cüt vəhşi tip (+/+) və homozigot (-/-) siçanların beş diz ekleminde, iki omba oynaqında, beş çiyin oynaqında və üç dirsək oynaqında oynaq qığırdaqlarının orta qalınlığı ± SD. Məlumat nöqtələri hər bir oynaq üçün cəmi 420 ölçmə üçün 14-dən 70-ə qədər ölçməni təmsil edir. Çiyin birləşməsində qığırdaq qalınlığı glenoid fossada (SG) əhəmiyyətli dərəcədə fərqlənmirdi və yalnız 90% səviyyəsində əhəmiyyətlidir (P = 0.10) humerus artikulyar səthində (SH). KF, diz oynağı, bud sümüyü HF, bud oynağı, bud sümüyü HA, bud oynağı, asetabulum SH, çiyin oynağı, humerus SG, çiyin oynağı, glenoid fossa EH, dirsək oynağı, humerus EU, dirsək oynağı, dirsək ER, dirsək oynağı, radius


Toxuma mühəndisliyi qığırdaqlarının bioloji aspektləri

Qığırdaq regenerativ təbabəti yaxşı inkişaf etmiş və kliniki tətbiq mərhələsinə çatmışdır. Müxtəlif texnikalar arasında materialşünaslıq elementlərini özündə birləşdirən toxuma mühəndisliyi yüksək klinik ehtiyaclar əsasında ciddi şəkildə araşdırılır. Polilaktid iskeledən istifadə edən qığırdaq toxumasının mühəndisliyi 3 illik müşahidə zamanı yaxşı klinik nəticələr göstərən dodaq-burun yarığı xəstələrinin müalicəsində kəşfiyyat məqsədilə istifadə edilmişdir. Bununla belə, bu müalicənin etibarlılığını artırmaq üçün təkcə toxuma mühəndisliyi məhsulların təhlükəsizliyi və faydalılığına dair klinik sübutların toplanması deyil, həm də bioloji mexanizmlər haqqında elmi məlumatların yaradılması vacib hesab olunur. Bu yazıda biz klinik praktikada qığırdaq toxumasının mühəndisliyinin son tendensiyalarını nəzərdən keçirdik, qığırdaq regenerasiyası zamanı hüceyrə və matriks dəyişiklikləri ilə bağlı eksperimental nəticələri ümumiləşdirdik və toxuma mühəndisliyi ilə həyata keçirilən qığırdağın bioloji aspektləri üzrə, xüsusən də histoloji və biokimyəvi tədqiqatlar vasitəsilə gələcək tədqiqatların əhəmiyyətini müzakirə etdik. morfoloji üsullar.

Bu, abunə məzmununun, qurumunuz vasitəsilə girişin önizləməsidir.


Giriş

Bioloji materialın təfərrüatlı struktur təşkili haqqında anlayışımız o vaxtdan bəri əsasən mikroskopik üsullarla müəyyən edilmişdir. XVIII əsrdə işıq mikroskopiyası ilə başlayan və XX əsrdə elektron mikroskopların inkişafı ilə yekunlaşan histologiyanın özü də mikroskopik texnikanın təkmilləşdirilməsi ilə yanaşı inkişaf etdi. Bu gün orqanizmlər, toxumalar və hüceyrələr haqqında ultrastruktur biliklərimizin çoxluğu əsasən ötürücü və ya skan edən elektron mikroskopiya kimi müxtəlif elektron mikroskopik yanaşmalardan əldə edilir.

Elektron mikroskopiyasının (EM) tətbiqindən bəri uyğun EM nümunəsi əldə etmək üçün çoxlu sayda nümunə hazırlama üsulları yaradılmışdır 1 – 5 . Buna baxmayaraq, ümumi tətbiq olunan protokollar bu gün hələ də çox mürəkkəbdir, zəhərli kimyəvi maddələrdən istifadə edir və nəticədə digər üsullar və onların başlanğıcdan EM məlumatları ilə əlaqəsi istisna olmaqla, əsasən elektron mikroskopiya üçün uyğun olan nümunələr əldə edilir. Bundan əlavə, həmişə belə vacib immuno-etiketləmə tədqiqatlarına EM məlumatlarının əldə edilməsindən əvvəl intensiv nümunə müalicəsindən, xüsusən də epoksi qatranlarına daxil edilməsindən irəli gələn bir sıra çətinliklər mane olur 6 , 7 . Ümumilikdə, EM bioloji nümunələr üzərində müxtəlif təcrübələr üçün əsas maneələr yaradan müəyyən kritik məhdudiyyətlərdən əziyyət çəkir.

1986-cı ildə Binnig, Quate və Gerber tərəfindən Atom Gücü Mikroskopiyasının (AFM) tətbiqi ilə 8, klassik ultrastruktur üsullarla müqayisədə müəyyən təəccüblü üstünlükləri özündə birləşdirən yeni mikroskopik yanaşma mövcud oldu. AFM ilə görüntüləmə məlumatı yaratmaq üçün nümunəyə vakuum tətbiq etmək artıq lazım deyildi, beləliklə, nəhayət, fizioloji şəraitdə bioloji materialın ultrastruktur məlumatlarını əldə etmək mümkün oldu 9, 10. Əlavə olaraq, ötürücü elektron və ya skan edən elektron mikroskopiya (TEM, SEM) ilə müqayisədə intensiv nümunə hazırlama üsullarına ehtiyac əhəmiyyətli dərəcədə azaldı. AFM-nin EM-dən əlavə üstünlükləri arasında məs. z oxu məlumatlarını dəqiq həll etmək qabiliyyəti, eləcə də güc spektroskopiyası ilə nümunənin özlü-elastik xüsusiyyətlərinə daxil olmaq imkanı.

AFM-nin EM ilə müqayisədə qeyd olunan üstünlükləri ilə yanaşı, bir təəccüblü məhdudiyyət keçmişdə bioloji nümunələrin daxili xüsusiyyətlərinin ultrastruktur məlumatlarının əldə edilməsində hələ də böyük problemlər yaradırdı. Bir topoqrafik texnika olaraq, AFM təsvir məlumatı yaratmaq üçün ölçmə zondunun maraq strukturu arasında birbaşa qarşılıqlı əlaqə yaratmalıdır. Buna görə də AFM tərəfindən bütöv orqanizmlərin, toxumaların və tək hüceyrələrin daxili morfologiyasına dair fikir əldə etmək AFM tədqiqatçıları arasında ümumi maneə olmuşdur.

Qeyd olunan problemin aradan qaldırılması EM ilə müqayisədə AFM tərəfindən bioloji nümunələrin ultrastruktur məlumatlarının əldə edilməsi ilə bağlı bacarıqlar vəd edir, məsələn. dəqiq z oxu məlumatlarına, eləcə də verilmiş nümunənin özlü-elastik xassələrinə yalnız bir neçə ad vermək üçün daxil olmaq seçimi.

Bioloji materialın daxili xüsusiyyətlərinin AFM-ni təmin etmək üçün asan və geniş tətbiq olunan polietilen qlikolun yerləşdirilməsi, ultra-bölmə və dehidrasiya protokolu işlənib hazırlanmışdır ki, nəticədə AFM ilə faktiki olaraq istənilən bioloji materialın daxili morfologiyasını ultrastruktur olaraq xarakterizə etmək imkanı əldə edilmişdir. İlkin olaraq, əldə edilən tədqiqatda tədqiq edilən nümunələr qlutaraldehid və ya paraformaldehid kimi tipik reagentlərdən istifadə etməklə sabitlənmişdir. İkincisi, nümunənin susuzlaşdırılması su/etanol seyreltmə seriyasının tətbiqi, ardınca yerləşdirmə mühiti kimi polietilen qlikolun (PEG) infuziyası ilə həyata keçirilmişdir. Standart şüşə bıçaqlarla təchiz edilmiş tipik bir ultra-mikrotomda blok bərkidildikdən və ultra-bölmə aparıldıqdan sonra, əldə edilən bölmələr örtülmüş şüşə slaydlarda hərəkətsizləşdirildi və suda həll olunan yerləşdirmə mühiti təkrar yuyulma addımları ilə tamamilə çıxarıldı. Nəhayət, nümunələr sadə hava axını texnikası ilə susuzlaşdırıldı və sonra ətraf mühit şəraitində aralıq əlaqə rejimi AFM ilə təsvir edildi.

Ən müasir AFM texnologiyasına daxil ola bilməyən elm adamlarını istisna etməmək məqsədi ilə təqdim olunan tədqiqatlarda geniş yayılmış AFM cihazları (havada fasilələrlə əlaqə rejimi) xüsusi olaraq istifadə edilmişdir. Tədqiqatın məqsədi sözügedən protokolun praktiki olaraq hər hansı bir orqanizm, toxuma və ya hüceyrə üzərində mümkünlüyünü sübut etmək üçün seçilmiş təmsilçi bioloji nümunələrə tətbiq oluna biləcəyini aydınlaşdırmaqdır.


Materiallar və metodlar

Doğma qığırdaq toxumasının hazırlanması və xarakteristikası

Doğma qığırdaq toxumasının hazırlanması

Evtanaziyadan dərhal sonra 3, 100 və 200 günlük köhnə Yeni Zelandiya Dovşanlarının (Siçuan Vilayəti Eksperimental Heyvanlar Xüsusi Komitəsi üçün Yetişdirmə Təsərrüfatı) diz oynaqlarından oynaq qığırdaq toxumaları kəsildi. Qığırdaq dilimləri ülgüc bıçağı ilə yığılmış və PBS ilə yuyulmuşdur.

Su tərkibi

Qığırdaq toxumasının yaş çəkisini (WW) ölçmək üçün toxuma səthindəki həddindən artıq nəmlik WW-ni qeyd etmək üçün elektron balansa (ME204) yerləşdirməzdən əvvəl əvvəlcə filtr kağızı ilə çıxarıldı. Eyni qığırdaq toxuması daha sonra 70°C-də 72 saat susuzlaşdırıldı və quru çəki müvafiq olaraq ölçüldü. Yenidoğulmuş, yeni doğulmuş və ya yetkin dovşanların yerli qığırdaq toxumasının su tərkibi (WW - quru çəki)/WW *100% kimi hesablanmışdır.

Mexanik qiymətləndirmə

Hər bir nümunənin mexaniki qiymətləndirilməsi nano-indenter (Piuma, Optics11, Hollandiya) istifadə edərək müəyyən edilmişdir. Effektiv gəncin modulu aşağıdakı parametrlərə uyğun məlumatlarla hesablanmışdır: zond sərtliyi 4,3 (N m -1) uc radiusu 51,0 μm.

DNT-nin kəmiyyəti

DNT-nin kəmiyyəti Quant-iT TM Picogreen TM dsDNA analiz dəstindən istifadə etməklə əldə edilmişdir. Qısaca olaraq, qığırdaq hissəcikləri sınaqlardan əvvəl 24 saat ərzində 65°C-də papain məhlulunda (0,1 mq/ml) həzm olundu. 100 μl papain həzm şirəsi TE (1 ×) ilə seyreltildi və sonra Picogreen işləyən maye ilə qarışdırıldı. Qaranlıqda 3-5 dəqiqə inkubasiya edildikdən sonra qarışıq istehsalçının protokoluna uyğun olaraq fluorometriya ilə ölçüldü.

SGAG və ümumi kollagenin miqdarı

sGAG tərkibi Blyscan GAG analiz dəsti (Biocolor, Newtownabbey, Böyük Britaniya) ilə müəyyən edilmişdir. Qısaca, 10 μl supernatant Blyscan boya reagenti ilə qarışdırıldı. Santrifüqadan sonra sGAG-boya kompleksi dissosiasiya reagentində həll edildi və ardınca Termo oxuyucu (Multiskan FC) istifadə edərək 656 nm-də absorbans ölçüldü. Ümumi kollagenin miqdarı Woessner hidroksiprolin analizindən istifadə edərək ölçüldü [20]. Hidroksiprolinin tərkibi kolorimetriya ilə müəyyən edildi və ümumi hidroksiprolinin kollagenə çevrilməsi 8,2 [21] çarpma əmsalı istifadə edildi.

Hüceyrəsizləşmiş qığırdaq hissəciklərinin hazırlanması və səciyyələndirilməsi

Hüceyrəsizləşdirilmiş qığırdaq hissəciklərinin hazırlanması

Doğma qığırdaq toxuması kriogen öğütücü (Scientz-48L) istifadə edərək kiçik hissəciklərə üyüdülməzdən əvvəl ülgüc bıçağı ilə kiçik parçalara kəsilmişdir. Hüceyrəsizləşdirmə proseduru əvvəlki metodumuza uyğunlaşdırılmışdır [22]. Qısaca olaraq, qığırdaq hissəcikləri əvvəlcə hipertonik məhlul (50 mM Tris-HCl tamponu və 1 M NaCl, PH = 8) və hipotonik məhlul (0,5 M Tris-HCl tamponu, PH = 8) ilə üç dəfə yuyuldu. Daha sonra hissəciklər maye azotda donduruldu və 37°C-də üç dəfə sobada əridildi. Sonra hissəciklər hüceyrə membranlarını məhv etmək üçün 40 dəqiqə ərzində 0,5% Triton X-100 məhlulu ilə əlavə edildi və üç dəfə su ilə yuyuldu. DNT-ni daha da aradan qaldırmaq üçün 200 U ml -1 DNAse I işçi məhlulu əlavə edildi və 37°C-də 12 saat inkubasiya edildi. Nəhayət, hissəciklər 50 mM Etilendiamintetra-sirkə turşusu (EDTA) məhlulunda 20 dəqiqə batırıldı və üç dəfə su ilə yuyuldu. Hüceyrəsizləşdirilmiş qığırdaq hissəcikləri (DCP) maye azotda donduruldu və istifadə etməzdən əvvəl -20°C-də dondurucuda saxlanıldı.

DNT-nin çıxarılması

4′,6-diamidino-2-fenilindol (DAPI) ilə boyanmış yerli və hüceyrəsizləşdirilmiş nümunələrin qığırdaq hissəcikləri hüceyrələrin çıxarılmasını təsdiq etməklə müqayisə edildi. DNT-nin çıxarılmasının effektivliyini daha da təsdiqləmək üçün hər bir nümunənin DNT tərkibi “DNT-nin kəmiyyəti” bölməsində təsvir olunduğu kimi Quant-iT TM Picogreen TM dsDNA analizindən istifadə etməklə kəmiyyətcə ölçüldü.

DCP-lərin ölçü bölgüsü

Hüceyrəsizləşdirmədən sonra yeni doğulmuş, yetkinlik yaşına çatmayan və ya yetkin dovşanların DCP-ləri aşağı güclü mikroskop altında skan edilmiş elektron mikroskopiya (SEM) ilə müşahidə edildi və fotoşəkilləri çəkildi. Hər bir nümunənin hissəcik ölçüsü hesablanmış və DCP ölçüsünün paylanması ImageJ proqramı ilə təhlil edilmişdir.

DCP-lərin xarakteristikası

Hüceyrəsizləşdirmə prosedurunun müxtəlif DCP-lərə təsirini daha da xarakterizə etmək üçün “SGAG və ümumi kollagenin miqdarı” bölməsində təsvir olunduğu kimi müvafiq olaraq Blyscan GAG və Woessner hidroksiprolin analizindən istifadə etməklə sGAG və ümumi kollagen ölçüldü.

Kollagen-DCP kompozit hidrogellərin hazırlanması və xarakteristikası

Kollagen-DCP kompozit hidrogellərin hazırlanması

Laboratoriyamızda sterilizə edilmiş şəraitdə dana dərisindən çıxarılan və təmizlənmiş kollagen I hidrogel məhlulu [23] 60 Co γ şüalanması (25 kGy-də) ilə sterilizasiya edilmiş DCP-lərlə qarışdırılmadan əvvəl 1 M NaOH məhlulu ilə zərərsizləşdirildi. Kollagenin son konsentrasiyası 10 mq ml -1 və qarışıq məhlulunda DCP-lər müvafiq olaraq 20 mq ml -1 idi və məhlul kollagen-DCP kompozit hidrogel (Φ 8 mm × h) yaratmaq üçün 37°C-də qəlibə töküldü. 2,5 mm).

Mikrostruktur analizi

Kollagen-DCP kompozit hidrogelləri gradient etanol ilə susuzlaşdırıldı. Sahə emissiyası SEM (Hitachi S-4800, Yaponiya) altında yeni doğulmuş, yetkinlik yaşına çatmayan və ya yetkin dovşanlardan müxtəlif kollagen-DCP kompozit hidrogellərinin mikro strukturları müşahidə edilmişdir. Nəzarət olaraq eyni ölçüdə və kollagen konsentrasiyasına malik kollagen hidrogellərdən istifadə edilmişdir.

Mexanik sınaq

Kollagen hidrogelin və üç müxtəlif kollagen-DCP kompozit hidrogelin (Φ 8 mm × h 2.5 mm) saxlama və itki modulu otaq temperaturunda dinamik mexaniki analizator (DMA, TA-Q800, ABŞ) istifadə edərək təyin edildi və onun mexaniki xassələri təyin edildi. çox tezlikli rejimdə (1-5 Hz) ölçülür.

Deqradasiya qabiliyyəti

Kollagen hidrogelin və üç müxtəlif kollagen-DCP kompozit hidrogelinin (Φ 8 mm × h 2,5 mm) deqradasiyası müxtəlif vaxt nöqtələrində 37 ° C-də 30 μg ml -1 olan kollagenazın Tip I (Sigma) məhlulunda müəyyən edilmişdir. Hər bir nümunənin WW-si ilkin vaxt nöqtələrində (WW0) qeydə alınmışdır və müxtəlif vaxt nöqtələrində deqradasiya dərəcəsi (WW0 - WWT)/WW0 × 100% kimi hesablanmışdır, burada WWT müxtəlif vaxt nöqtələrində nümunənin WW idi .

Kollagen-DCP kompozit hidrogeldə BMSC-lərin xondrogenik fərqi in vitro

BMSC-lərin izolyasiyası və mədəniyyəti

Qısaca desək, steril şəraitdə qurbanlıq yeni doğulmuş Yeni Zelandiya ağ dovşanından uzun sümüklər yığılıb. Sümük iliyi 20% fetal iribuynuzlu zərdab (FBS) və 1% penisilin-streptomisin ehtiva edən a-MEM (Gibco) ilə şprisdən istifadə edərək yuyuldu. The cell suspension was filtered through the cell strainer (BD) to remove tissue fragments, followed by centrifugation. The isolated cells were resuspended and cultured in 10-cm cell culture dishes and cultured in a-MEM containing 20% FBS and 1% penicillin-streptomycin. After 24 h, non-adherent cells were washed away, and the attached cells were cultured until reaching 90% confluence. The BMSCs were passaged and cultured in a-MEM containing 10% FBS and 1% penicillin-streptomycin until the third passage (P3) before used in further experiments.

Encapsulation of BMSCs in collagen and collagen-DCP composite hydrogels

Collagen I hydrogel solution was neutralized by 1 M NaOH solution before mixing with DCPs from newborn, juvenile or adult rabbits. The mixture of the collagen-DCP solution was then mixed with BMSCs (P3) to reach a final collagen concentration of 10 mg ml −1 and DCP concentration of 20 mg ml −1 , with the cell density of 3 × 10 6 ml −1 . The mixture solution was then casted in a mould at 37°C to form a collagen-DCP composite hydrogel (Φ 8 mm × h 2.5 mm). Collagen hydrogels with the same BMSCs density, collagen concentration, and hydrogel dimension were also fabricated for comparison. The hydrogels were subsequently cultured in an ultra-low adhesion surface plate. The culture medium was prepared with 1% penicillin-streptomycin, 90 μg/ml VC, 0.35 mM L-proline, 1% ITS, 1% non-essential amino acids and 1% FBS with medium changing interval of 2 days.

Gross appearance and cell viability

The gross appearance of each sample was observed at Days 1, 3, 7, 14 and 21. The diameter of samples at different time points was recorded and compared. Fluorescein Diacetate (FDA)/ Propidium Iodide (PI) double staining was utilized for cell viability measurement at Day 3, 7 and 14. In brief, samples were gently rinsed in PBS for 5 min and incubated in dark for 5 min with the FDA-PI (1 μg ml −1 ) dye solution. Each sample was observed and photographed under a confocal laser scanning microscope (CLSM, Zeiss-LSM880).

Quantitation of DNA and sGAG

To determine the cell proliferation and sGAG secretion, samples were collected and lyophilized for 48 h in a freeze dryer. The dry weight was measured before digested in a papain solution. The cell proliferation (DNA content at different time points) and the sGAG quantity was analyzed using the Quant-iT TM picogreen TM dsDNA assay and the Blyscan GAG assay, which were previously described in Sections ‘Quantitation of DNA’ and ‘Quantitation of SGAG and total collagen’.

Histological and immunohistochemical staining

The BMSCs/hydrogel samples were collected at Days 1, 7, 14 and 21 and fixed with 4% paraformaldehyde. The fixed samples were dehydrated by a gradient of 15% and 30% sucrose. The sample was embedded in the optimal cutting temperature embedding agent and then sectioned (6 μm) in a frozen section machine (Leica, RM2016). The cell and tissue morphology in each sample were observed by Haematoxylin–Eosin (HE) staining, secretion of GAGs was detected by Toluidine blue (TB) staining, and calcium deposition was highlighted with the Alizarin red staining (ARS). Furthermore, immunohistochemical (IHC) of collagen Type II (COL2A1) was performed with the mouse monoclonal Collagen II antibody (1:200, Novus Biologicals, NB600-844) primary antibody and the goat anti-mouse IgG (H + L) HRP (1:200, Affinity, S0002) was the secondary antibody for COLII. In brief, the sections were blocked with goat serum for 2 h to block the non-specific antigen, before incubated with the primary antibodies at 4°C for 10 h. After washed three times with TBS, the sections were immersed with 0.3% H2O2 for 10 min to deplete endogenous peroxidase, followed by incubation with the secondary antibody for 20 min. The sections were coloured with diamino-benzidine staining solution and re-dyed with haematoxylin. The sections were dehydrated by gradient ethanol and treated with xylene solution. Finally, the sections were sealed with neutral gum and observed under a light microscope (LEICA DM1000).

Cartilage formation of BMSCs in the collagen-DCP composite hydrogel in vivo

Subcutaneous implantation in nude mice

BMSCs in collagen and collagen-DCP composite hydrogel (Φ 8 mm × h 2.5 mm) were prepared as described in Section ‘Encapsulation of BMSCs in collagen and collagen-DCP composite hydrogels’, and pre-cultured in vitro 3 gün ərzində. Subcutaneous implantation in nude mice experiments strictly abided by the rules and regulations of the Sichuan University Ethics Committee. In brief, 24 male BALB/c nude mice (6 weeks old) were purchased from GemPharmatech Co. Ltd. After intraperitoneal injection with 10 mg ml −1 pentobarbital sodium, nude mice in anaesthesia condition were placed on an ultra-clean table covered with sterile sheets. The back skin of a nude mouse was disinfected with povidone–iodine, and ophthalmological scissors were used to cut a ∼1.5 cm incision on the back of a nude mouse. Four pre-cultured BMSCs/hydrogel constructs were implanted into two subcutaneous pockets before the skin incision was closed with 4-0 needle suture and disinfected with povidone–iodine. Finally, the nude mice were sent back to their original cages, before euthanasia at day 14 and 28. The implants were collected at each time points for further investigation.

Biochemical analysis

The gross appearance of each implant was observed before (Day 0), and 14/28 days after implantation. The diameter of samples at different time points were recorded and compared. The DNA and sGAG quantity in each sample were analyzed before (Day 0) and 14/28 days after the implantation using the Quant-iT TM picogreen TM dsDNA and Blyscan GAG assays that described in Sections ‘Quantitation of DNA’ and ‘Quantitation of sGAG and total collagen’. Histological staining of HE, TB and ARS, and the IHC staining of COL2 were performed on each implant at Days 0, 14 and 28. The detailed methodologies were described in Section ‘Histological and immunohistochemical staining’.

Gene expression analysis

The mRNA expression levels of four chondrogenic genes (Aggrecan, COL2A1, SOX9 and collagen Type X [COL10A1]) in each implanted construct were analyzed at Days 14 and 28 using Quantitative Real-time PCR (qRT-PCR) technique. In brief, samples were washed with PBS and grinded in an enzyme-free tube with lysate. RNA was extracted using the RNeasy ® Mini Kit (Qiagen) and the RNA concentration was measured using a spectrophotometer (ND1000, Nanodrop Technologies). The isolated RNA was reverse transcribed into cDNA using the iScript TM cDNA Synthesis Kit (BIO-RAD). Finally, the cDNA in RNAse-free water was mixed with Ssofast EvaGreen Supermix (BIO-RAD) and the upstream and downstream primers, and the qRT-PCR was performed using the CFX96 TM qRT-PCR detection system (Bio-Rad, USA). The genes expression was determined by the software of BioRad CFX Manager, which calculated the relative gene expression based on the ΔΔCt method using the housekeeping gene of GAPDH. The forward and reverse primers’ sequences were referred from previous literature [ 24] and summarized in Table 1.

The forward and reverse primer sequences for qRT-PCR

Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
GAPDH TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC
Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
GAPDH TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC

The forward and reverse primer sequences for qRT-PCR

Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
GAPDH TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC
Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
GAPDH TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC

Statistik təhlil

The quantitative data involved in this experiment were presented as mean ± SD. The experimental data were compared by the t-test and the analysis of variance test method using SPSS software. *P < 0.05 was considered to have a significant difference, **P < 0,01 və ***P < 0.001 were considered to be a higher level of significant difference.


Nəticə

This study established a new concept for cartilage regeneration𠅊nalogous to steel-reinforced concrete�sed on ECG and DBM and demonstrated its feasibility. Additionally, the formation method and relative parameters were investigated and optimized. However, some important issues, including how to precisely control the shape and realize homogeneity of the whole regenerated cartilage, still need to be investigated. The presented results provide a new cartilage regeneration strategy with potential for future clinical translation.


Hyaline Cartilage in Other Animals

Animals in the class Chondrichthyes have a skeleton composed completely of cartilage. Köpəkbalığırays are good examples of this. Cartilage is less dense than bone, yet still provides strength and therefore allows these animals to move quickly through the water without exerting too much effort.

Cartilage is also found in onurğasızlar, kimi horseshoe crabs, snails, və sefalopodlar (predatory mollusks e.g. octopus and squid). The branchial cartilage in the arthropod Atlantic horseshoe crab (Limulus polifemus), is rich in vacuolated chondrocytes that differs from any other arthropod.

Endosternite cartilage is another type found in this species. It is more fibrous than the hyaline cartilage found in vertebrates. It is found near the ventral nerve cords and gill cartilage tissue.

İçində octopus (an example of a cephalopod), the cranial cartilage resembles hyaline cartilage and is one of the only hard parts of the octopus body. The growth of this cartilage occurs via cells moving from the outside to the center. In the common cuttlefish (Sepia officianalis), the cartilage is fibrillar collagen. The growth pattern of this cartilage is essentially the same as in vertebrate cartilage.

In gastropods (snails, slugs, or whelks), the odontophore is a cartilage formed feeding structure that provides feeding support. The odontophore is cell-rich cartilage containing myoglobin that is surrounded by a low volume of extracellular matrix and collagen.

Nəhayət, ildə feather duster worms (Sabellid polychaetes), cartilage supports their tentacles.


1.9 Osteoarthritis Research

Osteoarthritis in humans has been extensively studied clinically. Since articular cartilage is avascular and aneural, a diagnosis of primary osteoarthritis is not made until a patient experiences pain in the joint, which signals later-stage disease. The main focus for human osteoarthritis research is to find a way to diagnose the disease early and accurately. The best-known human imaging project during the recent years is the Osteoarthritis Initiative (OAI), which is a multi-center observational study of human osteoarthritis sponsored by the National Institutes of Health in the USA. The OAI data are available publically on the internet. Many correlational studies have been published using various parts of the OAI data.

In addition to studies on human osteoarthritis, a large number of different domestic animals have been used in osteoarthritis studies. 206 However, none of the animal models reproduce all the features of human osteoarthritis. 207 A general consensus in the community is that there is no universal animal model to recapitulate the pathogenesis and progression of human osteoarthritis. 206,207 Despite the limitations, animal models are an integral and irreplaceable component of human osteoarthritis research. This is because no disease can be induced ethically in the human the only alternative for the entire biomedical community is to study the cellular and animal models of the human disease, in order to gain better insights that could be used to produce guidelines for human treatment.

1.9.1 In vivo Models of Osteoarthritis

Primary osteoarthritis progresses slowly over several decades. It is the most common form of osteoarthritis and increases in prevalence and severity with the age in both human and non-human animals. 207 Compared to the idiopathic and slow development of primary osteoarthritis, post-traumatic osteoarthritis in animals and humans is known to be induced as a consequence of injury, and often develops quite rapidly. Post-traumatic osteoarthritis can be reproduced by mechanical insult or by surgery. Since articular cartilage has a limited capacity for repair, the physiological response to the resulting tissue damage rarely restores a normal articular surface. Similarly, any changes in the cartilage structure caused by abnormal loading in a stable joint, or even by degradative enzymes in the synovium, can lead to the development of osteoarthritis. The assessment of animal models of osteoarthritis traditionally depends on the histological analysis of articular cartilage. Recent advances have seen the emergence of many other effective analyses, such as biomarkers and imaging, for monitoring the progress of osteoarthritis. 81,154–156,206,208,209

Although there is a perceived advantage in using naturally occurring models of osteoarthritis (məs. Dunkin–Hartley guinea pigs) with a slower onset and progression similar to human osteoarthritis, 210 many investigators have utilized fast-advancing animal models first reported by Magnuson in 1941. 211 With a division of the medial collateral ligament and the cruciate ligaments in the joint, Magnuson showed osteoarthritis-like changes in articular cartilage. In 1952, Paatsama published a thesis describing the degradation of canine articular cartilage associated with a cranial cruciate ligament rupture. 212 Many studies from the 1970s onwards that used a similar model, or only the transection of the anterior cruciate ligament or a removal of the meniscus (menisectomy) showed reproducible histopathological changes including fibrillated articular surface, depleted proteoglycan content, and cloning of chondrocytes. 206,207,210

In addition to cartilaginous changes, Radin and Rose 191 showed alterations in the sub-chondral bone and the calcified zone of cartilage after application of repetitive sub-impact loads to the patellofemoral joint. Responses to traumatic injury were also studied using a direct impact applied to the patella using a "drop tower" type of apparatus in order to produce high-energy damage similar to that seen in human injuries. Intra-articular injections of many proteolytic enzymes such as trypsin, papain, and collagenase have also been used to trigger model osteoarthritis in mice, rats, and rabbits. However, the mechanisms responsible for cartilage degradation in these models, particularly those in which papain or trypsin was injected, may deviate significantly from those that normally occur in the human disease. Chemically induced osteoarthritis models use intra-articular injection of sodium iodoacetate to study acute cartilage toxicity and degradation and joint pain however, this has many limitations as a model of osteoarthritis. 213 For example, since sodium iodoacetate is a metabolic poison, this model exhibits extensive chondrocyte cell death, unlike naturally occurring osteoarthritis in humans. However, it does provide an in vivo model of rapid cartilage degradation mirroring some of the events observed in vitro in organ culture screening studies. 214

1.9.2 In vitro Models of Cartilage Degeneration

Fərqli olaraq in vivo animal studies concentrating on the outcomes of post-traumatic joints and progression of osteoarthritis, many in vitro models have been used to study the effect of cell death and specific degradative mechanisms in well-defined loading and culture environments. 208,215–220 Many enzymes have been used to induce cartilage degradation in vitro. For example, to investigate the potential use of imaging as a diagnostic tool for osteoarthritis, purified collagenase, trypsin, or chondroitinase ABC 217,218 have been used to digest bovine patellar cartilage in order to generate spatial and temporal changes in the cartilage matrix. Similar changes in structure and collagen network were observed in proteoglycan-depleted tissue and correlated directly with the loss of compressive strength. 215

As an alternative to enzymatic cleavage, many studies have used in vitro explant injury models to study the molecular mechanisms of chondrocyte death and matrix degradation in injured cartilage. The relatively low compressive moduli and the compression-induced stiffening in the superficial zone are closely related to cell death following a blunt impact or repeated mechanical insults. This was well demonstrated in vitro in a study of chondrocyte necrosis, where chondrocyte death occurred only in the superficial zone when two cartilage disks were positioned articular-surface-to-articular-surface and subjected to 1.0 MPa cyclic compression for 24 h, as shown in Figure 1.12. 216 The vulnerability of cells in the superficial zone is a feature often seen in early osteoarthritic cartilage and is significant in the initiation of post-traumatic osteoarthritis.

Some aspects of cartilage repair can also be examined in vitro by osteochondral models, such as defects of different depths created using a dermal biopsy punch and a scalpel. 209 Lin və b. 208 observed progressive changes in cell viability, collagen cleavage, and proteoglycan loss by cyclically loading cartilage explants with 1 and 5 MPa stresses for 24 h. Thibault və b. 221 subjected cartilage explants to high but physiological cyclic load levels and characterized the resulting damage using a sequence of unconfined-compression stress-relaxation tests. These studies indicated that acute injury in articular cartilage can induce an upregulation of reactive oxygen species and pro-inflammatory cytokines. These are important areas of research, since the prevention of cell death and the inhibition of matrix-degrading enzymes in the injured joint are significant for the prevention of posttraumatic osteoarthritis. Birlikdə bunlar in vitro explant models provide effective systems to study biomechanical and mechanobiological factors involved in initiating cartilage injury biochemical factors associated with cell death and matrix degradation and gene regulation critical for the advance of post-traumatic osteoarthritis.


Videoya baxın: Scanning Electron Microscope المجهر الإلكتروني الماسح (Iyul 2022).


Şərhlər:

  1. Momi

    very funny idea

  2. Nebei

    Bəli, cazibədar şəkildə səslənir

  3. Keaira

    Üzr istəyirəm, amma mənim fikrimcə, səhv edirsən. Mən əminəm. Mənə baş nazirlə yaz, müzakirə edin.

  4. Benoyce

    Səhv edirsən. Bunu müzakirə etməyi təklif edirəm.



Mesaj yazmaq