Məlumat

Sadə ardıcıllığın təkrarlarının gendə və əlaqəli transkript ardıcıllıqlarında yerləri niyə fərqlidir?

Sadə ardıcıllığın təkrarlarının gendə və əlaqəli transkript ardıcıllıqlarında yerləri niyə fərqlidir?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mən sadə ardıcıllığın təkrarı (SSR) üzərində işləyirəm. Müəyyən bir gendə SSR motivi olan yalnız bir bölgə (təxminən 21 bp) tapdım. Bu genin çoxlu transkriptləri var, eyni SSR motivi müxtəlif transkriptlərin müxtəlif mövqelərində yerləşir. Bunun necə baş verdiyini anlamağa kömək edə bilərsinizmi?


Alternativ Splicing səbəbiylə, fərz edək ki, ekson nə birinci, nə də sonuncu baş vermir, onda eyni ekson eyni genin müxtəlif transkriptlərində müxtəlif mövqelərdə gələcək. Beləliklə, əgər maraqlandığınız SSR həmin eksonda mövcuddursa, siz eyni SSR-ni müxtəlif transkriptlərin müxtəlif mövqelərində tapacaqsınız.


Alu təkrarları və insan genomik müxtəlifliyi

Alu elementləri primat genomlarında bir milyondan çox elementin surət sayına qədər genişlənmiş qısa kəsişən elementlər (SINE) sinfidir.

Alu elementlərinin genişlənməsi ümumi nukleotid əvəzetmələrini bölüşən müxtəlif təkamül yaşı elementlərinin bir sıra alt ailələrdə yayılması ilə xarakterizə olunur.

Alu elementləri genomlara bir neçə yolla təsir göstərir, o cümlədən daxiletmə mutasiyaları, elementlər arasında rekombinasiya, gen çevrilməsi və gen ifadəsi.

Alu əlavələrinin səbəb olduğu insan xəstəliklərinə neyrofibromatoz, hemofiliya, ailəvi hiperkolesterolemiya, döş xərçəngi, insulinə davamlı diabet tip II və Ewing sarkoması daxildir.

Alu elementləri metilasiyanın paylanmasını və ola bilsin ki, genlərin transkripsiyasını bütün genomda dəyişir.

Alu elementlərinin transkripsiyası hüceyrə stressinə cavab olaraq dəyişir və hüceyrə stress reaksiyasının saxlanmasında və ya tənzimlənməsində iştirak edə bilər.

Alu elementləri primat genomlarında sadə ardıcıllıq təkrarlarının mənşəyi üçün əsas mənbədir.

Alu-insertion polimorfizmləri insan populyasiyasının genetikasının və primatların müqayisəli genomikasının öyrənilməsi üçün bir lütfdür, çünki onlar məlum əcdad vəziyyətləri ilə neytral, eyni nəsil genetik markerlərdir.


Fon

Dinoflagellatlar dəniz və şirin su mühitlərində hər yerdə mövcud olan birhüceyrəli mikroyosunların müxtəlif qrupudur. Mərcan qayalarında, Symbiodiniaceae ailəsinin dinoflagellatları cnidarianların (məsələn, mərcanlar, dəniz anemonları və meduzalar), nəhəng timsahların, süngərlərin və digər mikroorqanizmlərin, o cümlədən foraminiferanların və kirpiklərin üstünlük təşkil edən fotosintetik simbionlarıdır [1]. Symbiodiniaceae, mərcan sahibinin enerji ehtiyaclarını ödəmək üçün fotosintez yolu ilə sabitlənmiş karbonlarının 90% -dən çoxunu təmin edə bilər [2].

Dünya miqyasında mərcan rifi ekosistemləri okeanların istiləşməsi və sahilyanı ərazilərdə artan insan fəaliyyəti nəticəsində ciddi təhlükə altındadır [3]. Bu mühitdə okean səthinin temperaturunda təvazökar bir epizodik artım oksidləşdirici zədələnməyə və simbiont ilə ev sahibi arasında karbon axınının ayrılmasına səbəb ola bilər. Xüsusilə, mərcan-dinoflagellat simbiozunun parçalanması (yəni mərcan ağartması) mərcan sahibini aclıq, xəstəlik və nəticədə ölüm riski altına qoyur [4,5,6]. 2014 və 2017-ci illər arasında qlobal mərcan ağartma hadisəsi qeydə alınmış ən uzun hadisədir və epizodik kütləvi ağartma hadisələri baş verməkdə davam edir [7, 8]. Mövcud mərcan riflərini saxlamaq və bərpa etmək üçün təcili olaraq konservasiya strategiyalarına ehtiyac var. Bu cür müdaxilələrin dizaynı sağlam, möhkəm simbiozun davam etdirilməsi üçün hər bir biotik komponentin rolunu anlamaq üçün çoxşaxəli yanaşma tələb edir [9,10,11]. Genomik resursların qorunma səylərini məlumatlandırmaq üçün faydalı olduğu sübut edilmişdir [12], lakin mərcan rifi simbiontları üçün genom miqyaslı məlumatlar az olaraq qalır. Symbiodiniaceae-dən genom məlumatlarının çatışmazlığı dinoflagellat genomlarının və xromosomlarının nisbətən böyük ölçüləri (1-5 Gbp) [13, 14] və mürəkkəb, atipik quruluşu ilə izah olunur [15, 16].

Symbiodiniaceae-nin genetik müxtəlifliyi ev sahibinin spesifikliyi, ötürülmə rejimi və qalıcılığı ilə fərqlənən geniş spektrli simbiotik birləşmələrdə iştirak edən genomlara təsir edən təbii seçmə ilə izah edilə bilər. mehmanxanada [17, 18], həmçinin genetik sürüşməyə səbəb ola bilən stoxastik qüvvələr tərəfindən [19]. Simbioz və ya onun olmaması Symbiodiniaceae [20] genomunun təkamülündə rol oynamışdır. Əksər simbiotik növlərin sərbəst yaşayan hərəkətli mərhələ (mastigote) və sferik simbiotik mərhələ (kokoid) arasında keçid potensialı ilə müəyyən dərəcədə fakultativ olduğu düşünülür. Fakultativ və yeni hüceyrədaxili bakteriya simbionlarının genomları adətən dinamikdir, geniş struktur dəyişiklikləri, transpozisiya olunan elementlərin (TE) aktivləşməsi və psevdogenlərin toplanmasına səbəb olan genlərin təkrarlanmasının artması ilə xarakterizə olunur [21, 22]. Əsasən fakultativ olan simbiotik Symbiodiniaceae-nin sərbəst yaşayan taksonlardan fərqli olaraq oxşar genomik xüsusiyyətlərə malik olması gözlənilir ki, sonuncu qrupa indiyədək yalnız ətraf mühit nümunələrində tapılmış və laboratoriya təcrübələrində potensial sahibləri uğurla yoluxdura bilməyən növlər daxildir [23, 24]. Mövcud taksonomik təsnifata əsaslanaraq, Symbiodiniaceae ailəsi filogenetik cəhətdən fərqli Suessiales [25, 26] sırası daxilində təsvir edilən növlərin ən çoxunu ehtiva edir. Polarella [27] və Sfaerodinium [28].

Burada cinsin yeddi üzvündən qaralama genom məclisləri yaratdıq Symbiodinium: Symbiodiniaceae-nin fərqli həyat tərzini təmsil edən iki sərbəst yaşayan, bir fürsətçi və dörd simbiotik təcrid. Digər mövcud məlumatlar ilə birlikdə, Symbiodiniaceae-nin tək cinsinə aid olanlara nisbətən fərqliliyini və genetik müxtəlifliyini qiymətləndirmək üçün 15 dinoflagellat taksonun (onlardan 13-ü Symbiodiniaceae) bütün genom ardıcıllığını sistematik şəkildə müqayisə etdik. Symbiodinium. Biz daxilində geniş genom ardıcıllığı fərqliliyini aşkar etdik Simbiodinium Bu, Symbiodiniaceae-nin müxtəlif cinsləri və niş uyğunlaşmasına kömək edə biləcək gen ailələri ilə müqayisə edilə bilər. Bu genetik müxtəliflik, ehtimal ki, mərcan (və digər) ev sahibləri ilə Symbiodiniaceae simbiontları arasında əvvəllər düşünüldüyündən daha mürəkkəb qarşılıqlı təsirlərə çevrilir.


Nəticələr

Genom montajı

Biz burada bir qadın və bir kişinin çox bitişik genom birləşmələrini təqdim edirik S. purpurea. Qadın məclisi (94006 v4) cəmi 317,1 Mb-ni əhatə edən 5,1 Mb N50 ilə 452 kontigmadan ibarətdir. Eynilə, kişi məclisi (Fish Creek v3) 312,9 Mb əhatə edən 351 kontig və 5,6 Mb N50-yə malikdir (Əlavə fayl 1: Cədvəl S1). Hər iki məclis, iki haplotipin fərqli olduğu genomik bölgələrdə qismən mərhələli olur. Alternativ haplotiplər qadın məclisində cəmi 72,4 Mb olan 421 kontig, kişi üçün isə 149 Mb olan 497 kontig ilə təmsil olunur. Ardıcıl kişi genotipinin nəslindən əldə edilən böyük bir çarpaz ailənin genetik xəritəsindən istifadə edərək, qadın üçün cəmi 288,3 Mb olan 108 kontig və kişi üçün 288,5 Mb olan 96 kontig olan 19 xromosomu təmsil edən birləşmələr yaratdıq. Bunlar hər iki halda yığılmış ardıcıllığın 90%-dən çoxunu təşkil edir, baxmayaraq ki, 344 və 255 kontig, müvafiq olaraq, qadın və kişi üçün genetik xəritədə yerləşdirilməmişdir (Əlavə fayl 1: Cədvəl S2). Xəritələnmiş və yerləşdirilməmiş kontiglər bundan sonra birlikdə alternativ haplotipləri istisna edən əsas genom adlandırılacaq.

Biz W haplotipinin SDR-də Z haplotipindən fərqlənəcəyini gözlədiyimiz üçün bu bölgənin çox hissəsinin ayrıca kontiglər kimi yığılacağını gözləyirdik. Kişi və qadın qısa oxunuş ardıcıllığını bu istinadlara uyğunlaşdırarkən əhatə dairəsinin nisbi dərinliyini tədqiq etməklə bunları asanlıqla fərqləndirmək olar. Cinslə əlaqəli markerlərin [20] mövcudluğuna əsaslanaraq SDR-nin yerini müəyyən etdikdən sonra 15-ci Xromosomun ilkin yığılması SDR daxilində olduğunu düşündüyümüz bölgədə Z və W skafoldlarının qarışığından ibarət olduğu ortaya çıxdı (Əlavə fayl 2). : Şəkil S1a). Buna görə də biz xromosomları ayırmaq üçün yığılmış Z və W haplotipləri ilə yeni bir birləşmə yaratmağa çalışdıq. Bunu etmək üçün biz ilk olaraq 60 əlaqəsiz fərddən ibarət populyasiyada cinsi əlaqədən istifadə edərək ehtimal olunan W kontiglərini və F-dən kişi və qadınların əhatə dairəsinin diferensial dərinliyini müəyyən etdik.2 meyar kimi damazlıq göstəriciləri [20]. Bu, ehtimala görə, əsasən W haplotipindən əldə edilən ardıcıllıqdan ibarət olan 23 kontigmanın müəyyən edilməsi ilə nəticələndi (Əlavə fayl 1: Cədvəl S3). Bir iskele xaric edildi, çünki o, əsasən daha uzun Chr15W kontigmasının alternativ haplotipindən ibarət idi.

Bu kontiglərin bir çoxunda orijinal genom birləşməsində [20] istifadə edilən çarpaz xəritənin markerləri yox idi, xüsusən də Z xromosomunda olmayan W haplotip hissələrindən gələnlər üçün. Buna görə də biz genomun bu hemizigot hissələrini tutmaq üçün daha uyğun olan SNP və indel markerlərinin qarışığına malik olan yeni genetik xəritələr yaratdıq. Yeni genetik xəritələr 19 xromosomu təmsil edən 19 əsas əlaqə qrupuna birləşdi. Kişilərin arxa kross xəritəsində 8715 marker, qadın arxa kross xəritəsində isə 8560 marker var idi (Əlavə fayl 1: Cədvəl S4). Biz bunlardan Chr15-in Z və W versiyasını yığmaq üçün istifadə etdik (Əlavə fayl 1: Cədvəl S5). Beləliklə, cari məclis (ver5 buraxılışı) Chr15Z və Chr15W daxil olmaqla 20 xromosom ehtiva edir. 17 kontigdə olan W-xüsusi kontig ardıcıllığının cəmi 6,56 Mb (95,7%) bu xəritələrdən istifadə etməklə Chr15W-ə yığılmışdır. Ümumi uzunluğu 297 kb olan dörd ehtimal olunan W skafoldunda xəritələşdirilmiş markerlər yox idi və birmənalı şəkildə yerləşdirilə bilməzdi.

SDR-nin yeri

Chr15Z silinmiş yeni məclisimizdən istifadə edərək, əlaqəsi olmayan 60 şəxs üçün cinsi əlaqə təhlilini təkrarladıq. Ardıcıllıqla sınaqdan keçirilmiş 54,959 Genotipləmə (GBS) SNP arasında əhəmiyyətli dərəcədə cinsi əlaqəyə malik 105 SNP-nin hamısı yalnız Chr15W-də mövcud idi (Şəkil 1a Əlavə fayl 2: Şəkil S2a-c) və əsas genomdakı PAR və digər skafoldlardan olan markerlər yox idi. hər hansı cinsi əlaqəni göstərin (Əlavə fayl 2: Şəkil S2a). Səkkiz yüksək səviyyəli sekslə əlaqəli markerlər 7,66-dan 8,66 Mb-a qədər paylandı. Cinslə əlaqəli markerlər qadınlarda ilk növbədə heterozigot və kişilərdə homozigot idi, bu da ZW cinsinin təyini ilə bağlı əvvəllər bildirdiyimiz müşahidəmizi təsdiqləyir. S. purpurea [20].

Chr15W-nin genomik məzmunu və cinsi təyinetmə bölgəsinin (SDR) tərkibi. a Chr15Z olmayan bir istinad genomuna uyğunlaşmadan əldə edilən SNP-lərdən istifadə edən GWAS-a əsaslanan Chr15W-nin Manhetten planı. The Y ox mənfi loqarifmdir səh dəyərlər və qırmızı xətt Bonferroni kəsildiyini göstərir. b Gypsy və Copia daxil olmaqla LTR elementlərinin, həmçinin 50 kb addım ölçüsü ilə 100 kb-lıq pəncərələrdəki genlərin sayı. c Aşağıdakı SDR-nin daha ətraflı görünüşü ilə birlikdə Chr15W-də qadına aid qərəzli ardıcıllığın paylanması. Hər bir rəngli blok jurnalı göstərir2 10 kb-lik pəncərələrdə qadın və kişi dərinliyinin nisbəti. Şəklin altındakı şaquli boz xətlər SDR-də kontiglərin sərhədlərini göstərir. d Hər bir gənə SDR-də bir geni təmsil edir. Rənglər genomun qalan hissəsinə qarşı blastp əsasında genlərin ehtimal olunan mənşəyini göstərir

15 W və 15Z xromosomların tərkibi

Chr15W 15,7 Mb uzunluğunda, yeni genetik xəritə ilə yerləşdirilmiş 22 kontigmadan ibarətdir. Müqayisə üçün qeyd edək ki, Chr15Z cəmi 13,3 Mb-dir və 16 kontigdən ibarətdir (Əlavə fayl 1: Cədvəl S5 Şəkil 1). Chr15W-nin hər iki ucunda bir olmaqla, Chr15Z-də müvafiq bölgələrdən fərqlənməyən iki psevdoautosomal bölgə (PAR) var. PAR1 2,3 Mb uzunluğundadır və bir kontigdən, PAR2 isə 6,5 Mb-dir və üç kontigdən ibarətdir (Şəkil 1). Bu bölgələr mərhələsizdir və buna görə də iki məclisdə eynidir.

W ilə əlaqəli cinsi təyin edən bölgə (SDR) 6,8 Mb uzunluğundadır və xromosomun təxminən 40% -ni tutur (bundan sonra W-SDR adlandırılacaq). Xəritəçəkmə populyasiyasında bu bölgə minimal rekombinasiyaya məruz qalır (Əlavə fayl 2: Şəkil S4). W-SDR-nin kişi və qadın əhatə dairəsinin dərinliyini yenidən nəzərdən keçirdikdə, genomun bu bölgəsinin əsasən kişi və qadın haplotiplərini ayırmaq üçün mərhələli olduğu aydın olur (Əlavə fayl 2: Şəkil S1b). Chr15Z-də W-SDR-ə uyğun gələn bölgə yalnız təxminən 4 Mb uzunluğundadır və xromosomun yalnız 28,2%-ni (bundan sonra Z-SDR adlandırılacaq) tutur (Əlavə fayl 2: Şəkil S3). Kişi və qadın əhatə dairəsinin dərinliyinin nisbətinə əsasən, həm Z, həm də W xromosomunda mövcud olan ZW homoloji bölgələri təxminən 3,5 Mb və W-SDR-də W üçün unikal olan əlavələr təxminən 3,1 Mb təşkil edir (Şəkil 1). 1c).

W-SDR genomun digər hissələrinə nisbətən daha aşağı gen sıxlığına və daha yüksək təkrar sıxlığına malikdir və bu, təkrarlanan elementlərin bu bölgədə yığıldığını göstərir (Cədvəl 1). Daha dəqiq desək, həm W-SDR, həm də Z-SDR PAR və ya digər autosomlardan orta hesabla daha aşağı gen sıxlığını göstərir. Eynilə, həm W-SDR, həm də Z-SDR qaraçı retrotranspozonlarının daha yüksək yığılmasını göstərir. Maraqlıdır ki, Copia-LTR-lər Z-SDR ilə müqayisədə W-SDR regionunda daha yüksək sıxlıqda baş verir (W-SDR-nin 10,9%-i və Z-SDR-nin 5,9%-i), (Kruskall-Wallis testi, P < 2.2e−16) (Cədvəl 1), bunların bu haplotiplər arasında rekombinasiya dayandırıldıqdan sonra daxil edildiyini göstərir.

W xromosomunun gen tərkibi

PAR1-də 269 gen, PAR2-də 778 gen və W-SDR-də 488 gen var. Bunun əksinə olaraq, Z-SDR yalnız 317 gen ehtiva edir (Şəkil 2 Əlavə fayl 1: Cədvəl S6-S7). Scaffold_844-də, ehtimal ki, Z haplotipindən əldə edilən, lakin onu düzgün yerləşdirmək üçün genetik markerlərə malik olmayan əlavə 29 gen mövcuddur. Z xromosomunun tamlığını qiymətləndirmək üçün biz bu bölgənin gen məzmununu Fish Creek kişi istinad genomundan olanla müqayisə etdik. Z-SDR bölgəsi Fish Creek-də 2,86-dan 7,10 Mb-a qədər olan, cəmi 333 gendən ibarət dörd kontigdən ibarət idi. Ölçü və gen məzmunu kişi və qadın istinadlarının Z xromosomları arasında çox oxşar olduğundan, müqayisəni asanlaşdırmaq üçün analizimizi qadınla məhdudlaşdırırıq.

Chr15W və Chr15Z-də şərh edilmiş genlər. Genlər annotasiya edilmiş genomda ən yaxşı özünü vurmayanlara görə qruplaşdırılır. Xəritəsiz Z, scaffold_844-dən iyirmi doqquz gen də daxil edilmişdir. Tökülmüş sahələr tandem dublikatları kimi müəyyən edilmiş qrupların genlərini göstərir

W-SDR və Z-SDR arasında 156 tək surətli qarşılıqlı ən yaxşı hitlər var idi, bundan sonra Z-W homoloqları (məməlilərin cinsi xromosomlarında X-degenerativ genlərin analoqu) adlandırılacaq (şək. 2). W-SDR həmçinin tandem dublikasiyasında 32 gen, Z-SDR-də müvafiq tandem təkrarları isə 56 gen ehtiva edir. Bundan əlavə, W-SDR digər autosomlarda qarşılıqlı ən yaxşı hitlərə malik 40 gen ehtiva edir və bunlardan 33-ü SDR-də tandemlə təkrarlanır. Bunun əksinə olaraq, Z-SDR bölgəsində yalnız 11 belə gen var, onlardan yalnız altısı tandemlə təkrarlanır. Bu ehtimal edilən transpozisiya edilmiş genlər W-SDR-nin 8%-ni və Z-SDR-nin yalnız 3%-ni təşkil edir. W-SDR-də daha 54 gen intraxromosomal transpozisiya və sonrakı tandem dublikasiyası nəticəsində yaranıb, Z-SDR-də isə bu kateqoriyada yalnız 7 gen var. Ümumilikdə, bu köçürülmüş və amplikonik genlər haplotiplər arasında gen məzmununda uyğunsuzluğun yarısından çoxunu təşkil edir. W-SDR-də əlavə 103 gen genomdakı digər genlərə yüksək təsir göstərdi, lakin ən yaxşı hit qarşılıqlı olmadı, buna görə də bunlar transpozisiya və ya Z-W homoloqları üçün daha aşağı inamlı namizədlərdir. Z-SDR-də 54 belə gen var idi. Qalan genlərin, ehtimal ki, silinmə nəticəsində itirilməsi və ya ardıcıllıq və ya annotasiyadakı boşluqlar (W-SDR-də 85 və Z-SDR-də 42) səbəbiylə genomdakı digər genlərə əhəmiyyətli zərbələr yox idi.

Z-W homoloqları və təbəqələri

Sinonim əvəzetmələrə əsaslanan fərqli dərəcələrə malik təbəqələrin olub olmadığını yoxlamaq üçün W-SDR və Z-SDR arasında MCScanX vasitəsilə müəyyən edilmiş sintenik gen cütlərindən istifadə etdik (dS), bu, rekombinasiyanın dayandırılmasının müxtəlif mərhələlərini göstərəcək [27]. 156 cüt Z-W homoloquna əsaslanan təbəqələrin mövcudluğunu dəstəkləyən çox az dəlil var idi (Şəkil 3 və Əlavə fayl 1: Cədvəl S8). Orta dS 0,027 ± 0,020 SE idi. Müqayisə üçün, dS üçün Chr01-də sintenik genlər arasında S. purpureaS. suchowensis 0,045 ± 0,0022 SE idi və dS arasında S. purpureaP. trichocarpa Chr01-də sintenik genlər üçün 0,146 ± 0,0022 SE idi (Şəkil 3).

Sinonim əvəzetmə dərəcələri (dS) SDR-dəki genlər üçün. a W-SDR və Z-SDR-də sintenik genlərin müqayisəsi. Barlar standart səhvləri təmsil edir. b Chr01-də yaxından əlaqəli növlər üçün 1365 sintenik gen üçün növlərarası sinonim əvəzetmələrin paylanmasını göstərən qutu planı S. purpureaS. suchowensis və Chr01-də 1363 gen üçün S. purpureaPopulus trichocarpa, sintenik genlər arasında əvəzləmələrin paylanması ilə müqayisədə S. purpurea SDR

W-SDR və palindromik təkrarlara keçidlər

Bu yaxınlarda köçürülmüş genlər xüsusi maraq doğurur, çünki onlar SDR-nin yaradılması üçün potensial mexanizm təmin edə bilər və cinsi təyin etmək və/və ya cinsi antaqonizm üçün potensial namizəd olan genləri vurğulaya bilər [28]. Avtosomlardan W-SDR-ə güman edilən 40 gen arasından 7-si Chr19-da ən yaxşı hitlərə malikdir (əl ilə qeyd edilmiş genlər istisna olunur) (Əlavə fayl 1: Cədvəl S9). Contig ws19 transpoze edilmiş genlər üçün xüsusilə zənginləşdirilmişdir və daha yaxından araşdırılmağa layiqdir (Şəkil 1). Contig ws19, Chr19-dan dörd gen və Chr17-dən dörd gen daxil olmaqla, 11 transpoze edilmiş gendən ibarətdir (Şəkil 1). Bu köçürülmüş genlərin çoxu məməlilərin Y xromosomlarında baş verən palindromik təkrarlara bənzər təəccüblü tərs təkrar konfiqurasiyalarda ws19-da iki-dörd nüsxədə baş verir (Şəkil 4).

Palindromik təkrarlar S. purpurea W xromosomu (a) və H. sapiens Y xromosomu (b). Nöqtə qrafikləri eyni parametrlərlə LASTZ istifadə edərək istehsal edilmişdir. Hər bir rəqəmin yuxarı sağ tərəfindəki çubuqla göstərilən müxtəlif miqyaslara diqqət yetirin. H. sapiens palindromlar Skaletsky et al. [4]

In S. purpurea, bu bölgə qadına xasdır (yəni bütün qadınlarda olur, lakin kişilərdə yoxdur) və iki palindromdan ibarətdir. Palindrome W.P1 mərkəzdə 2,6 kb spacer ilə təxminən 42,7 kb, Palindrome W.P.2 isə dərhal bitişikdir və 165 kb-dən çox əhatə edir (Cədvəl 2 Şəkil 4a). 20 kb-lıq ardıcıllıq tərs oriyentasiyada baş verir və hər iki palindromun dörd qolunda yüksək ardıcıllıq eyniliyini göstərir (Cədvəl 2 Şəkil 5a). Palindrom W.P1-də bunlara qol1 və qol2, Palindrom W.P2-də isə arm3a və arm4a kimi istinad edilir (Cədvəl 2 Şəkil 4a). Bu dörd qol arasında ardıcıllıq eyniliyi orta hesabla 99%-dən çoxdur. Yüksək ardıcıllıqlı eynilik bölgələri a tərəfindən pozulur

Qolun ortasına 500 bp daxiletmə4. Bundan əlavə, arm3-də 11,7 kb-da 6,9 kb silinmə, ardınca eyni oriyentasiyada digər qollara uyğunlaşdırıla bilən 1,6 kb-lik bir uzanma var (Şəkil 5a). Bundan əlavə, qol1-in yuxarı hissəsində 12 kb-lıq uzanma var ki, bu da 1 və 2-ci qolların hissələrinə yüksək eynilik göstərir. Biz bunu rahatlıq üçün ön qol adlandırırıq (Cədvəl 2).

İki palindrom üçün ardıcıl müqayisələr. a İki palindrom arasında paylaşılan dörd qolun müqayisəsi. Qara xətt 100-bp pəncərələrindəki nukleotid fərqlərinin sayını, qırmızı xətt isə tərs miqyasda düzülmədəki boşluqları göstərir. b Palindrom 2-nin palindrom 1 ilə paylaşılmayan hissələrinin müqayisəsi. c Palindromik bölgədə beş çox surətli genin filogenetik ağacları

Palindrom W.P2 W.P1-də çatışmayan əlavə tərs təkrardan ibarətdir. Biz bunu arm3b və arm4b adlandırırıq (Cədvəl 2 Şəkil 4a). Ardıcıllıq eyniliyi bu iki qol arasında digər dörd qolla müqayisədə bir qədər aşağıdır, uzunluğunun çox hissəsi üzrə 96-99% arasında dəyişir. Bundan əlavə, yüksək şəxsiyyət bölgələri çoxsaylı əlavələr və silinmələrlə pozulur (Şəkil 5b).

Palindromların gen tərkibi

Hər iki palindromun 1, 2, 3a və 4a qollarında təkrarlanan beş gen var. Bunlar Kiçik Muts ilə əlaqəli zülal (SMR), A Tipi sitokinin reaksiya tənzimləyicisi (RR), NB-ARC domenini (R1 və R2) ehtiva edən iki gen və hidroksisinnamoil-CoA şikimat/hidroksisinnamoil transferazdır (HCT) (Cədvəl 3). R2 istisna olmaqla, bütün bu genlərin Chr19-da aydın paraloq nüsxələri var. Palindromlarda bu paraloqların əksəriyyəti arasında ardıcıllıq fərqi çox azdır (şək. 5).

Sitokinin reaksiya tənzimləyicisi xüsusi maraq doğurur, çünki bu genin ortoloqunun da cinsiyyətlə əlaqəli olduğu aşkar edilmişdir. Populus [24] və buna görə də Salicaceae cinsində cinsi təyinetmə geni kimi əla namizəddir. RR geni W-SDR-də bütün dörd palindrom qolunda yüksək dərəcədə qorunur (Şəkil 5a, c). Maraqlıdır ki, Z-SDR üzərində RR geninin psevdogen surətini də tapdıq. Bu, W-SDR, Z-SDR, Chr19 və həmçinin SDR-də müəyyən formada mövcud olan beş gendən yeganə biridir. Populus. Z-SDR psevdogenində və ya Chr19-da deyil, palindromda bütün RR nüsxələrinin yuxarı axınına daxil edilmiş 2,6 kb-lıq ardıcıllıq var (Əlavə fayl 2: Şəkil S5). Bu, W-SDR palindromunun Chr19-dan transpozisiyadan sonra əmələ gəldiyini göstərir. Maraqlıdır ki, RR geni genomun hər üç yerində (W-SDR, Z-SDR və Chr19) ters çevrilmiş təkrarlar kimi baş verir. Bununla belə, W-SDR, Z-SDR və Chr19 versiyalarının uyğunlaşdırılması palindromların çox güman ki, müstəqil şəkildə formalaşdığını nümayiş etdirir, çünki palindromik bölgələr fərqlidir (Əlavə fayl 2: Şəkil S5).

W.P2 palindromunda əlavə beş gen var. Bu genlərdən üçü ters çevrilmiş təkrarlar kimi baş verir: DNT-yə yönəlmiş primaz/polimeraza zülalı (DRBM), DNT primazası (DPRIM) və Naməlum Funksiya Sahəsi 789 (DUF789). Bundan əlavə, ARGONAUTE 4-ün homoloqu var (TF2C) və CBS domen zülalı (ACDP) tək nüsxədə. Bu genlərdən dördünün Chr17-dən transpozisiya edildiyi görünür (Cədvəl 3). Bu, bizi bu fərziyyəyə aparır ki, bu genlər W-SDR-ə köçürüldükdən sonra onlar dublikasiyalar, inversiyalar və silinmələr daxil olmaqla bir neçə raund struktur yenidən qurulmasına məruz qalıblar.

Palindromda çoxlu LTR retrotranspozonları

W-SDR-nin tərkibi və tarixi haqqında daha çox məlumat əldə etmək üçün palindromik bölgədə LTR retrotranspozonlarına şərh vermək üçün LTRharvest və LTRdigest-dən istifadə etdik. Biz silahdan əvvəlki bölgədə bir LTR retrotranspozonunu və kodlaşdırma bölgələri ilə müəyyən edilmiş terminal təkrarları olan palindrom W.P2-də 12 LTR retrotranspozonunu müəyyən etdik (Şəkil 6a). Bu 13 retrotranspozon, müxtəlif uzun terminal təkrarlarına, eləcə də fərqli hədəf sahə dublikasiyalarına malik olduqlarını və palindromun əks qolunda eyni mövqedə baş vermədiklərini nəzərə alsaq, müstəqil daxiletmə hadisələri ola bilər (Əlavə fayl 1: Cədvəl S10). Eyni retrotranspozonun LTR-ləri daxilində müxtəlif sayda əvəzetmələrin olduğunu nəzərə alsaq, belə görünür ki, bu daxiletmələr palindromların qurulmasından sonra dəfələrlə baş verib. Əvvəlki mutasiya nisbətindən istifadə edərək P. tremula (ildə 2,5 × 10 - 9) [29], biz hesab edirik ki, ən qədim daxiletmə ən azı 8,6 ± 2,9 s.d. Avtonom olmayan LTR retrotranspozonundan MYA, Ltr-p2-a (Şəkil 6a və Əlavə fayl 1: Cədvəl S10). Bu, çox güman ki, bir az qiymətləndirmədir, çünki Salix əvəzetmə dərəcəsi ilə müqayisədə əhəmiyyətli dərəcədə yüksəkdir Populus [30]. Ən qədim əvəzetmələr Palindrom W.P2-də baş verdiyindən, biz belə nəticəyə gəlirik ki, bu element əvvəlcə qurulmuşdur (şək. 6a). Avtonom olmayan elementlərin LTR-ləri Ltr-p2-aLtr-p2-k cinahda SMRRR genlər (Şəkil 6c, d Əlavə fayl 2: Şəkil S6), bu LTR-lərin bu genlərin bu bölgəyə köçürülməsində iştirak etməsi ilə bağlı maraqlı ehtimalı artırır. Bununla belə, bu nüsxələr üçün hədəf sayt dublikasiyaları palindrom qolları üzrə eynidir və bu, W-SDR-də bu genlərin təkrarlanması və yenidən təşkilinin bu elementləri əhatə etmədiyini göstərir (Əlavə fayl 2: Şəkil S6). Biz həmçinin W.P1-də eyni ailədən iki çox oxşar LTR tapdıq (Ltr-p2-b3 arm3 və Ltr-p2-b4 arm4-də Şəkil 6a–c Əlavə fayl 1: Cədvəl S10). Bu LTR-nin ön qolda və qol1 və qol2 arasındakı aralayıcıda da kəsilmiş hissələri var (Şəkil 6b, c). Bu nüsxələr müstəqil əlavələr əvəzinə palindromun formalaşması zamanı baş verən dublikasiyaların və inversiyaların birbaşa nəticəsi ola bilər.

LTR retrotranspozonları, qadına xas genlər və palindromlar. a Üstündə paz olan hər bir şaquli xətt LTRharvest tərəfindən palindromik bölgədə müəyyən edilmiş 13 TE-nin hər birini təmsil edir. Hər bir xəttin hündürlüyü iki LTR-də (a-h transpozonlarında) təxmin edilən nukleotid əvəzetmələrinin sayını və mutasiya sürətinə əsaslanan daxiletmə vaxtının təxminisini göstərir. P. tremula [29]. b Rəngli qutular palindromdakı genlərin ehtimal olunan xromosom mənşəyini təmsil edir. Tünd qırmızı, Chr19, mavi, Chr17. Mavi qutular Z xromosomunda paraloqları olan genləri təmsil edir. c 13 LTR mövqeləri (kölgələnmiş qutular). Çirklənmiş qutular əldə edilən natamam dublikasiyaları təmsil edir Ltr-p2-b3/b4. d Rəngli oxlarla təmsil olunan ekson mövqeləri və istiqamətləri. e Qadına xas palindromların sxematik təsviri. Ulduzlu qutu qollardan birinin (preARM) bir hissəsindən əldə edilən homoloji bölgəni təmsil edir. Oxların istiqamətləri dörd qolun nisbi istiqamətlərini göstərir

Palindromlarda gen çevrilməsinin sübutu

Biz retrotranspozon analizi əsasında palindromların milyonlarla il yaşı olduğunu göstərdik, lakin palindrom qollarının hissələrinin ardıcıllığı yüksək olaraq qalır (Şəkil 5a). Bunun ən həssas izahı, məməlilərin Y xromosom palindromlarında müşahidə edildiyi kimi, palindrom qolları arasında gen çevrilməsidir [6, 31]. Bunu sınamaq üçün biz spesifik baza əvəzetmələri olan bölgələri axtardıq Salix suchowensis, ZW cinsiyyət təyini ilə yaxından əlaqəli növ [22]. Əgər növlərarası əvəzetmələri olan bölgələrdə palindrom qolları arasında paraloq ardıcıllıq variasiyası (PSV) yoxdursa, bu, gen çevrilməsinin əla sübutu olardı [31]. Palindromların içərisində PSV-lərin olmadığı 3 kb-lıq bir bölgə aşkar etdik S. purpurea və yalnız bir PSV daxil S. suchowensis, lakin əhəmiyyətli növlərarası polimorfizmlər (Şəkil 7). Palindrom qollarının dörd nüsxəsi üçün gözlənildiyi kimi bu bölgənin dərinliyi 4N-dir. S. purpurea. In S. suchowensis, dərinlik 2N və 3N arasındadır, bu, natamam ola bilsə də, palindrom quruluşunun da ola biləcəyini göstərir. Eyni üsulları iki qadın və iki kişinin oxunuşlarının təkrarlanması ilə də tətbiq etdik S. viminalis şəxslər (digər Salix ZW cinsinin təyini ilə) [21], lakin palindromik bölgə hər iki cinsin oxunması ilə yaxşı əhatə olunmamışdır. Bu onu göstərə bilər S. viminalis daha uzaqdan əlaqəli olsa da, palindromdan məhrumdur S. purpurea olduğundan S. suchowensis, buna görə də bu, sadəcə olaraq bu regionda ardıcıllığın həddindən artıq fərqliliyi ilə bağlı ola bilər.

Palindrom qollarında ardıcıllığın dəyişməsi. a Aralarındakı sabit fərqlərin sıxlığı S. purpureaS. suchowensis 100 bp üçün. b Paraloq ardıcıllıq variantlarının sıxlığı (PSV-lər, dörd palindrom qolu arasındakı fərqlər) S. purpureaS. suchowensis. c Illumina ardıcıllığının nisbi dərinliyi bir qolunun istinad ardıcıllığına uyğunlaşdırılmış oxunur. S. purpurea palindrom, burada 2N bütün genom üzrə gözlənilən oxu düzülməsi dərinliyini təmsil edir. Boz kölgəli sahə palindromun spesifik sabit variantlar üçün zənginləşdirilmiş, lakin PSV-lərdə tükənmiş seqmentini təmsil edir və iki nəsildə diferensial gen çevrilməsi üçün güclü dəlil təmin edir.

Palindromlarda genlərin ifadə nümunələri

Proqnozlaşdırılan transkriptləri təsdiqləmək və palindromlardakı genlərin ifadə nümunələrinin otosomal analoqlarından necə fərqləndiyini müəyyən etmək üçün iki istinad genomunun çoxsaylı toxumalarında ifadə profillərini araşdırdıq. Palindromlardakı genlərin çoxu qadın məhdud ifadəsini göstərir, otozomal nüsxələr isə ümumiyyətlə cinsi yönümlü deyildir (Şəkil 8a). Sitokinin reaksiya tənzimləyicisi (RR) (Sapur.15 W073500) ən yüksək ifadəni catkin toxumasında, ardınca tumurcuq uclarında və gövdələrdə ifadə edir. Əksinə, Chr19-da iki otozomal nüsxədə dişi pişiklər və kişi tumurcuqları ilə məhdudlaşan daha aşağı ifadə göstərilir. Dörd nüsxə SMR gen qadın catkins və digər toxumaların aşağı ifadə göstərir, lakin Chr19 (Sapur.019G001500) üzrə autosomal surəti bütün toxumalarda (Şəkil. 8a) ifadə edilir. Bütün beş nüsxə HCT palindromlardan olan gen dişi pişiklərdə və köklərdə aşağı ekspressiya, yarpaq toxumalarında, tumurcuq uclarında və gövdələrdə daha yüksək ifadə nümayiş etdirdi, bunların hamısı dişi meyilli idi. Palindrom W.P2-dən olan DNT Primase geninin iki nüsxəsi də yarpaq toxumalarında yüksək ifadə nümayiş etdirir, eyni zamanda autosomdakı orijinal nüsxə (Sapur.017G119600) nümunə götürülmüş bütün toxumalarda ifadə edilir. Eynilə, F-da 10 dişi və 10 erkək pişiklərin transkriptomik məlumatlarının təhlili2 ailə palindromlarda olan genlərin otosomal paraloqlarından fərqli olaraq, ilk növbədə qadın toxumasında ifadə olunduğunu təsdiqləyir (Şəkil 8b).

W palindromlarından və otosomal paraloqlardan olan genlərin ifadə profili. a Klon 94006 (qadın) və Fish Creek (kişi) fərqli toxumalarda genlərin normallaşdırılmış oxunma sayları. b 10 dişi və F cinsindən 10 erkək pişiklərdə seçilmiş genlərin normallaşdırılmış oxunma sayları2 ailə. Qalın şriftlə yazılmış gen etiketləri palindromlardandır. Ulduzlar əl ilə qeyd edilmiş genləri göstərir


Giriş

Buğumayaqlılar Yer kürəsində ən çox növ zəngin heyvan filumudur. Buğumayaqlıların dörd sinfindən (Insecta, Crustacea, Myriapoda və Chelicerata) (Şəkil 1) yalnız Myriapoda (qırxayaqlar, millipedlər və onların qohumları) hazırda heç bir ardıcıl genomla təmsil olunmur [1],[2]. Bu yoxluq xüsusilə təəssüf doğurur, çünki bu yaxınlarda miriapodlar bütün həşəratları və xərçəngkimiləri əhatə edən dəstənin canlı qardaş qrupu kimi tanınıblar [3]–[6]. Beləliklə, Myriapodalar müqayisə üçün bir qrup təmin etmək, əcdadların xarakter vəziyyətlərini və birlikdə Yerdəki ən müxtəlif heyvan təbəqəsini təmsil edən həşərat və xərçəngkimilər içərisində təkamül dəyişikliyinin qütblərini müəyyən etmək üçün xüsusilə yaxşı yerləşdirilmişdir.

(Ətraflı məlumat üçün mətnə ​​baxın). Ənənəvi olaraq qəbul edilən dörd artropod sinfi qalın hərflərlə qeyd olunur.

Baxmayaraq ki Drosophila melanogaster ən yaxşı öyrənilmiş artropoddur, onun əcdadlarının ikitərəfli gen dəstində mövcud olan çoxlu genlər yoxdur və xromosomların yenidən qurulması digər filalarla sinteniyanın bütün aşkar sübutlarını pozmuşdur [7]. Beləliklə, o, digər artropodları tam təmsil etmir. Buğumayaqlıların genomlarının daha əhatəli seçilməsi onların əsas strukturunu təyin edəcək və müxtəlif taksonların, məsələn, holometabol həşəratların unikal genomik xüsusiyyətlərinin nə vaxt göründüyünü müəyyən edəcəkdir.

Myriapodların filogenetik mövqeyi

Myriapodlar bu gün iki əsas nəsillə təmsil olunur - otyeyən qırxayaqlar (Diplopoda) və ətyeyən qırxayaqlar (Chilopoda), iki kiçik dəstə ilə birlikdə, səthi olaraq kiçik ağ qırxayaqlara bənzəyən Simfila və kiçik Pauropoda [8]. Hamısı, döş qəfəsi və ya qarın boşluğuna diferensiallaşmadan, kifayət qədər oxşar (homonim) seqmentlərdən ibarət çoxseqmentli gövdə ilə xarakterizə olunur. Bütün son tədqiqatlar, molekulyar və morfoloji, miriapodların monofiliyasını dəstəkləyir [3]–[5],[8]–[10] onların vahid ortaq əcdadı paylaşdıqlarını göstərir.

Myriapodlar, həşəratlar və xərçəngkimilər ənənəvi olaraq antenaları və dişləyən çənələri əhatə edən baş əlavələri ilə xarakterizə olunan mandibulat artropodların bir dəstəsi kimi müəyyən edilmişdir [11]. Bəzi molekulyar məlumat dəstləri bu fikrə etiraz edərək, bunun əvəzinə miriapodların chelicerates [12],[13] ilə bir qardaş qrupu olduğunu irəli sürdü. İndiyə qədər ən əhatəli filogenomik məlumat dəstləri bunu rədd edir və xeliseratların mövcud dörd əsas buğumayaqlıların ən əsası olduğunu və mandibulatların əsl monofiletik qrupu təmsil etdiyini irəli sürən filogeniyanı güclü şəkildə dəstəkləyir [3],[5],[10] ],[14]–[17].

Mandibulatlarda, miriapodların yerüstü artropodlar kimi həşəratlarla ortaq mənşəyi paylaşdığına inanılırdı. Uniramous əzalar, nəfəs borusu vasitəsilə havanın nəfəs alması, ikinci bir cüt antenanın olmaması və Malpigi borularından istifadə edərək ifrazat daxil olmaqla bir sıra ortaq xarakterlərə əsaslanan bu fikir morfoloji əsaslı filogeniyalarla geniş şəkildə dəstəklənir [9],[18]. Bununla belə, molekulyar filogeniyalar böcəklər və miriapodlar arasındakı qardaş qrup əlaqəsini qəti şəkildə rədd edir, miriapodların mənşəyini xərçəngkimilərin şaxələndirilməsinə əsas verir [5] və həşəratları xərçəngkimilər [19]-[21] içərisində törəmə qrup kimi müəyyən edir. Xərçəngkimilər bu gün böyük əksəriyyətlə dəniz qrupu olduğuna və ata-babadan qalmalarına görə, bu o deməkdir ki, miriapodlar və həşəratlar quruda müstəqil işğalları təmsil edirlər (xeliseratlar əlavə, əlaqəsiz işğalı təmsil edir). Onların ortaq xüsusiyyətləri sinapomorfiyalar deyil, təəccüblü yaxınlaşmalardır.

S. maritima Model Myriapod kimi

seçdik S. maritima qismən praqmatik səbəblərə görə ardıcıllıqla növlər kimi: geofilomorf qırxayaqlar, məsələn S. maritima, digər qırxayaqlarla müqayisədə nisbətən kiçik genom ölçülərinə malikdir [22]. Daha da əhəmiyyətlisi, ekoloji və inkişaf tədqiqatları [23]–[25], xüsusən də seqment modelləşdirmə prosesi [26]–[32] üçün maraq kəsb edən bir növdür. S. maritima Fransadan Norveçin ortalarına qədər sahil xətti boyunca tapılan şimal-qərb Avropanın adi qırxayaq növüdür. Bu, yüksək gelgit işarəsi ətrafında meydana gələn və strand xətti ilə əlaqəli bol xərçəngkimilər və həşərat sürfələri ilə qidalanan çınqıllı çimərliklər və qayalı sahillər üzrə mütəxəssisdir. Bu, Britaniya adaları ətrafındakı bu yaşayış yerlərində ən çox yayılmış qırxayaqdır və bəzən uyğun yerlərdə hər kvadrat metrə minlərlə sıxlıqda baş verir [25]. Bu bol populyasiyalardan yayda çoxalma mövsümündə nisbətən az səylə çoxlu miqdarda yumurta yığıla bilər [27]. Onlar laboratoriyada yumurtanın qoyulmasından ən azı ilk sərbəst həyat mərhələsinə, yeniyetmə I [24],[33] kimi yetişdirilə bilərlər.

Bəzi aspektləri S. maritima biologiya bütün qırxayaqlar üçün ümumi deyil. Bunlar arasında diqqət çəkən epimorfik inkişafdır, burada embrionlar yumurtadan son yetkin sayda ayaq daşıyan seqmentlərlə çıxır. Epimorfik inkişaf iki qırxayaq sırasında olur: geofilomorflar (o cümlədən S. maritima) və skolopendromorflar. Bunun əksinə olaraq, daha çox bazal təbəqələr anamorfik inkişaf nümayiş etdirir və post-embrional olaraq seqmentlər əlavə edir [34]. Bu anamorfik təbəqələrin nisbətən az ayaq daşıyan seqmentləri var, ümumiyyətlə 15, geofilomorflarda isə daha çox, bəzi növlərdə təxminən 200-ə qədər var [6]. Bu unikal xüsusiyyətlər, ehtimal ki, ən azı 300 milyon il əvvəl yaranmışdır, çünki daha böyük skolopendromorf qırxayaqların ən erkən fosilləri Üst Karbon dövrünə aiddir [35]. Bunlar geofilomorflarla eyni inkişaf tərzini bölüşürlər və ehtimal olunan bacı qrupudur. Geofilomorflar həmçinin yeraltı həyat tərzinə uyğunlaşdırılmışdır, bütün nizam gözlərin bütün izini itirmişdir [36],[37], lakin görünür, fotohəssaslıq [38] deyil.

genomunu sıraladıq S. maritima filogenetik əhəmiyyətli miriapodların nümayəndəsi kimi. İntensiv şəkildə nümunə götürülmüş holometabol həşəratlardan fərqli olaraq, bu miriapod genomu ilə bağlı təhlilimiz buğumayaqlıların ümumi genomik xüsusiyyətlərinə işıq salmaqla konservativ gen dəstləri və qorunmuş sinteniya tapır.


İstinad ardıcıllığının növləri

Məlumat veriləcək variantlardan asılı olaraq DNT, RNT və ya zülal səviyyəsində müxtəlif istinad ardıcıllığı faylları istifadə olunur. a istifadə edərək, istinad ardıcıllığı faylının növünü göstərmək məcburidir prefiks variantın təsvirindən əvvəl. Təsdiq edilmiş istinad ardıcıllığı növləri bunlardır c., g., m., n., o., səh.r.:

  • g. = xətti genomik istinad ardıcıllığı
  • o. = dairəvi genomik istinad ardıcıllığı
  • m. = mitoxondrial istinad (dairəvi genomik istinad ardıcıllığının xüsusi halı)
  • c. = kodlaşdırma DNT istinad ardıcıllığı (zülal kodlaşdırma transkriptinə əsasən)
  • n. = kodlaşdırılmayan DNT istinad ardıcıllığı (zülal üçün kodlaşdırılmayan transkript əsasında)

Protein

DNT - genomik istinad ardıcıllığı (g.)

  • xətti genomik istinad ardıcıllığı a istifadə edərək göstərilir g. prefiks genomik istinad ardıcıllığı hamısını əhatə edir xətti DNT molekulları və tercihen son genom quruluşuna əsaslanır, məsələn. NC_000023.11 (üçün Homo sapiens GRCh38/hg39 qurun) QEYD: diaqnostik tətbiqlər üçün Locus Reference Genomik ardıcıllığı (LRG), məs. LRG_199 (Dalgleish 2010-a baxın, və ya MacArthur 2014, əlavə olaraq istifadə edilə bilər
    • maraq gen üçün zaman LRG yoxdur mövcuddur, biri tələb edilməlidir.
    • gözləyən” LRG-lərdən istifadə edilməməlidir, onlar təsdiq edilməmişdən əvvəl dəyişə bilər
    • LRG tələb edildikdə, RefSeq ardıcıllığından istifadə tövsiyə olunur, məs. NG_012232.1 (bax: O'Leary 2016)
    • bütün məlum eksonları ehtiva etməli və bütün məlum transkriptləri əhatə etməlidir
    • dərhal gen cinah bölgələrində (məsələn, promotor bölgə) variantların təsvirini asanlaşdırmaq üçün 5' yuxarı (tövsiyə olunur 5 kb) və 3' aşağı axın (tövsiyə olunan 2 kb) ardıcıllığın bir neçə kilobazasını ehtiva etməlidir.

    DNT - dairəvi genomik istinad ardıcıllığı (o.)

    • dairəvi genomik istinad ardıcıllığı a istifadə edərək göstərilir o. prefiks dairəvi genomik istinad ardıcıllığına xloroplast ardıcıllığı, plazmid ardıcıllığı, viral resuens və s. daxildir. İSTİSNA: the m. mitoxondrial istinad ardıcıllığı üçün prefiks yaxşı qurulmuşdur, universal istifadə olunur, birmənalıdır və buna görə də mitoxondrial ardıcıllıqdakı variantlar haqqında məlumat vermək üçün tövsiyə olunur.

    DNT - mitoxondrial istinad ardıcıllığı (m.)

    • mitoxondrial genomik istinad ardıcıllığı a istifadə edərək göstərilir m. mitoxondrial istinad ardıcıllığının prefiksi dairəvi genomik istinad ardıcıllığının xüsusi növüdür. ildən m. prefiks yaxşı qurulmuşdur, universal istifadə olunur və birmənalı olaraq mitoxondrial istinad ardıcıllığının istifadəsi aşağıdakılardan istifadə etməklə göstərilir. m. prefiks
    • üstünlük verilən insan mtDNT istinad ardıcıllığıdır Homo sapiens mitoxondri, tam genom (GenBank NC_012920.1). QEYD: mtDNA istinad ardıcıllığı a-dır dairəvi molekul (Açıq Məsələlərə baxın)

    DNT - kodlayan DNT istinad ardıcıllığı (c.)

    • kodlaşdırma DNT istinad ardıcıllığı a istifadə edərək göstərilir c. prefiks
    • (insan) bir gendəki variantları təsvir etmək üçün istifadə edilməli tövsiyə olunan transkript tərəfindən tövsiyə olunan transkriptdir. MANE konsorsiumu.
    • kodlaşdıran DNT istinad ardıcıllığı bir genin zülal kodlaşdıran transkriptinə əsaslanan, nukleotidlərin nömrələnməsi üçün istifadə oluna bilən DNT istinad ardıcıllığıdır. c. prefiks. Belə bir istinad ardıcıllığına kodlaşdırma DNT ardıcıllığı (CDS) və 5' və 3' UTR bölgələri daxildir.
    • üstünlük verilən kodlaşdırma DNT istinad ardıcıllığı a-dır Lokus İstinad Genomik ardıcıllığı (LRG).
      • heç bir LRG olmadıqda, tələb edilməlidir.
        • qeyd edin ki LRG-lər sabitdir (heç vaxt dəyişməyin), müxtəlif ekspertlərlə məsləhətləşdikdən sonra müəyyən edilir və bütün məlum transkript variantları və protein izoformları qeyd edilə bilər
        • LRG_ üçün annotasiya edilmiş "transkript variantı 1” kimi təsvir olunur t1 ”, məs. LRG_199 t1 :c.11T>G
        • NC_ və ya NG_ istinad ardıcıllığı üçün istifadə edilən şərh edilmiş transkript birbaşa giriş.versiya nömrəsindən sonra mötərizədə verilir və NC_000023.10(NM_004006.2):c.357+1G>A və ya NG_012232.1(N0_02) kimi variant təsvirlərini verir: c.357+1G>A
        • əsas oxu çərçivəsini pozan ekzonlar daxil edilməməlidir
        • insanlar üçün EBI üstünlük verilən transkripti seçmək üçün aşağıdakı iyerarxiyadan istifadə edir: 1. dayanma kodonları olmayan ən uzun CCDS tərcüməsi. 2. yoxdursa (1), dayanma kodonları olmayan ən uzun Ansambl/Havana birləşmiş tərcüməni seçin. 3. yoxdursa (2), dayanma kodonları olmayan ən uzun tərcüməni seçin. 4. tərcümə yoxdursa, protein kodlaşdırmayan ən uzun transkripti seçin.

        DNT - kodlaşdırmayan DNT istinad ardıcıllığı (n.)

        • kodlaşdırılmayan DNT istinad ardıcıllığı a istifadə edərək göstərilir n. prefiks
        • (insan) bir gendəki variantları təsvir etmək üçün istifadə edilməli tövsiyə olunan transkript tərəfindən tövsiyə olunan transkriptdir. MANE konsorsiumu.
        • üstünlük verilən kodlaşdırılmayan DNT istinad ardıcıllığı a-dır Lokus İstinad Genomik ardıcıllığı (LRG).
          • heç bir LRG olmadıqda, tələb edilməlidir.
            • qeyd edin ki LRG-lər sabitdir (heç vaxt dəyişməyin), müxtəlif ekspertlərlə məsləhətləşdikdən sonra müəyyən edilir və bütün məlum transkript variantlarına şərh verilə bilər
            • LRG_ üçün şərh edilmiş "transkript variantı 1” kimi təsvir olunur t1 ”, məs. LRG_163 t1 :n.5C>T

            RNT istinad ardıcıllığı (r.)

            • RNT istinad ardıcıllığı a istifadə edərək göstərilir r. prefiks
            • (insan) bir gendəki variantları təsvir etmək üçün istifadə edilməli tövsiyə olunan transkript tərəfindən tövsiyə olunan transkriptdir. MANE konsorsiumu.
            • üstünlük verilən RNT istinad ardıcıllığı a-dır Lokus İstinad Genomik ardıcıllığı (LRG).
              • heç bir LRG olmadıqda, tələb edilməlidir.
              • gözləyən” LRG-lərdən istifadə edilməməlidir, onlar təsdiq edilməmişdən əvvəl dəyişə bilər
              • LRG tələb edildikdə, RefSeq ardıcıllığından istifadə tövsiyə olunur, məs. NM_004006.2 və ya NR_002196.1 (bax: O'Leary 2016)
              • LRG_ üçün şərh edilmiş "transkript variantı 1” kimi təsvir olunur t1 ”, məs. LRG_199 t1 :r.11u>g
              • NC_ və ya NG_ istinad ardıcıllığı üçün istifadə edilən şərh edilmiş transkript birbaşa giriş.versiya nömrəsindən sonra mötərizədə verilir və NC_000023.10(NM_004006.2):r.357_358ins357+1_357+12 və ya NG_012.012(NG_012.012) kimi variant təsvirlərini verir. ):r.357_358ins357+1_357+12
              • kodlaşdıran DNT istinad ardıcıllığı intron ardıcıllığını ehtiva etmir və buna görə də ola bilər istifadə edilməməlidir intron ardıcıllığına təsir edən variantları təsvir etmək

              Protein istinad ardıcıllığı (s.)

              • zülal istinad ardıcıllığı a istifadə edərək göstərilir səh. prefiks
              • (insan) bir gendəki variantları təsvir etmək üçün istifadə edilməli tövsiyə olunan transkript tərəfindən tövsiyə olunan transkriptdir. MANE konsorsiumu.
              • üstünlük verilən protein istinad ardıcıllığı a-dır Lokus İstinad Genomik ardıcıllığı (LRG).
                • heç bir LRG olmadıqda, tələb edilməlidir.
                • gözləyən” LRG-lərdən istifadə edilməməlidir, onlar təsdiqlənməmişdən əvvəl dəyişə bilər
                • LRG tələb edildikdə, RefSeq ardıcıllığından istifadə tövsiyə olunur, məs. NP_003997.1 (bax: O'Leary 2016)
                • LRG_ üçün şərh edilmiş "protein izoformu 1” kimi təsvir olunur p1 ”, məs. LRG_199 p1 :s.(Val25Gly)

                Nəticələr

                Boru kəmərimizdə (Usullara baxın) biz 53 onurğalı və insan genomu arasında cüt-cüt düzülmə bloku bölgələrini müqayisə etdik və əksər məməlilərə nisbətən məməli olmayan onurğalılarla daha çox qorunma göstərən insan genomu ardıcıllıqlarını çıxardıq. Bənzərlik həddi (40%) və məməli genomları ilə hg19 arasında uzunluq əhatəsi (40%) ilə boru kəmərimiz 1000 bps-dən daha uzun 1467 HGT bölgəsini tapdı.

                Xromosomlarda proqnozlaşdırılan HGT bölgələrinin yerləşməsi

                Bu HGT bölgələrini insan xromosomlarında yerləşdirdik. HGT bölgələrinin sayı xromosomdan xromosoma qədər dəyişir və HGT bölgələrinin əksəriyyəti xromosomların hər iki ucunda yerləşir (Cədvəl 1, Şəkil 2). Xromosomların hər iki ucunda və ortasında HGT bölgələrinin tezliyini hesabladıq və xromosomların hər iki ucunda HGT bölgələrinin tezliyinin xromosomların ortasından (qoşalaşmış) əhəmiyyətli dərəcədə böyük olduğunu gördük. t-test səh-qiymət < 0,001).

                İnsan genomunun xromosomlarında proqnozlaşdırılan HGT bölgələrinin paylanması. Hər bir xromosomda HGT bölgələrinin yeri göstərildi. İdentifikasiya boru kəmərində istifadə edilən həddlər identiklik 40%, insan genomunun uyğunlaşdırılmış bölgəsinin uzunluğu 1000 bps-dən uzun və əhatə dairəsi insan genomu bölgələrinin 40% -dən çox idi. HGT regionlarının ümumi sayı 1467 olub

                Burada proqnozlaşdırdığımız HGT bölgələri primatların məməlilərdən ayrılmasından sonra baş verdiyinə görə, bu kəşf bizi HGT fraqmentlərinin xromosomların hər iki ucuna yerləşdirmə ehtimalının daha yüksək ola biləcəyini ehtimal etməyə aparır.

                Üst-üstə düşmüş genlərin təhlili

                Proqnozlaşdırılan HGT bölgələri ilə üst-üstə düşən 642 Ensemb genini tapdıq və genlərin növləri Ensemble gen annotasiyasına uyğun olaraq müəyyən edildi. Ən çox yayılmış gen növü HGT bölgələrinin 39,1%-ni əhatə edən “protein kodlaması”, ikinci yerdə “lincRNA” (6,6%) və “antisens” (2,9%) olub. Qeyri-gen bölgəsi HGT bölgələrinin 46,1%-ni əhatə edir. Ümumi məlumat (bütün insan genomu) göstərdi ki, “protein kodlayan” genlər insan genomunun 40,7%-ni, sonra “lincRNA” (7,0%) və “antisens” (3,7%) tutur. Qeyri-gen bölgələri insan genomunun 45,7%-ni əhatə edir (Cədvəl 2, Şəkil 3a). Buna görə də, üst-üstə düşən genlərin gen tipli tərkibi fondan əhəmiyyətli dərəcədə fərqlənmir.

                a HGT bölgələri ilə üst-üstə düşən gen növləri. Üst-üstə düşən Ensemb genləri çıxarıldı və Ensembl Mənbə cədvəli axtarıldı. Üst-üstə düşən genlər zülal kodlaşdırması, lincRNA, antisens və digərləri (işlənmiş transkript, işlənmiş psevdogen və s.) kimi müəyyən edilmişdir. Pasta diaqramımız üst-üstə düşən genlərin gen tipi nisbətlərini fon kimi insanın bütün geninə qarşı müqayisə etdi. b, cd Gen zənginləşdirmə analizi. Gen zənginləşdirmə nəticələri üç aspektdə göstərilmişdir, bioloji proseslər (Şəkil 2b), hüceyrə komponentləri (Şəkil 2c) və molekulyar funksiyalar (Şəkil 2d). Pasta diaqramımız üst-üstə düşən genlərin gen funksiyası terminini fon kimi insanın bütün geninə qarşı müqayisə etdi

                Üst-üstə düşən genlərin zənginləşdirilməsini hesablamaq üçün DAVID-dən istifadə edərək, Gen Ontologiyası (GO) verilənlər bazasında funksiya annotasiyası olan 435 geni kəşf etdik və onları funksional qruplara ayırdıq və müəyyən funksiyalar üzrə zənginləşmələrini təhlil etdik. Dəyişdirilmiş Fisher Exact testi ilə (səh-dəyər < 0.05), biz bir müddət gen funksiyalarının əhəmiyyətli dərəcədə zənginləşdiyini kəşf etdik. Bu termin metal ionlarının bağlanmasıdır (120 gen) (Cədvəl 3). Biz həmçinin hüceyrə hissəsinin genlərinin nisbətinin fondan daha çox olduğunu aşkar etdik (Şəkil 3c, d). Ümumiyyətlə, HGT bölgələrinin təsir etdiyi ən əhəmiyyətli gen funksiyası ion bağlamasıdır.

                Proqnozlaşdırılan HGT bölgələrinin xromatin vəziyyəti

                Proqnozlaşdırılan HGT bölgələrinin və insan genomunun Xromatin Dövlətlərini müqayisə etdikdə, HGT bölgələrinin 61%-nin heterokromatin, 23%-nin transkripsiya və 6,8%-nin repressiyaya məruz qaldığını aşkar etdik. Bununla belə, insan genomunda 72% heterokromatin, 20% transkripsiya və 1,6% repressiyaya məruz qalmışdır. (Cədvəl 4, şək. 4). HGT bölgələrinin orta transkripsiya səviyyəsindən daha aktiv olduğunu və insan genomunda mühüm funksional rol oynaya biləcəyini göstərdi.

                HGT bölgələrinin xromatin vəziyyətləri. Proqnozlaşdırılan HGT ardıcıllığının xromatin vəziyyətlərinə heterokromatin (Heteroxrom), transkripsiya edilmiş bölgə (Txn), Gücləndirici, Promoter, Bastırılmış, İzolyator və Təkrarlayıcı daxildir. HGT bölgələrinin xromatin vəziyyəti nisbətləri fon kimi bütün insan genomu ilə göstərildi

                Proqnozlaşdırılan HGT bölgələrində təkrarlanan elementlər

                RepeatMasker trekindən istifadə edərək, məlum təkrarlar olan HGT bölgələrinin faizini, eləcə də hər təkrar növünün nisbətini (sadə təkrar, SINE, LINE və s.) hesabladıq. HGT bölgələrində təkrarların faizi (orta: 24%) fon bölgəsindən (orta: 41%) aşağı olmuşdur. Ən çox yayılmış təkrarlama növü bütün HGT bölgələrinin təxminən 10% -ni tutan "sadə təkrar", 4,5% ilə "Aşağı mürəkkəblik təkrarı"dır. Ümumi məlumatlar göstərir ki, insan genomunda ən çox yayılmış təkrar növləri “sadə təkrarların” minimal miqdarı ilə LINE və SINE təkrarlarıdır (Şəkil 5a).

                a HGT bölgələrinin təkrarlarının paylanması. Proqnozlaşdırılan HGT bölgələrində müxtəlif növ təkrarların, o cümlədən SINE-lər, Xətlər, LTR-lər, DNT təkrarları, sadə təkrarlar, aşağı mürəkkəblik və s. nisbətləri göstərilmişdir. Hər bir HGT ardıcıllığı və frankinq bölgələri beş bölgəyə bölündü: pəncərə 1 (w1, ardıcıllığın 300 bps yuxarı hissəsi), pəncərə 2 (w2, HGT bölgələrinin başlanğıcı 300 bps), pəncərə 3 (w3, orta bölgələr). HGT regionları), windows 4 (w4, ardıcıllığın sonu 300 bps) və windows 5 (w5, 300 bps ardıcıllığın aşağı axını). Bundan əlavə, HGT bölgələri və bütün insan genomu üçün təkrar növlərin paylanması. b HGT bölgələrində təkrarların paylanması. Ardıcıllığımızın beş bölgəsində müxtəlif növ təkrarların orta nisbətlərini hesabladıq və HGT bölgələri daxilində və HGT bölgələrinin yuxarı və aşağı axınında 1 kbps daxilində müxtəlif növ təkrarların orta nisbətləri əyrisini çəkdik. X oxunu altı intervala ayıra bilərik: 0-dan 300 bps-ə qədər interval HGT bölgələrinin 1 kbps yuxarı axını deməkdir, 300 bps ilə 600 bps arasında interval HGT bölgələrinin başlanğıc 300 bps, 600 bps ilə 900 arasında interval deməkdir. bps HGT bölgələrinin orta bölgələrini, 900 bps-dən 1200 bps-ə qədər olan interval HGT bölgələrinin 300 bps bitməsini, 1200 bps ilə 1500 bps arasında HGT bölgələrinin 300 bps aşağı axını, 1500 bps ilə 1700 arasında interval deməkdir. bps bütün insan genomu deməkdir. cd HGT bölgələrində GC məzmunu və histon modifikasiyası. Biz GC məzmununu hesabladıq və Şəkil 5c, d-də təkrarlar üçün etdiyimiz yuxarıdakı bölməyə oxşar yanaşma ilə ardıcıllığımız üçün GC məzmunu və histon modifikasiya əyrisini çəkdik. Histon markalarımıza H3K4Me1, H2A.Z, H3K4Me3, H3K9Ac, H3K27Ac, ​​H3K27Me3 və s.

                Yan bölgələrlə müqayisədə proqnozlaşdırılan HGT bölgələrində “sadə təkrar” və “Aşağı mürəkkəblik təkrarı” daha yüksək faizlər var. Lakin “LTR”, “SINE” və “LINE” təkrarları kimi digər təkrar növləri üçün HGT bölgələrində faiz yuxarı və aşağı axın bölgələrindən aşağıdır (Şəkil 5b).

                Proqnozlaşdırılan HGT bölgələrinin GC məzmunu

                Biz proqnozlaşdırılan HGT bölgələrinin və onların 300 bps yuxarı və aşağı axın bölgələrinin CG məzmununun orta faizini hesabladıq. HGT bölgələrinin orta GC faizi yuxarı və aşağı axın bölgələrindən daha yüksəkdir (Şəkil 5c).

                Proqnozlaşdırılan HGT bölgələrinin histon modifikasiyası təhlili

                Proqnozlaşdırılan HGT bölgələrində və onların 300 bp yuxarı və aşağı axın bölgələrində tənzimləmə ilə əlaqəli histon modifikasiyası siqnallarının orta faizini hesabladıq. Nəticələr HGT bölgələrində histon modifikasiyasının əhəmiyyətli bir xüsusiyyətini göstərmədi (Şəkil 5d).

                Filogenetik ağac analizi

                Bizim boru kəmərimiz əksər məməlilərə nisbətən məməli olmayan onurğalıların daha çox qorunduğu HGT bölgələrini tapa bilər. Onu da qeyd etmək lazımdır ki, biz insan genomu ilə homoloji ardıcıllığı olan səkkizdən az məməliyə icazə veririk. Həqiqətən də, tapdığımız əksər HGT bölgələri üçün bəzi məməlilərin hg19 ilə homoloji ardıcıllığı var və onların əksəriyyəti primatlardır. Bu hadisə primatların əcdadı ilə məməli olmayan onurğalılar arasında üfüqi gen transferinin baş verdiyini göstərirdi.

                HGT mexanizmini daha da başa düşmək üçün məməlilərdə və qeyri-məməli növlərdə proqnozlaşdırılan üfüqi gen transfer ardıcıllığının homoloji ardıcıllığını çıxardıq, ardıcıllıq filogenetik ağacını qurduq və onu növ filogenetik ağac ilə müqayisə etdik. İki filogenetik ağacın müqayisəsi göstərdi ki, əksər hallarda iki filogenetik ağac ardıcıl deyildir. Sonra biz bir ağacı digərinə çevirmək üçün tələb olunan alt ağac budaması və köçürmələrin (SPR) sayını təxmin edən SPRIT proqramından istifadə edərək proqnozlaşdırılan HGT bölgələrindən tikilmiş ağacı növlərin genomlarından tikilmiş ağacla müqayisə etdik. SPRIT çıxışından aydın oldu ki, əksər HGT bölgələri üçün homoloji ardıcıllıqların filogenetik ağac topologiyasını izah etmək üçün ən azı üç və ya dörd SPR tələb olunur. Hər bir SPR ən azı bir HGT hadisəsinə uyğun ola bilər, buna görə də biz onurğalıların təkamül tarixi ərzində ən azı üç və ya dörd növlərarası HT hadisəsinin baş verdiyi qənaətinə gəlirik. Bundan əlavə, bu HGT hadisələrinin mümkünlüyünü yoxladıqda, bütün və ya əksər primatların əcdadı ilə məməli olmayanlar arasında ən azı bir HGT hadisəsinin olduğunu gördük.

                Məməli onurğalılar və hg19 arasında oxşarlıq həddi (60%) və uzunluq əhatəsi (0) ilə biz uzunluğu 1000 bps-dən çox olan 22 fraqment çıxardıq. Bu ardıcıllıqların HGT bölgələri olma ehtimalı yüksəkdir. Biz aşkar etdik ki, bu fraqmentlərdən biri, diapazon = chr11:71072901–71074379, dörd primatda (İnsan, Şimpan, Qorilla və Oranqutan), bir məməlidə (Çin hamsteri), birində homoloq ardıcıllığına malikdir. Lepidosauriya (Kərtənkələ) və bir balıq (Lamprey). Digər növlərdəki HGT bölgələrimizin homoloji ardıcıllığını tapmaq üçün Nukleotidlərin toplanması məlumat bazasında axtarış etdikdə bir neçə balıq (məsələn, Cyprinus carpio, Lethenteron camtschaticum və s.) homoloji ardıcıllığa malikdir və bu, balıqların bu HGT bölgəsinin mənşəyi ola biləcəyini göstərir. HGT fraqmentləri və növ genomları tərəfindən qurulan filogenetik ağacları müqayisə edərək, uyğunsuzluğu izah etmək üçün ən azı üç proqnozlaşdırılan HGT hadisəsinin tələb olunduğunu aşkar etdik. Balıqlarla Primatlar arasında, balıqlarla Kərtənkələ arasında və ya Primatlarla Çin hamsteri arasında HGT hadisələrinin baş verə biləcəyini düşündük (Şəkil 6). Buna görə də, bu HGT fraqmentinin təkamül tarixi ərzində üç növlərarası HGT hadisəsinin baş verə biləcəyi qənaətinə gəldik.

                Potensial bir HGT nümunəsi. Biz bir HGT fraqmentinin homoloji ardıcıllığını uyğunlaşdırdıq (aralıq = chr11:71072901–71074379) və filogenetik ağac qurduq. Biz homoloji ardıcıllıqlardan istifadə edərək qurduğumuz filogenetik ağacı növlərin filogenetik ağacı ilə müqayisə etdik və iki filogenetik ağac arasındakı fərqi vurğuladıq. Qırmızı kənarlar bu HGT fraqmentlərinin mənşəli növlərini təmsil edir. The mavi kənarlar bu HT ardıcıllığının köçürüldüyü hədəf növləri təmsil edir. The qırmızı oxlar iki növ arasında üfüqi köçürmə prosesini göstərir

                Media növlərində homoloji ardıcıllıqlar

                İtirilmiş genin interpolyasiyasını aradan qaldıra bilmədik. Bununla belə, müəyyən etdiyimiz bu bölgələr üçün HGT-ni dəstəkləmək üçün daha çox dəlil tapıla bilər.Proqnozlaşdırılan HGT fraqmentlərinin homoloji ardıcıllıqlarını tapmaq üçün Nukleotid kolleksiyası verilənlər bazasında axtarış etdikdə, HGT-nin inkişafı üçün media növləri ola biləcək parazit, bakteriya və ya göbələk kimi bəzi növlərdə onları tapa bildik. Nəticələr göstərdi ki, bizim proqnozlaşdırılan HGT fraqmentlərinin əksəriyyəti insanlarda, balıqlarda, quşlarda, quşlarda və mal-qarada homoloq ardıcıllığına malikdir. Ən etibarlı proqnozlaşdırılan 22 HGT bölgəsi arasında 6-sı insanın ən azı bir trematod parazitində homoloq ardıcıllığına malikdir (Cədvəl 5), məsələn: EchinostomaŞistosoma. Hər ikisi EchinostomaŞistosoma insana və digər məməlilərə yoluxa bilər. Schistosoma-nın bəzi növləri quşları və timsahları da yoluxa bilər. Proqnozlaşdırılan HGT fraqmentlərinin homoloji ardıcıllığına malik olmayan digər trematodlar da balıqları yoluxa bilər [29]. Bizim proqnozlaşdırılan HGT fraqmentlərindən bəziləri primatlarda və bəzi balıq və quş növlərində tapıla bilər. Filogenetik ağac analizimizdən balıqlar, quşlar, primatlar və bir neçə məməlilər arasında baş verən bir neçə HGT hadisəsinin ola biləcəyini proqnozlaşdırdıq ki, bu da bizi balıqların və quşların HGT irəliləyişinin və trematod parazitlərinin və ya onların ümumi mənşəyi ola biləcəyini düşünməyə vadar edir. ata HGT prosedurları üçün media növləri ola bilər.


                Adam, E., Deak, M., Kay, S., Chua, N.H. və Nagy, F. 1993. Bir tütünün ardıcıllığı (Nicotiana tabacum) A tipi fitoxrom üçün gen kodlaması. Bitki fiziol. 101: 1407–1408.

                Adam, E., Kozma-Bognar, L., Dallmann, G. və Nagy, F. 1995. Tütün fitoxrom-A genlərinin transkripsiyası bir çox başlanğıc yerində başlayır və çoxlu tələblər tələb edir. cis- fəaliyyət göstərən tənzimləyici elementlər. Bitki Mol. Biol. 29: 983–993.

                Adam, E., Kozma-Bognar, L., Schäfer, E. və Nagy, F. 1997. Tütün fitoxromları: genlər, struktur və ifadə. Bitki Hüceyrə Ətrafı. 20: 678–684.

                Ahn, S.N. və Tanksley, S.D. 1993. Düyü və qarğıdalı genomlarının müqayisəli əlaqə xəritələri. Proc. Natl. akad. Sci. ABŞ 90: 7980–7984.

                Ostin, D.F. və Li, M. 1996a. F-də müqayisəli xəritəçəkmə2:3 və F6:7 qarğıdalıda taxıl məhsuldarlığı və məhsul komponentləri üçün kəmiyyət əlamət lokuslarının nəsilləri. Teor. Tətbiq. Genet. 92: 817–826.

                Ostin, D.F. və Li, M. 1996b. Qarğıdalının rekombinant inbred cinsləri ilə çiçəkləmə və bitki boyu üçün kəmiyyət əlamətlərin yerlərinin genetik həlli və yoxlanılması. Genom 39: 957–968.

                Causse, M., Fulton, TM, Cho, YG, Ahn, SN, Chunwongse, J., Wu, K., Xiao, J., Yu, Z., Ronald, PC, Harrington, SE, Second, GA, McCouch , SR və Tanksley, S.D. 1994. Növlərarası geri kross populyasiyaya əsaslanan düyü genomunun doymuş molekulyar xəritəsi. Genetika 138: 1251–1274.

                Chao, S., Baysdorfer, C., Heredia-Diaz, O., Musket, T., Xu, G. və Coe, E.H. 1994. Qarğıdalıda qismən ardıcıllaşdırılmış yarpaq cDNA klonlarının RFLP xəritəsi. Teor. Tətbiq. gen. 88: 717–721.

                Childs, K.L., Miller, F.R., Cordonnier-Pratt, M.-M., Pratt, L.H., Morgan, P.W. və Mullet, J.E. 1997. Sorghum fotoperiod həssaslıq geni, Ma3, fitoxrom B kodlayır. Bitki fiziol. 113: 611–619.

                Christensen, A.H. və Quail, P.H. 1989. Qarğıdalı fitoxrom kodlayan geninin strukturu və ifadəsi. Gen 85: 381-390.

                Kilsə, G.M. və Gilbert, W. 1984. Genomik ardıcıllıq. Proc. Natl. akad. Sci. ABŞ 81: 1991–1995.

                Clapham, D.H., Kolukisaoglu, H.Ñ., Larsson, C.-T., Qamaruddin, M., Ekberg, I., Wiegmann-Eirund, C., Schneider-Poetsch, H.A.W. və von Arnold, S. 1999. Fitoxrom tipləri PiceaPinus. ifadə nümunələri PHYA- əlaqəli növlər. Bitki Mol. Biol. 40: 669–678.

                Cowl, J.S., Hartley, N., Xie, D.-X., Whitelam, G.C., Murphy, G.P. və Harberd, N.P. 1994. The PHYC gen Ərəbidopsis. Üçüncü intronun olmaması aşkar edilmişdir PHYAPHYB. Bitki fiziol. 106: 813–814.

                Davison, A.J. və Moss, B. 1989. Vaccinia virus erkən təşviqatçılarının strukturu. J. Mol. Biol. 210: 749–769.

                Dehesh, K., Franci, C., Sharrock, R.A., Somers, D.E., Welsch, J.A. və Quail, P.H. 1994. The Ərəbidopsis fitoxrom A geninin çoxlu transkripsiya başlanğıc nöqtələri və monokot fitoxrom A genlərinin repressor elementi ilə homoloji promotor ardıcıllığı motivi var. Fotokimya. Fotobiol. 59: 379–384.

                Dehesh, K., Tepperman, J., Christensen, A.H. və Quail, P.H. 1991. phyB təkamül yolu ilə qorunub saxlanılır və konstruktiv olaraq çəltik tumurcuqlarında ifadə edilir. Mol. General Genet. 225: 305–313.

                Devlin, P.F., Patel, S.R. və Whitelam, G.C. 1998. Fitoxrom E internode uzanmasına və çiçəkləmə müddətinə təsir göstərir Ərəbidopsis. Bitki Hüceyrəsi 10: 1479–1487.

                Devlin, P.F., Rood, S.B., Somers, D.E., Quail, P.H. və Whitelam, G.C. 1992. Fotofiziologiya uzanmış internod (ein) mutant Brassica rapa: the ein mutantda aşkar edilə bilən fitoxrom B kimi polipeptid yoxdur. Bitki fiziol. 100: 1442–1447.

                Geballe, A.P. 1996. Upstream AUG kodonları ilə vasitəçilik edilən tərcümə nəzarəti. In: J.W.B. Hershey, M.B. Mathews və N. Sonenberg (Eds.) Translational Control, Cold Spring Harbor Laboratory Press, Plainview, NY, s. 173.

                Goosey, L., Palecanda, L. və Sharrock, R.A. 1997. ifadənin diferensial qanunauyğunluqları Arabidopsis PHYB, PHYD, və PHYE fitoxrom genləri. Bitki fiziol. 115: 959–969.

                Halliday, K.J., Tomas, B. və Whitelam, G.C. 1997. Transgen tütün bitkilərində heteroloji fitoxrom A, B və ya C ifadəsi vegetativ inkişafı və çiçəkləmə vaxtını dəyişir. Bitki J. 12: 1079–1090.

                Hanelt, S., Braun, B., Marx, S. and Schneider-Poetsch, H. 1992. Fitoxrom təkamülü: kriptoqamik bitkinin fitoxrom A-nın ilk tam ardıcıllığına malik filogenik ağac (Selaginella martensii Bahar). Fotokimya. Fotobiol. 56: 751–758.

                Hershey, H.P., Barker, R.F., Idler, K.B., Lissemore, J.L. və Quail, P.H. 1985. Fitoxrom üçün klonlanmış cDNT və genomik ardıcıllıqların təhlili: etiollaşdırılmış şəkildə ifadə olunan iki gen məhsulu üçün tam amin turşusu ardıcıllığı Avena. Nucl. Acids Res. 13: 8543–8559.

                Hershey, H.P., Barker, R.F., Idler, K.B., Murray, M.G. və Quail, P.H. 1987. Nukleotid ardıcıllığı və fitoxrom polipeptidini kodlayan genin xarakteristikası Avena. Gen 61: 339-348.

                Heun, M., Kennedi, A.E., Anderson, J.A., Lapitan, N.L.V., Sorrells, M. və b. 1991. Arpa üçün məhdudlaşdırıcı fraqment uzunluğu polimorfizm xəritəsinin qurulması (Hordeum vulgare). Genom 34: 437–447.

                Heyer, A. və Gatz, C. 1992a. Kartof növü A fitoxromu üçün kodlaşdırma cDNA-klonunun təcrid edilməsi və xarakteristikası. Bitki Mol. Biol. 18: 535–544.

                Heyer, A. və Gatz, C. 1992b. Kartof B tipi fitoxrom üçün kodlaşdırma cDNA-klonunun təcrid edilməsi və xarakteristikası. Bitki Mol. Biol. 20: 589–600.

                Hughes, J., Lamparter, T. and Mittmann, F. 1996. CpPHY2 (PHYCER2), 'normal' fitoxrom Ceratodon. Bitki fiziol. 112: 446.

                Kaneko, T., Matsubayashi, T., Sugita, M. və Suguira, M. 1996. Birhüceyrəli siyanobakteriyanın fiziki və gen xəritələri Sinekokok sp. PCC6301 genomunun ştammı. Bitki Mol. Biol. 31: 193–201.

                Kay, S.A., Keith, B., Shinozaki, K., Chye, M.-L. və Chua, N.-H. 1989a. Düyü fitoxrom geni: struktur, avtoregulated ifadə və GT-1-in 5′ yuxarı bölgəsində qorunan bir yerə bağlanması. Bitki Hüceyrəsi 1: 351–360.

                Kay, S.A., Keith, B., Shinozaki, K. və Chua, N.-H. 1989b. Düyü fitoxrom geninin ardıcıllığı. Nucl. Acids Res. 17: 2865–2866.

                Kendrick, R.E., Kerchoffs, L.H.J., van Tuinen, A. and Koornneef, M. 1997. Pomidorun fotomorfogen mutantları. Bitki Hüceyrə Ətrafı. 20: 746–751.

                Kendrick, R.E. və Kronenberg, G.H.M. 1994. Bitkilərdə fotomorfogenez, 2-ci nəşr, Kluwer Academic Publishers, Dordrecht, Hollandiya.

                Kosambi, D.D. 1944. Rekombinasiya qiymətlərindən xəritə məsafələrinin qiymətləndirilməsi. Ann. Genet. 12: 172–175.

                Lagarias, D.M., Wu, S.-H., Lagarias, J.C. 1995. Yaşıl yosunlarda atipik fitoxrom gen quruluşu Mesotaenium caldariorum. Bitki Mol. Biol. 29: 1127–1142.

                Lander, E.S., Green, P., Abrahamson, J., Barlow, A., Daly, M., Linkoln, S.E. və Newburg, L. 1987. MAPMAKER: eksperimental və təbii populyasiyaların xəritələri üçün interaktiv kompüter paketi. Genomika 1: 174–181.

                Lazarova, G.I., Kerckhoffs, L.H.J., Brandstädter, J., Matsui, M., Kendrick, R.E., Cordonnier-Pratt, M.-M. və Pratt, L.H. 1998a. Molekulyar analiz a PHYA Pomidorun yabanı tipli və fitoxromlu mutantlarında. Bitki J. 14: 653–662.

                Lazarova, G.I., Kubota, T., Frances, S., Peters, J.L., Hughes, M.J.G., Brandstädter, J., Széll, M., Matsui, M., Kendrick, R.E., Cordonnier-Pratt, M.-M. və Pratt, L.H. 1998b. Pomidorun xarakteristikası PHYB1 və dörd mutant alleldə molekulyar qüsurların müəyyən edilməsi. Bitki Mol. Biol. 38: 1137–1146.

                Ló pez-Juez, E., Nagatani, A., Tomizawa, K.-I., Deak, M., Kern, R., Kendrick, R.E. və Furuya, M. 1992. Xiyar uzun hipokotil mutantında yüngül dayanıqlı phyB kimi fitoxrom yoxdur. Bitki Hüceyrəsi 4: 241–251.

                Mathews, S. və Sharrock, R.A. 1996. Otlarda fitoxrom gen ailəsi (Poaceae): filogeniya və otların ikibucaqlı angiospermlərdə tapılan lokusların alt çoxluğuna malik olduğuna dair sübut. Mol. Biol. Təkamül. 13: 1141–1150.

                Mathews, S. və Sharrock, R.A. 1997. Fitoxrom gen müxtəlifliyi. Bitki Hüceyrə Ətrafı. 20: 666–671.

                Mathews, S., Lavin, M. və Sharrock, R.A. 1995. Fitoxrom gen ailəsinin təkamülü və onun angiospermlərin filogenetik analizləri üçün faydası. Ann. Miss Bot. Bağ 82: 296–321.

                Matz, M., Shagin, D., Bogdanova, E., Britanova, O., Lukyanov, S., Diatchenko, L. and Chenchik, A. 1999. cDNA-nın gücləndirilməsi şablon keçid effekti və kənara çıxma əsasında bitir. PCR. Nucl. Acids Res. 27: 1558–1560.

                Maucher, P.H. 1994. Molecularbiologie der Phytochrome des Farns Anemiya phyllitidis (L.) SW. Tezis, Ulm Universiteti, Ulm, Almaniya.

                McCouch, S.R., Kochert, G., Yu, Z.H., Wang, Y.Z., Khush, G.S., Coffman, R. and Tanksley, S.D. 1988. Düyü xromosomlarının molekulyar xəritəsi. Teor. Tətbiq. Genet. 76: 815–829.

                Ming, R., Liu, S.-C., Lin, Y.-R., da Silva, J., Wilson, W., Braga, D., van Deyzne, A., Wenslaff, TF, Wu, KK , Moore, PH, Burnquist, W., Sorrells, ME, Irvine, JE and Paterson, AH 1998. Saxarum və sorghum xromosomlarının ətraflı uyğunlaşdırılması: yaxından əlaqəli diploid və poliploid genomlarının müqayisəli təşkili. Genetika 150: 1663–1682.

                O'Donoughue, L.S., Wang, Z., Roder, M., Kneen, B., Legget, M. və b. 1992. İki diploid takson arasında xaç üzərində yulafın RFLP-ə əsaslanan xəritəsi (Avena atlantica x A. hirtula). Genom 35: 765–771.

                Oh, S.-K., Scott, M.P. və Sarnow, P. 1992. Homeotik gen Antennapediya mRNT daxili ribosom bağlanması ilə translyasiya başlanğıcını təmin edən 5′-kodlanmayan ardıcıllıqları ehtiva edir. Genes Dev. 6: 1643–1653.

                Paterson, A.H., Lin, Y.-R., Li, Z., Schertz, K.F., Doebley, J.F., Pinson, S.R.M., Liu, S.-C., Stansel, J.W. və Irvine, J.E. 1995. Müvafiq genetik lokuslarda müstəqil mutasiyalarla dənli bitkilərin konvergent əhliləşdirilməsi. Elm 269: 1714–1717.

                Pereira, M.G., Lee, M., Bramel-Cox, P., Woodman, W., Doebley, J. and Whitkus, R. 1994. Sorgumda RFLP xəritəsinin qurulması və qarğıdalıda müqayisəli xəritəçəkmə. Genom 37: 236–243.

                Pratt, L.H., Cordonnier-Pratt, M.-M., Kelmenson, P.M., Lazarova, G.I., Kubota, T. və Alba, R.M. 1997. Pomidorda fitoxrom gen ailəsi (Solanum lycopersicum L.). Bitki Hüceyrə Ətrafı. 20: 672–677.

                Qin, M., Kuhn, R. və Quail, P.H. 1997. Həddindən artıq ifadə edilmiş fitoxrom C, fitoxrom B ilə oxşar fotosensor spesifikliyə malikdir, lakin ilkin yarpaq genişlənməsini gücləndirmək üçün fərqli qabiliyyətə malikdir. Bitki J. 12: 1163–1172.

                Bıldırcın, P.H. 1994a. Bitkilərdə fotosensor qavrayış və siqnal ötürülməsi. Curr. Rəy. Genet. Dev. 4: 652–661.

                Bıldırcın, P.H. 1994b. Fitoxrom genləri və onların ifadəsi. In: R.E. Kendrick və G.H.M. Kronenberg (Red.) Bitkilərdə Fotomorfogenez, 2-ci nəşr, Kluwer Academic Publishers, Dordrecht, Hollandiya, səh. 71-104.

                Bıldırcın, P.H. 1997a. Fitoxromların yeni yaranan molekulyar xəritəsi. Bitki Hüceyrə Ətrafı. 20: 657–665.

                Bıldırcın, P.H. 1997b. Fitoxromlar: saytda siqnalın biokimyəvi mexanizmi? BioEssay 19: 571–579.

                Quail, P.H., Boylan, M.T., Parks, B.M., Short, T.W., Xu, Y. and Wagner, D. 1995. Fitoxromlar: fotosensor qəbulu və siqnal ötürülməsi. Elm 268: 675–680.

                Reed, J.W., Nagpal, P., Poole, D.S., Furuya, M. and Chory, J. 1993. Qırmızı/uzaq-qırmızı işıq reseptoru fitoxrom B genindəki mutasiyalar hüceyrə uzanmasını və fizioloji reaksiyaları dəyişdirir. Ərəbidopsis inkişaf. Bitki Hüceyrəsi 5: 147–157.

                Sato, N. 1988. Nukleotid ardıcıllığı və fitoxrom geninin ifadəsi Pisum sativum: çoxsaylı transkriptlərin işığı ilə diferensial tənzimləmə. Bitki Mol. Biol. 11: 697–710.

                Schneider-Poetsch, H.A.W., Kolukisaoglu, Ñ., Clapham, D.H., Hughes, J. and Lamparter, T. 1998. Qeyri-angiosperm fitoxromları və damar bitkilərinin təkamülü. Fiziol. bitki. 102: 612–622.

                Schwer, B., Mao, X. and Shuman, S. 1998. Maya mRNA qapaq fermentinin şərti mutantlarında sürətlənmiş mRNT çürüməsi. Nucl. Acids Res. 26: 2050–2057.

                Senior, M.L., Chin, E.C.L., Lee, M., Smith, J.S.C. və Stuber, C.W. 1996. GenBank verilənlər bazasında tapılan qarğıdalı ardıcıllığından hazırlanmış sadə ardıcıllığın təkrar markerləri: xəritənin qurulması. Bitki Sci. 36: 1676–1683.

                Sharrock, R.A. və Quail, P.H. 1989. Yeni fitoxrom ardıcıllığı Arabidopsis thaliana: bitki tənzimləyici fotoreseptor ailəsinin quruluşu, təkamülü və diferensial ifadəsi. Genes Dev. 3: 1745–1757.

                Shen, B., Carneiro, N., Torres-Jerez, I., Stevenson, B., McCreery, T., Helentjaris, T., Baysdorfer, C., Almira, E., Ferl, RJ, Habben, J. və Larkins, BA 1994. İki qarğıdalı cDNA kitabxanasından klonların qismən ardıcıllığı və xəritələşdirilməsi. Bitki Mol. Biol. 26: 1085–1101.

                Şima, D.T., Kuroki, M., Deutsch, U., Ng, Y.-S., Adamis, A.P. və D'Amore, P.A. 1996. Damar endotelinin böyümə faktoru üçün siçan geni. J. Biol. Kimya. 271: 3877–3883.

                Singh, K., Ishii, T., Parco, A., Huang, N., Brara, D.S. and Khush, G.S. 1996. Düyünün molekulyar əlaqə xəritəsinin sentromer xəritəsi və oriyentasiyası (Oryza sativa L.). Proc. Natl. akad. Sci. ABŞ 93: 6163–6168.

                Somers, D.E. və Quail, P.H. 1995. Zaman və məkan ifadə nümunələri PHYAPHYB içərisində genlər Ərəbidopsis. Bitki J. 7: 413–427.

                Tahir, M., Kanegae, H. və Takano, M. 1998. PHYC Pirinçdə (Fitokrom C) geni: tam kodlaşdırma ardıcıllığının təcrid edilməsi və xarakteristikası. Bitki fiziol. 118: 1535.

                Wada, M., Kanegae, T., Nozue, K. and Fukuda, S. 1997. Kriptoqram fitoxromları. Bitki Hüceyrə Ətrafı. 20: 685–690.


                Gen və əlaqəli transkript ardıcıllıqlarında sadə ardıcıllığın təkrarlarının mövqeləri niyə fərqlidir? - Biologiya

                Mutasiya prosesi: Mikrosatellitlər faydalı genetik markerlərdir, çünki onlar yüksək polimorfikliyə meyllidirlər. 20 və ya daha çox allel və heterozigotlu insan mikropeyklərinin olması qeyri-adi deyil (Hexp = gen müxtəlifliyi, D) > 0,85. Niyə onlar bu qədər dəyişkəndirlər? Səbəb, görünür, onların mutasiyalarının "klassik" nöqtə mutasiyalarından (burada bir nukleotidin digəri ilə əvəzlənməsi baş verir, məsələn, G-nin C-ni əvəz etməsi) çox fərqli şəkildə baş verir. Mikropeyklərdəki mutasiya prosesi sürüşmə replikasiyası kimi tanınan şey vasitəsilə baş verir. Təkrar vahidləri (məsələn, AC dinukleotid təkrarı) zəncirdəki muncuqlar kimi təsəvvür etsək, təxmin edə bilərik ki, replikasiya zamanı iki tel nisbi mövqeləri bir qədər sürüşə bilər, lakin yenə də fermuarı muncuqlardan aşağı salmağı bacarır. Bir və ya digər zəncir daha sonra nukleotidlərin əlavə edilməsi və ya kəsilməsi ilə uzadıla və ya qısaldıldı. Nəticə, orijinaldan bir muncuq daha uzun və ya qısa olan təkrar vahiddən ibarət yeni bir "mutasiya" olacaq. Bir təkrar əlavə etmək və ya çıxmaq iki və ya daha çox muncuq əlavə etməkdən və ya çıxmaqdan daha asan olması fikri istifadə etmək üçün əsasdır. Addım-addım mutasiya modeli (SMM) ilə müqayisədə Sonsuz allel modeli (MƏN). SMM-nin üstünlüyü (ən azı nəzəri cəhətdən) ondan ibarətdir ki, ölçü fərqi sonra allellərin filogeniyası haqqında əlavə məlumat verir. IAM altında yalnız iki dövlət "eyni" və "fərqli"dir. SMM altında müxtəlif oxşarlıqların (eyni ölçüdə, ölçüdə oxşar, ölçüdə çox fərqli) potensial davamlılığı var. Bununla belə, SMM tutmursa, onda biz ondan istifadə etməkdən daha pis ola bilərik -- bu, əslində çox yanıltıcı ola bilər. Əsas mutasiya prosesi böyük ölçüdə mərhələli olsa belə, sürüşmənin allel ölçülərinin paylanmasına SMM-i demək olar ki, tamamilə etibarsız edəcək şəkildə necə təsir edə biləcəyini görmək çətin deyil (Mühazirə 6-da Şəkil 6.1 və 6.2-ni araşdıraraq bunu vizuallaşdırın).

                  Lokus spesifik (mini peyklər və ya RAPD kimi çox yerli markerlərdən fərqli olaraq)
                  Kodominant (heterozigotları homozigotlardan ayırmaq olar, RAPD və AFLP-lərdən fərqli olaraq "binar, 0/1")
                  PCR əsaslı (yüksək dərəcədə deqradasiyaya uğramış və ya "qədim" DNT üzərində işləmək üçün bizə çox az miqdarda toxuma lazımdır.)
                  Yüksək polimorf ("hiperdəyişən") -- əhəmiyyətli nümunə təmin edir
                  Faydalı a tərəzi diapazonu fərdi ID-dən incə miqyaslı filogeniyalara qədər

                1) Çıxarış Dokudan DNT (toxuma növündən asılı olaraq mümkün üsulların geniş çeşidi)

                2) Fraqment genom. Bizim genomik DNT-ni uyğun ölçüdə parçalara kəsin məhdudlaşdırıcı fermentlər. Ümumiyyətlə, 300-600 bp aralığında orta fraqment ölçüləri yaradan məhdudlaşdırıcı fermentlər arzu olunan məqsəddir.

                3) Daxil et. Parçaları içəri daxil edin plazmidlər. Bu addım fraqmentlərin klonlaşdırılmasına imkan verir -- plazmidlərə daxil etdiyimiz 300-600 bp parçaların bir çox nüsxəsini istehsal edir. Plazmidlərin necə hərəkət etdiyi haqqında bir az daha ətraflı fikir əldə etmək üçün vektorların klonlanması, terminlər lüğəti səhifəsində qalın şriftlə yazılmış terminlərə baxın. PUC19 bu cür analiz üçün çox istifadə olunan plazmiddir. Niyə PUC19? The məhdudiyyət saytları in PUC19 məlumdur (bağlanmış DNT fraqmentləri sonradan kəsilə bilsin) və o yaxşı təkrarlayır bakterial mədəniyyətdə.

                4) Boşqab neylon membran üzərində plazmidlər.

                5) Prob arzu olunan təkrarların etiketli oliqonukleotidləri olan membran (məsələn, AC10).

                6) Mədəniyyət müsbət klonlar (oliqo zondları ilə bağlanmış plazmid fraqmentləri).

                7) kəsmək məhdudlaşdırıcı fermentləri olan plazmidləri daxil edin və onları agaroz geldə bitirin.

                  a) üçün yoxlayın təkrarın olması və
                  b) bizə imkan verir ölçüsünü təxmin edin daxildən.
                  a) iki primerin "uyğunluğu" (onlar bir-birini tamamlaya bilməz, çünki bu, çarpaz bağlanmaya səbəb ola bilər, onların uzunluqları və ərimə temperaturları çox oxşar olmalıdır),
                  b) PCR uğursuzluqlarına səbəb ola biləcək dayanma kodlarından və ya digər ardıcıllıqlardan qaçınmaq,
                  c) yaxşı bağlanmayan primer başlanğıc yerlərindən qaçınmaq, palindromlardan (hər iki ucundan eyni ardıcıllığa malik olan ardıcıllıqlar) və bir sıra digərlərindən qaçınmaq.
                  d) ümumi gücləndirilmiş məhsul uzunluğu 100-250 bp-dir ki, onlar vizuallaşdırma üçün istifadə edəcəyimiz sekvensləşdirmə gelləri və ya avtomatlaşdırılmış genotiplər üçün mümkün olsun.
                  e) ardıcıl regionun sonuna yaxın təkrarlardan qaçınmaq. Ardıcıllaşdırdığımız müsbət klonlardan bəziləri yaxşı təkrar vahidlərinə malik ola bilər, lakin ardıcıllığın sonuna çox yaxın ola bilər. Daha sonra bir primer dizayn etmək üçün kifayət qədər cinah bölgəmiz yoxdur. Qismən buna görə də biz 300-600 bp-lik fraqmentləri istəyirik -- ardıcıllıq üçün mümkün olmaq üçün kifayət qədər qısa, lakin təkrarın "uçurumda asma" olma ehtimalını azaltmaq üçün kifayət qədər uzun.

                11) Sifariş verin lokalizasiyaya xas primerlər (ümumiyyətlə bunlar təkrar bölməyə dərhal bitişik olmayan cinah bölgələrinin 20-30 bp hissələri olacaq).

                Budur, təkrar vahidi və irəli və tərs primer yerlərini ehtiva edən skrab-jaylar üçün mikrosatellit ardıcıllığına bir nümunə.
                SJR3 [FSJ]
                GCCAAGCTTGCATGCCTGCAGGTCGACTCT AGAGGATCCCCAAGGTGTATGT GCATACACGTG
                CACACACACACACACACACA GAGGGTGTGCACATGTGCATGCACACTCCAAGAGACAGTG
                CCTAGTAAAGTGTCTC AGCACCATCTGCAGCAAACAG GTTCTGCAAAAAACCAATCCCAACTGA
                TGTTCCCACAGTGACACTGT

                İrəli astarın əvvəlindən tərs astarın sonuna qədər yuxarıda göstərilən 131 bp Təkrar CA-dır11
                The təkrar vahidi qırmızı rənglə vurğulanır , isə irəlitərs p r i m e r s -də vurğulanır maviyaşıl . Biz primer ardıcıllığı üçün sifariş göndərərdik (bizim vəziyyətimizdə əlavə olaraq 19 bp əlavə edirik MPZR-də gücləndirilmiş məhsulumuza floresan nukleotidləri/dNTP-ləri əlavə etməyə imkan verən 13 quyruq). Sequencer/avtomatlaşdırılmış genotipimizdəki lazer daha sonra flüoresansı aşkar edir, bu da biz vizuallaşdırmaq toplamaq və təhlil etmək ümid etdiyimiz allelik məlumatları təşkil edən lentlər.

                1) DNT-ni çıxarın. Biri tez-tez toxumanın bir şəkildə parçalanması ilə başlayır (məsələn, maye azotda üyüdülməklə). Ekstraksiya prosesi üçün alternativlərə klassik fenol-xloroform ekstraksiyaları, duz əsaslı ekstraksiyalar və müxtəlif kommersiya dəstləri daxildir. Bu addımda zülallardan və digər qeyri-DNT toxuma komponentlərindən xilas oluruq. Tipik analizə 30 nəfərdən ibarət yerli populyasiyada olan fərdlərin hər birindən DNT çıxarılması daxil ola bilər.

                2) Gücləndirin. Çıxarılan 30 DNT nümunəmizin hər birindən çox az miqdarda bir termosikldə gücləndirmək üçün PCR kokteylinə əlavə edirik. Bu, molekulyar biologiyada inqilab edən "sehrli" bir addımdır. Demək olar ki, heç bir DNT ilə başlayaq və onu bir geldə görə biləcəyimiz kifayət qədər əldə edirik! Müxtəlif "kokteyl" reseptləri mövcuddur - onlar adətən termofilik bakterial fermenti ehtiva edirlər Taq polimeraza (əsas), dNTP qarışığı (hədəf DNT-nin kütləvi surətdə təkrarlanmasına imkan verəcək nukleotidlər), maqnezium xlorid və flüoresan etiketli dNTP-lər (bunlar xüsusi olaraq əlavə edilmiş M13 və ya T3 quyruğuna bağlanacaq və lazerin altında işıqlanacaq və lentlər yaradacaq. DNT allelləri geldə görünür).

                3) yük. Biz 30 gücləndirilmiş məhsulumuzu böyük şaquli poliakrilamid geldə ayrı-ayrı zolaqlara yükləyirik. Biz də bir neçə zolağı DNT ilə yükləyirik nərdivan -- məlum kəmiyyət/konsentrasiyada gücləndirilmiş DNT-nin məlum ölçülü fraqmentləri. Ümumi bir nərdivan, bir sıra fraqmentlər əldə etmək üçün məhdudlaşdırıcı fermentlərlə kəsilmiş lambda fagıdır. Daha yeni kapilyar sequencerlər geldən istifadə etmir.

                4) Sıralayıcını işə salın. Gücləndirilmiş məhsulu bütün allellər flüoresan nukleotidləri işıqlandıran və gel üzərində işıqlandıran (və ya rəqəmsal-birbaşa kompüterə keçir) lazerlə işləməyə vaxt tapana qədər gücləndirilmiş məhsulu sequencerdən keçiririk. Sekvenser həm analoq təsviri (köhnə, gel əsaslı sekvenserlər üçün), həm də fraqmentlərin ölçüsü ilə bağlı rəqəmsal olaraq saxlanılan məlumatları yaradır.

                5) Optimallaşdırın (2-4-cü addımlardakı dəyişikliklər). Primer, DNT, termosikl və sekvenserin müəyyən bir kombinasiyası üçün düzgün PCR şərtlərini əldə etmək çox vaxt çox vaxt tələb edir. Optimallaşdırmada əsas dəyişənlərə aşağıdakılar daxildir:
                temperatur (primer ardıcıllığının proqnozlaşdırılan ərimə temperaturu olacaq, lakin əslində işləyən daha yüksək və ya aşağı ola bilər),
                denaturasiya, tavlama və addımların uzadılması üçün PCR tərəfindən proqramlaşdırılmış vaxtlar
                maqnezium xlorid konsentrasiyası

                Vizuallaşdırmanın alternativ üsullarına gümüşlə boyanma, CyberGreen boyama, etidium bromid boyama və ya radioaktiv etiketləmə ilə "əllə qurulmuş" poliakrilamid sekvensiya gelləri daxildir. Bunların bir çoxu zərərli kimyəvi maddələrdən ibarətdir (EtBr) və ya radioaktivlik, buna görə də biz nisbətən təmiz, təhlükəsiz prosedurdan istifadə etdiyimiz üçün özümüzü xoşbəxt hiss edirik.

                Şəkil 8.1. Mikropeyklər üçün elektroforetik gelin stilizə edilmiş diaqramı. Bir cərəyan gücləndirilmiş DNT-ni aşağı çəkir
                poliakrilamid geldə "zolaqlar". Daha sonra fraqmentlər ölçüyə (bp = əsas cütlər) və fərdlərə görə ayrıla bilər
                allel tərkibinə görə genotipləşdirilə bilər (bir və ya bir neçə allel üçün homozigot və ya heterozigot). Budur
                sol zolaqda məlum ölçülü fraqmentlərdən ibarət "nərdivan" var, ikinci zolaqda bir fərdin DNT-si var.
                (genotip e.ə) və üçüncü zolaqda ikinci bir fərddən (genotip reklam). Çoxlu lokusun işlədilməsi
                fərdlər, populyasiyalar və ya növlər haqqında zəngin genetik məlumat verir.

                E. Biz allelik məlumatları necə təhlil edirik? Bir az daha ətraflı təsvir üçün Genetik analiz səhifəsinə keçin.
                Siz həmçinin Web Genetic proqramında Word sənədimi yükləyə bilərsiniz. Luikart və İngiltərə (1999) yanaşmaların (köhnə) icmalını təqdim edir. Alternativ markerlərdən istifadə üçün Sunnucks (2000), Mueller and Wolfenbarger (1999 AFLP), Campbell et al. (2003 AFLP) və Brumfield et al. (2003 SNPs - tək nukleotid polimorfizmləri).

                  1) Ənənəvi populyasiya genetikası vasitələri
                    Heterozigotluq (Hobs, Hexp = D)
                    Hardy-Weinberg tarazlığı
                    Bağlantı tarazlığının pozulması
                    FST və digər F-statistika
                    Genetik məsafələr (Kavalli-Sforza akkordu, Neisin 1972 və 1978 məsafələri)
                    Təxminlər 4Ne m və 4Nem. (mutasiya üçün m, m miqrasiya üçün)

                  2) Mikrosatellitə xüsusi tədbirlər (əsasən SMM, Addım-addım Mutasiya Modellərinə əsaslanır)

                  (delta mu kvadrat) Goldstein et al. 1995
                  DSW Shriver və s. (1995)
                  RST Slatkin (1995) tərəfindən həyata keçirildiyi kimi Qudman (1997)
                  Michalakis və Excoffier (1996)


                  Bioinformatika lüğəti - S

                  Peyk DNT/sadə ardıcıllıq DNT
                  Çox təkrarlanan DNT ardıcıllığı ümumiyyətlə haploid genomda milyon dəfəyə qədər təkrarlanan qısa ardıcıllığa (7-20 nukleotid) əsaslanır. Adətən heteroxromatik bölgələrdə olur, tez-tez sentromere ilə əlaqələndirilir.

                  Hiss xətti
                  Bir gendə, RNT molekulunda olan ardıcıllığa malik olan DNT zənciridir. Kodlaşdırma, müsbət və ya şablon olmayan zəncir də adlanır.

                  Ov tüfənginin ardıcıllığı
                  Bütün genomların ardıcıllığı üçün strategiya, bu, kommersiya məqsədi daşıyan Celera şirkəti tərəfindən irəli sürülüb. Genomlar çox kiçik parçalara kəsilir, plazmidlərə klonlaşdırılır, ardıcıllaşdırılır və sonra bütün xromosomlara və ya genomlara yığılır. Bu üsul iyerarxik ov tüfəngi ardıcıllığından daha sürətlidir, lakin montaj səhvlərinə daha çox meyllidir.

                  Sadə təkrar
                  AAAAAAAAAAAA və ya CACACACACA kimi bir və ya az sayda əsasla nukleotid təkrarlanır.

                  SINE
                  Qısa interspersed nüvə elementləri tərs transkripsiya edilmiş genlərdən əldə edilən və adətən eukaryotik genomlarda rast gəlinən DNT seqmentləri sinfidir.

                  SNP
                  Tək nükleotid polimorfizmi iki ardıcıllıq arasında tək əsasda DNT ardıcıllığında fərqdir.

                  Birləşmə
                  İlkin transkriptdən yetkin, funksional RNT istehsal etmək üçün intronların çıxarılması və ekzonların birləşdirildiyi proses. Bəzi RNT-lər öz-özünə yapışır, lakin əksəriyyəti reaksiyanı kataliz etmək üçün xüsusi ribonukleoprotein kompleksinə ehtiyac duyur.

                  Birləşmə qəbuledici sahəsi
                  Bir intron və ekson arasındakı sərhəd dərhal aşağı axın (yəni intronun 3' tərəfində).

                  Donor yerinin birləşdirilməsi
                  Bir intron və ekson arasındakı sərhəd dərhal yuxarıya doğru (yəni intronun 5' tərəfində).

                  Splicing transesterifikasiya mexanizmi
                  Aşağı axın ekzonunun 5' ucunda yerləşən birinci nukleotidin 5' fosfatı ilə yuxarı axın ekzonunun sonuncu nukleotidinin 3' hidroksil qrupu ilə fosfodiester bağı əmələ gətirən kimyəvi reaksiya.

                  Kodon başlayın
                  Kodlaşdırma ardıcıllığının ilk kodonu. Eukariotlarda bu, demək olar ki, həmişə metionini kodlayan ATG-dir.

                  Sayta başlayın
                  Transkripsiyanın başlandığı nukleotid adətən transkripsiya edilən genə münasibətdə +1 mövqe kimi qeyd olunur.

                  Kodon dayandırın
                  Peptid sintezinin dayandırılmasını təyin edən kodon bəzən "cəfəngiyyat kodonları" adlanır, çünki onlar heç bir amin turşusu təyin etmirlər.


                  STRs
                  Qısa tandem təkrarlanır. Genomların bir çox yerində qısa ardıcıllıqlar var (


                  Videoya baxın: Məntiq testləri. Qanunauyğunluqlar #31. Asan İzah (Iyul 2022).


Şərhlər:

  1. Hadwin

    Qoşuluram. Mən də buna qaçdım. Bu mövzuda ünsiyyət qura bilərik.

  2. Tauzahn

    Bravo, what words..., a magnificent idea

  3. Lele

    Təbrik edirəm, sadəcə olaraq möhtəşəm fikirdir

  4. Nefen

    On mine it is very interesting theme. I suggest all to take part in discussion more actively.



Mesaj yazmaq