Məlumat

5.2: Genom Assambleyası I- Üst-üstə düşmə-Layout-Konsensus yanaşması - Biologiya

5.2: Genom Assambleyası I- Üst-üstə düşmə-Layout-Konsensus yanaşması - Biologiya


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Hesablama biologiyasında bir çox tədqiqat sahələri tam genom ardıcıllığı məlumatlarının mövcudluğuna əsaslanır. Birincisi, biz üst-üstə düşmə-layout-konsensus yanaşması üçün eksperimental quraşdırmanın aspektlərini araşdıracağıq, sonra oxunuşları necə birləşdirməyi və onlardan məlumat öyrənməyi öyrənməyə davam edəcəyik.

Eksperimentin qurulması

Bu təcrübəni qurarkən həll edilməli olan ilk problem odur ki, bu yanaşmadan istifadə etmək üçün hər bir xromosomun çoxlu nüsxəsindən başlamalıyıq. Bu rəqəm 10-a bərabərdir5. Qeyd etmək vacibdir ki, bu nüsxələri əldə etməyimiz çox vacibdir və sonradan nəticələrimizə təsir edəcək, çünki apardığımız müqayisələrin çoxu ardıcıl məlumatlardan asılı olacaq. Bu qədər məlumat əldə etmək üçün düşünə biləcəyimiz ilk yol müəyyən bir genomu gücləndirməkdir. Bununla belə, gücləndirmə sonrakı addımlarda alqoritmlərimizi pozacaq və daha pis nəticələrə səbəb olacaq zərər verir. Başqa bir mümkün üsul, hər bir xromosomun bir çox nüsxəsini əldə etmək üçün genomu inbreed etmək olardı. Əgər polimorfizmdən qurtulmaq istəyirsinizsə, bu yaxşı bir texnika ola bilər, lakin biz inbreed zamanı polimorf saytlardan qiymətli məlumatları da itiririk. Bu məlumatı əldə etmək üçün təklif olunan üsul, orqanizmin kifayət qədər böyük olmasına baxmayaraq, bir fərdin istifadə edilməsidir. Hər bir xromosomun mümkün qədər az versiyasını əldə etmək üçün bir nəsli və ya iki nəsli kimi üsullardan da istifadə edə bilərik. Bu, hər bir xromosomda yüksək ardıcıllıq dərinliyi əldə edəcək, buna görə də bütün xromosomların mümkün qədər oxşar olmasını istəyirik.

Sonra, indiki texnologiyanı nəzərə alaraq oxuma uzunluqlarımıza necə qərar verə biləcəyimizə baxaq. (Şəkil 5.2) baxsaq, görə bilərik ki, verilmiş layihədə hansı platformadan istifadə olunacağına qərar vermək üçün xərc-fayda təhlili aparılmalıdır. Mövcud texnologiya ilə biz tez-tez oxunuş uzunluğu təxminən 250 olan HiSeq2500-dən istifadə edirik, baxmayaraq ki, bu sürətlə dəyişir.

Nəhayət, qısa oxunan platformalardan istifadə edərkən problem yaradan bir neçə ardıcıllığa baxaq. Yüksək GC məzmunu (məsələn, GGCGGCGATC), aşağı GC məzmunu (məsələn, AAATAATCAA) və ya aşağı mürəkkəblik (məsələn, ATATATATA) olan ardıcıllıqlar qısa oxunuşda problem yarada bilər. Bu, hələ də fəal tədqiqat sahəsidir, lakin bəzi mümkün izahatlar arasında Polimeraz sürüşməsi və DNT-nin çox asanlıqla və ya kifayət qədər asanlıqla denaturasiyası daxildir.

Bu bölmədə ov tüfənginin ardıcıllığı adlanan DNT oxunuşları dəstindən hesablama üsulu ilə genomun yığılması üçün ən uğurlu erkən üsullardan biri araşdırılacaq (Şəkil 5.3). Ov tüfənginin ardıcıllığı eyni genomun çoxsaylı nüsxələrinin təsadüfi olaraq bir çox kiçik fraqmentlərə kəsilməsini nəzərdə tutur, sanki DNT ov tüfəngi ilə vurulmuş kimi. Tipik olaraq, DNT ya sonikasiya (ultrasəsdən qısa partlamalar) və ya genomu xüsusi ardıcıllıq motivlərində parçalamaq üçün nəzərdə tutulmuş hədəflənmiş fermentdən istifadə edərək əslində parçalanır. Bu üsulların hər ikisi müxtəlif ölçülü fraqmentlər yaratmaq üçün tənzimlənə bilər.

DNT gücləndirildikdən və parçalandıqdan sonra 1977-ci ildə Frederik Sanger tərəfindən hazırlanmış zəncirvari sonlanma ardıcıllığı (həmçinin Sanger ardıcıllığı adlanır) adlı texnika fraqmentləri ardıcıllıqla sıralamaq üçün istifadə olunur. Qısacası, fraqmentlər dideoksinukleotrifosfat daxil olana qədər DNT polimeraza tərəfindən uzadılır; bu xüsusi nukleotidlər fraqmentin uzanmasının dayandırılmasına səbəb olur. Buna görə də fraqmentin uzunluğu verilmiş ddNTP-nin ardıcıllıqla əlavə olunduğu yer üçün proxy olur. Hər biri fərqli ddNTP (A, G, C, T) olan dörd ayrı reaksiya həyata keçirə bilər və sonra əsasların nisbi sırasını müəyyən etmək üçün nəticələri bir gel üzərində bitirə bilərsiniz. Nəticə, hər bir bazanın düzgün adlandırılması ehtimalını göstərən, hər bir baza keyfiyyətinə uyğun olan bir çox baza ardıcıllığıdır. Daha qısa fraqmentlər tam ardıcıllıqla sıralana bilər, lakin keyfiyyət əhəmiyyətli dərəcədə azaldığından daha uzun fraqmentlər yalnız hər bir ucunda ardıcıllıqla sıralana bilər.

təxminən 500-900 baza cütündən sonra. Bu cütləşmiş oxunuşlara mate pairs deyilir. Bu bölmənin qalan hissəsində, bütün xromosomların ölçüsünə qədər daha uzun ardıcıllıqların qurulması üçün oxunuşlardan necə istifadə ediləcəyini müzakirə edirik.

Üst-üstə düşən oxunuşların tapılması

DNT fraqmentlərini daha böyük seqmentlərə birləşdirmək üçün iki və ya daha çox oxunmanın üst-üstə düşdüyü, yəni bir fraqmentin başlanğıc ardıcıllığının digər fraqmentin son ardıcıllığına uyğun gəldiyi yerləri tapmalıyıq. Məsələn, ACGTTGACCGCATTCGCCATA və GACCGCATTCGCCATACG- GCATT kimi iki fraqmenti nəzərə alsaq, üst-üstə düşmə əsasında daha böyük ardıcıllıq qura bilərik: ACGTTGACCGCATTCGCCATACGGCATT (Şəkil 5.4).

Uyğun ardıcıllıqların tapılması üsullarından biri 2-ci fəsildə müzakirə edilən Needleman-Wunsch dinamik proqramlaşdırma alqoritmidir. Needleman-Wunsch metodu genom montajı üçün praktiki deyil, çünki biz milyonlarla cüt-cüt düzülmələri yerinə yetirməli olacağıq, hər biri O (n2) DNT fraqmentlərindən bütöv bir genom yaratmaq üçün.

Daha yaxşı yanaşma BLAST alqoritmindən istifadə etməkdir (3-cü fəsildə müzakirə olunur) oxunuşlardakı bütün k-merləri (k uzunluğunun unikal ardıcıllığı) hash etmək və iki və ya daha çox oxunuşda k-merlərdən birinin olduğu bütün yerləri tapmaqdır. ümumi. Bu, bizə O(kn) O (n2) ikili müqayisələr. k oxunanların ölçüsündən kiçik istənilən ədəd ola bilər, lakin istənilən həssaslıq və spesifiklikdən asılı olaraq dəyişir. Genomun təkrarlanan bölgələrini əhatə etmək üçün oxunma uzunluğunu tənzimləməklə biz bu bölgələri düzgün həll edə və tam, davamlı genom idealına çox yaxınlaşa bilərik. Arachne adlı məşhur üst-üstə düşmə-layout-consensus assembler k = 24 [2] istifadə edir.

Uyğun k-merləri nəzərə alaraq, biz müvafiq oxunuşların hər birini uyğunlaşdıra və 97%-dən az oxşar olan uyğunluğu ləğv edə bilərik. Biz oxunuşların eyni olmasını tələb etmirik, çünki biz ardıcıllıqla səhvlər və heterozigotluq imkanlarına imkan veririk (yəni, insan kimi diploid orqanizmin polimorf yerdə iki fərqli variantı ola bilər).

Oxunmaların kontiglərə birləşməsi

DNT fraqmentləri arasında üst-üstə düşmələri tapmaq üçün yuxarıda təsvir edilən üsullardan istifadə edərək, davamlı ardıcıllığın daha böyük seqmentlərini birləşdirə bilərik. contigs. Bu prosesi vizuallaşdırmağın bir yolu, bütün qovşaqların oxunmaları, kənarların isə oxunuşlar arasında üst-üstə düşmələri təmsil etdiyi bir qrafik yaratmaqdır (Şəkil 5.5). Qrafikimiz olacaq keçidli üst-üstə düşmə; yəni bəzi kənarlar artıq aralıq qovşaqlarla bağlanmış fərqli qovşaqları birləşdirəcək. Keçidlə nəticələnə bilməyən üst-üstə düşmələri aradan qaldırmaqla, daha böyük bir kontig yaratmaq üçün əmr edilmiş oxunuşlar zənciri yarada bilərik. Bu qrafik çevrilmələri aşağıda 5.3.1-ci bölmədə daha dərindən müzakirə olunur. Contigs ölçüsünü daha yaxşı başa düşmək üçün biz kimi tanınan bir şeyi hesablayırıq N50. Çünki kontig uzunluq ölçüləri ən kiçik kontigiyanın kəsilməsinə çox həssas olur, N50 uzunluqla çəkilmiş median kimi hesablanır. Bir insan üçün N50 adətən 125 kb-a yaxındır.

Nəzəri olaraq, verilən bölgəni adekvat əhatə etdiyimiz müddətdə oxuduğumuzdan böyük kontiglər yaratmaq üçün yuxarıdakı yanaşmadan istifadə edə bilməliyik. Təcrübədə biz tez-tez genomun son dərəcə təkrarlanan və nəticədə yığılması çətin olan böyük hissələri ilə qarşılaşırıq. Məsələn, aşağıdakı iki ardıcıllığın necə uyğunlaşdırılacağı tam aydın deyil: ATATATAT və ATATATATAT. Ardıcıllıq nümunəsindəki son dərəcə aşağı məlumat məzmununa görə, onlar istənilən sayda şəkildə üst-üstə düşə bilər. Bundan əlavə, bu təkrarlanan bölgələr genomun bir çox yerində görünə bilər və hansı oxunuşların hansı yerlərdən gəldiyini müəyyən etmək çətindir. Bu qeyri-müəyyən, təkrar oxunuşlardan ibarət olan kontiglər overcollapsed contigs adlanır.

Hansı bölmələrin üst-üstə düşdüyünü müəyyən etmək üçün çox vaxt hər bir kontigi təşkil edən fraqmentlərin əhatə dairəsinin dərinliyini müəyyən etmək mümkündür. Bir kontig digərlərinə nisbətən əhəmiyyətli dərəcədə daha çox əhatə dairəsinə malikdirsə, o, həddindən artıq çökmüş bir bölgə üçün ehtimal namizəddir. Əlavə olaraq, eyni yerdə bir neçə unikal kontig bir kontigasiya ilə üst-üstə düşə bilər ki, bu da kontigiyanın həddindən artıq çökə biləcəyinin başqa bir göstəricisidir (Şəkil 5.6).

Fraqmentlər mümkün təkrarlanan hissənin nöqtəsinə qədər kontiglərə yığıldıqdan sonra nəticə qovşaqların kontiglər, kənarların isə unikal kontiglər və üst-üstə düşmüş kontiglər arasında əlaqə olduğu bir qrafikdir (Şəkil 5.7).

Contig qrafikinin iskelelərə salınması

Parçalarımız contigs və contig graphs şəklində yığıldıqdan sonra, kontigləri super kontiglərə və ya skafoldlara bağlamaq üçün daha böyük mate cütlərindən istifadə edə bilərik. Yoldaş cütləri həm kontigləri istiqamətləndirmək, həm də onları düzgün ardıcıllıqla yerləşdirmək üçün faydalıdır. Əgər cütlüklər kifayət qədər uzundursa, onlar tez-tez təkrarlanan bölgələri əhatə edə və əvvəlki bölmədə təsvir olunan qeyri-müəyyənlikləri həll etməyə kömək edə bilər (Şəkil 5.8).

Contiglərdən fərqli olaraq, supercontigs ardıcıllıqda bəzi boşluqlar ola bilər, çünki kontigləri birləşdirən cüt cütlər yalnız uclarda ardıcıllıqla sıralanır. Ümumiyyətlə, müəyyən bir cütlüyün nə qədər uzun olduğunu bildiyimiz üçün neçə əsas cütün əskik olduğunu təxmin edə bilərik, lakin ov tüfəngi ardıcıllığında kəsiklərin təsadüfi olması səbəbindən dəqiq ardıcıllığı doldurmaq üçün əlimizdə məlumat olmaya bilər. Hər bir boşluğu doldurmaq olduqca bahalı ola bilər, belə ki, hətta ən tam yığılmış genomlarda adətən bəzi boşluqlar olur.

Konsensus ardıcıllığının əldə edilməsi

Genom birləşməsinin məqsədi bir davamlı ardıcıllıq yaratmaqdır, buna görə də oxunuşlar kontiglərə uyğunlaşdırıldıqdan sonra onlar arasındakı hər hansı fərqi həll etməliyik. Yuxarıda qeyd edildiyi kimi, üst-üstə düşən oxunuşların bəziləri ardıcıllıq səhvləri və ya polimorfizm səbəbindən eyni olmaya bilər. Bir baza ona uyğunlaşdırılmış bütün digər əsaslarla razılaşmadıqda, biz tez-tez ardıcıllıq xətasının nə vaxt olduğunu müəyyən edə bilərik. Əsasların hər biri üzrə keyfiyyət xallarını nəzərə alsaq, biz adətən bu münaqişələri kifayət qədər asanlıqla həll edə bilərik. Münaqişənin həllinin bu üsulu çəkili səsvermə adlanır (Şəkil 5.9). Başqa bir alternativ, hər bir bazanın tezliklərinə məhəl qoymamaq və maksimum keyfiyyətli məktubu konsensus kimi qəbul etməkdir. Bəzən polimorf dəsti meydana gətirən bütün əsasları saxlamaq istəyəcəksiniz, çünki bu, vacib məlumat ola bilər. Bu halda, konsensus ardıcıllığı əldə etmək üçün bu üsullardan istifadə edə bilməyəcəyik.

Bəzi hallarda, məsələn, genom heterozigotdursa və bir yerdə bərabər sayda iki fərqli baza varsa, konsensus əldə etmək mümkün deyil. Bu halda montajçı öz nümayəndəsini seçməlidir.

Bilirdinizmi?

Polimorfizm diploid genomların yığılmasını əhəmiyyətli dərəcədə çətinləşdirə bildiyinə görə, bəzi tədqiqatçılar genomu ardıcıllaşdırmağa cəhd etməzdən əvvəl heterozigotluğun miqdarını azaltmaq üçün seçilmiş növlərdə bir neçə nəsil qohumluq yaradırlar.

Bu bölmədə oxunan oxunan genom montajını etmək üçün bir alqoritm gördük. Bununla belə, bu alqoritm oxunuşların uzunluğu 500 - 900 baza və ya daha çox olduqda yaxşı işləyir ki, bu da Sanger ardıcıllığına xasdır. Alternativ genom yığım alqoritmləri tələb olunur, çünki ardıcıllaşdırma üsullarımızdan əldə etdiyimiz oxunuşlar daha qısadır.


GUNC: prokaryotik genomlarda kimerizm və çirklənmənin aşkarlanması

Genomlar mikrobiologiyada kritik vahidlərdir, lakin prokaryotik genom birləşmələrində keyfiyyətin müəyyən edilməsi çətin bir problem olaraq qalır. Biz GUNC (Genom UNClutterer) təqdim edirik, bir genomun tam gen tamamlayıcısından istifadə edərək, ayrı-ayrı kontiglərin nəsil homojenliyinə əsaslanaraq genom kimerizmini dəqiq aşkarlayan və kəmiyyətini müəyyən edən alətdir. GUNC əvvəllər az aşkar edilmiş çirklənmə növlərini hədəf alaraq mövcud yanaşmaları tamamlayır: biz mühafizəkar olaraq hesab edirik ki, GenBank-da genomların 5,7%-i, RefSeq-də 5,2%-i və son tədqiqatlarda əvvəlcədən süzülmüş “yüksək keyfiyyətli” metagenomda yığılmış genomların 15-30%-i aşkar edilməmiş kimeralar. GUNC prokaryotik genomun keyfiyyətini əhəmiyyətli dərəcədə yaxşılaşdırmaq üçün sürətli və möhkəm bir vasitə təqdim edir.


Allopoliploid genomlarda homeoloji xromosomlar nə qədər oxşardır?

Yuxarıda təsvir edilən problemlər işığında, bütün genom ov tüfəngi yanaşmasının allopoliploid genomlarının yığılması üçün uyğun olmadığı görünür. Ənənəvi olaraq, bitki bitkilərinin allopoliploid genomlarının ardıcıllığına yanaşma pambıq, çiyələk, qəhvə və yağlı bitkilərin rapsında olduğu kimi, diploid genomların ardıncalanması olmuşdur. Bununla belə, 17 giqabaza (Gb) buğda genomunun progenitor genomları yuxarıda qeyd olunan allopoliploid genomların hər hansı birindən daha böyükdür və üç 5,5 Gb progenitor genomdan hər hansı birinin ardıcıllaşdırılması əhəmiyyətli investisiya tələb edir [5]. Buğda genomu 21 böyük və fərqlənə bilən xromosomdan ibarətdir və buğda icması ardıcıllıq və yığılma üçün hər bir xromosomu və ya xromosom qolunu çeşidləmək yanaşmasını tətbiq etdi [6]. Bu yanaşmadan istifadə etməklə homeoloji xromosomların yanlış yığılmasını aradan qaldırmaq mümkündür. Bununla belə, xromosomların çeşidlənməsi Illumina texnologiyasından istifadə edərək yüksək məhsuldarlıq ardıcıllığı üçün kifayət qədər DNT əldə etmir. Buna görə də hər bir xromosomu və ya qolu qısa fraqmentlərlə gücləndirmək lazımdır ki, bu da yığılmış genomda qısa kontiglərlə nəticələnən iskele üçün böyük daxillikli tullanan kitabxanaların qurulmasını qeyri-mümkün edir [6]. Bu, sonrakı genomik tədqiqatları daha az səmərəli edir.

Bu çağırışlar onun əhəmiyyətini nümayiş etdirir Genom Biologiyası Chapman və həmkarları tərəfindən bir allopoliploid genomu yığmaq üçün bütün genom ov tüfəngi ardıcıllığı və ultra yüksək sıxlıqlı əlaqə xəritəsini birləşdirən tədqiqat. “Sintetik W7984” tetraploid buğdanın AABB genomunun diploid DD genomu ilə kəsişməsi, ardınca xromosomun ikiqat artması, nəticədə heksaploid buğdanın müasir bərpası ilə yaradılıb. Bu homozigot xətt, ölçüsü 250 bp ilə 4,5 kb arasında olan qoşalaşmış uc və mate cütlərində 2 × 150 əsas cüt (bp) Illumina TruSeq kitabxanaları ilə bütöv genom ov tüfəngi yanaşmasından istifadə edərək 30 × əhatə dairəsində ardıcıllaşdırıldı [4]. 'W7984' genomu Meraculous-un təkmilləşdirilmiş versiyasından istifadə etməklə yığılıb. de novo dərin qoşalaşmış qısa oxu ilə genom montajı [7]. 51-mersin təhlili ikiqat və ya üçlü nüsxədə heç bir genomik xüsusiyyətlərin olmadığını aşkar etdi, bu da üç dəst homeoloji xromosomun genom birləşməsində ayrıldığını göstərir. 81-mer ardıcıllığının simulyasiyası 51-merinkindən daha çox genomda unikal ardıcıllıqların əhəmiyyətli dərəcədə yüksək fraksiyalarını əldə etdi, bu da ardıcıllığın dərinliyinin artırılmasının yığılmış genomun keyfiyyətini daha da yaxşılaşdırdığını göstərir. Eyni ekzonlar, allopoliploid genomların əsas xüsusiyyəti olan daha fərqli qanadlı intronik və intergenik ardıcıllıqlardan alınan məlumatlardan istifadə edərək düzgün subgenomlara yığılmışdır.

Allopoliploid genomlarındakı homeoloji xromosomların DNT ardıcıllığının şəxsiyyət səviyyəsi bir sirr idi, lakin heksaploid buğda və tetraploid yağlı toxumun qaralama genomları indi nəşr edilmişdir [6,8]. Homeoloji ardıcıllıqların birbaşa müqayisəsi əvvəllər nəzərdə tutulduğundan əhəmiyyətli dərəcədə yüksək ardıcıllıq fərqini aşkar etdi. Çörək buğdasında Triticum aestivum, 3A, 3B və 3D xromosomlarında müqayisə edilən bölgədə müvafiq olaraq 21,784 bp, 28,429 bp və 25,193 bp kollinear ardıcıllıq var idi. A və B, A və D və B və D altgenomları arasında cütlük müqayisəsi müvafiq olaraq 23,3%, 13,5% və 12,8% əlavə-silmə (InDel) fərqlərini, boşluqsuz müqayisədə isə 4,5%, 5,2% və 6,1% SNP-ləri aşkar etdi. Bu üç cüt arasında subgenomlar arasında birləşmiş DNT ardıcıllığı fərqləri 27.8%, 18.7% və 18.9% idi (Şəkil 1a). Allotetraploid yağlı rapsda Brassica napus, A subgenomunun 96,436 bp bölgəsi, C altgenomunda (104,516 bp) daha böyük bir bölgə ilə collinear idi, boşluqsuz müqayisədə 8,4% InDel fərqi və 5,7% SNP göstərdi. A və C subgenomları arasında birləşmiş DNT ardıcıllığı fərqi 14,1% təşkil etmişdir (Şəkil 1b). Beləliklə, homeoloji xromosomlar arasında DNT ardıcıllığının divergensiyasının allopoliploid genomlarında 14,1%-dən 27,8%-ə qədər idi. T. aestivumB. napusüçün kifayət qədər fərqlidir de novo allopoliploid genomların genom toplusu.

Hexaploid çörək buğdasında və allotetraploid yağlı rapada subgenomların kollinearlığı. (a) Çörək buğdasının A, B və D subgenomlarından üç homeoloji bölgə Triticum aestivum line Synthetic W7984 birbaşa ardıcıllıqla müqayisə üçün uyğunlaşdırılmışdır [4]. B altgenomunun iskele 946163 (mövqe 27,539-dan 55,967-yə qədər), D altgenomunun 1590518 (23,362-dən 48,554-ə qədər mövqeyi) və 235762 (vəzifə 75,800-dən 97,58-ə qədər) subgeno-nun skafoldu idi. Kollinear və tərs bölgələr müvafiq olaraq qırmızı və mavi xətlərlə təmsil olunur. A və D subgenomları üçün, lakin B deyil, mərkəzi bölgədə yüksək dərəcədə kollinear genom təkrarlanması müşahidə olunur. (b) İki homeoloji bölgədən Brassica napus subgenom A (mövqe 253,565-dən 350,000-ə qədər) və subgenom C (mövqe 409,878-dən 514,393-ə qədər) müqayisə üçün uyğunlaşdırılmışdır. 76 kb uyğunlaşdırılmış bölgədə 4,331 SNP (5,7%) var idi. Ümumilikdə 32,411 bp (14,1%) InDels aşkar edilib və ən uzununun uzunluğu 4,808 bp təşkil edir. Kiçik inversiya və duplikasiya hadisələri ilə iki subgenom arasında yüksək kollinearlıq müşahidə edildi.


Nəticələr

1999-cu ildə MUMmer 1.0-ın hazırlanmasından bəri geniş miqyaslı genom müqayisəsi üçün bir neçə başqa proqram hazırlanmışdır, məsələn, SSAHA [16], AVID [17], MGA [18], BLASTZ [19] və LAGAN [20] (bir baxış üçün [21] də baxın). Bu proqramların əksəriyyəti üç mərhələyə bölünə bilən lövbər əsaslı yanaşmaya əməl edir: potensial lövbərlərin hesablanması, üst-üstə düşməyən potensial lövbərlərin kolinear ardıcıllığının hesablanması – bu lövbərlər aralarındakı boşluqların düzülməsi və hizalanmasının əsasını təşkil edir. lövbərlər. Potensial lövbərləri hesablamaq üçün ənənəvi üsullar, yəni müəyyən uzunluqdakı maksimal uyğunluqlar l və ya daha uzun müddətə generasiya və sınaq yanaşmasından istifadə edin. İlk addımda, müəyyən uzunluqdakı bütün uyğunluqlar k < l, çağırdı k-mers, hashing ([22]-dən qəbul edilmişdir) əsasında metoddan istifadə etməklə yaradılır. Hər bir belə k-mer ən azı uzunluğun maksimum dəqiq uyğunluğuna qədər uzadıla biləcəyini yoxlamaq üçün yoxlanılır l. Uzatma cüt xarakterli müqayisələr yolu ilə həyata keçirilir və beləliklə, bu yanaşmanın işləmə müddəti təkcə potensial lövbərlərin sayından deyil, həm də onların uzunluqlarından asılıdır. Bu, iki müxtəlif ştamm arasında uzunluğu 20 və ya daha böyük olan bütün maksimum uyğunluqların olduğu bir nümunə ilə təsvir edilə bilər. Escherichia coli (ştamm K12, 4,639,221 əsas cüt (bp) və O157:H7, 5,528,445 bp) hesablanır. ilə k = 10, üçün tipik seçimdir k, hashing yanaşması əvvəlcə 4.99 × 10 7 yaradır k-mers və sonra uzunluğu 20 və ya daha böyük olan bütün 46,629 maksimal uyğunluğu müəyyən etmək üçün 1,66 × 10 7 simvol müqayisəsini həyata keçirir. Beləliklə, 0,1% -dən az istehsal k-mers müəyyən edilmiş uzunluqdakı maksimum uyğunluqlara qədər uzadılır. Bu səbəbdən, nəzərdən keçirilən ardıcıllıqlar uzun alt sətirləri bölüşürsə, yaratma və sınaq yanaşması uzun müddət işləməyə səbəb olur.

Hashing yanaşmasının bu dezavantajını dərk edərək, MUMmer 1.0 uyğunlaşma üçün potensial lövbərləri tapmaq üçün şəkilçi ağaclarından istifadə edən ilk proqram sistemi idi. Suffiks ağacları, demək olar ki, üç onilliklər ərzində kompüter elmində tədqiq edilmişdir (bax: [23] ümumi baxış üçün). Suffiks ağacı, bu sətir DNT ardıcıllığı, zülal ardıcıllığı və ya düz mətn olmasından asılı olmayaraq sətirin bütün alt sətirlərini təmsil etmək üçün məlumat strukturudur. Suffiks ağacları onları geniş miqyaslı genom analizi üçün mühüm məlumat strukturu edən aşağıdakı gözəl xüsusiyyətlərə malikdir: sim üçün şəkilçi ağacı S uzunluğu n ilə mütənasib fəzada təmsil oluna bilər n ilə mütənasib zamanda şəkilçi ağacı qura bilən sürətli alqoritmlər işlənib hazırlanmışdır n [24, 25] -in şəkilçisi verilmişdir S və sorğu sətri Q uzunluğu m, arasında bütün unikal maksimal uyğunluqları hesablamaq üçün alqoritmlər var SQ ilə mütənasib vaxtda hər hansı müəyyən edilmiş minimum uzunluq (potensial lövbərlər). m. Unikal və ya olmayan bütün maksimal uyğunluqları optimal vaxtda tapmaq olar. Xüsusilə qeyd edək ki, hashing yanaşmalarından fərqli olaraq, şəkilçi ağacı alqoritmlərinin işləmə müddəti maksimal uyğunluqların uzunluğundan asılı deyil.

MUMmer-in əvvəlki versiyalarına daxil edilmiş şəkilçi ağacı alqoritmlərinin təfərrüatları [5, 7]-də təsvir edilmişdir. Burada yeni inkişaflara diqqət yetirəcəyik. MUMmer, AVID, BLASTZ və LAGAN [20] ilə müqayisədə 4 ilə 110 dəfə arasında dəyişən MUMmer üçün son bildirilmiş sınaq müddətində genişmiqyaslı uyğunlaşma üçün ən sürətli proqramlardan biridir. Defolt parametrlərində MUMmer uyğunluqları aşkar etməkdə bu proqramlara nisbətən daha az həssasdır, lakin biz MUMmer 3.0-a sistemin başqa cür tapacağından daha zəif uyğunluqların aşkarlanmasına imkan verən bir neçə komanda xətti variantı əlavə etmişik. Qeyd edək ki, MUMmer-in modulluğu və onun açıq mənbə kodu kimi əlçatanlığı o deməkdir ki, başqaları indi, məsələn, MUMmer-də şəkilçi ağacı uyğunlaşdırma alqoritmi və LAGAN və ya AVID-dən uyğunluq genişləndirilməsi proqram kodundan istifadə edərək hibrid sistem qura bilər.

MUMmer 3.0-a əlavə edilmiş əlavə xüsusiyyətlər yeni Java görüntüləyicisidir, DisplayMUM əncir formatında və ya PDF-də şəkillər yaratmaq üçün yeni qrafik çıxış proqramıdır, kontigs dəstinin istinad xromosomuna uyğunlaşdırılmasını və qeyri-adi uyğunluqları tapmaq üçün yeni seçimləri göstərir. Bunlar aşağıda təsvir olunacaq.

Optimallaşdırılmış şəkilçi ağacı məlumat strukturu və şəkilçi ağacı kitabxanası

MUMmer 3.0-da ən əhəmiyyətli texniki təkmilləşdirmə [26]-nın kompakt şəkilçi ağacı təsvirinə əsaslanan şəkilçi ağacı kodunun tam yenidən yazılmasıdır. Bu təsvir təkrar analiz aləti REPuter-də də istifadə edilmişdir [27]. Bununla belə, REPuter yalnız 134 milyon bp (Mbp) qədər ardıcıllığı yerləşdirə bilərdi. MUMmer 3.0 üçün tətbiq elə təkmilləşdi ki, o, 4 giqabayt (GB) real yaddaşa malik kompüterdə 250 Mb/s-ə qədər ardıcıllığa imkan verir ki, bu da hər bir baza cütü üçün bir qədər böyük yer istifadəsi hesabınadır. Məsələn, insan 2-ci xromosom üçün şəkilçi ağacını (237.6 Mbp, ən böyük insan xromosomu) hər bir baza cütü üçün 15.4 baytdan istifadə etməklə qurmaq olar. Uzunluğu 134 Mbp-dən az olan DNT sekanslarının işlənməsi üçün MUMmer elə tərtib edilə bilər ki, o, hər bp üçün cəmi 12,5 bayt istifadə etsin [26]. DNT sekansları üçün şəkilçi ağacları adətən zülal ardıcıllıqlarından daha böyük olduğundan, baza-cüt nisbətinə düşən baytlar sonuncu üçün daha yaxşıdır.

MUMmer indi buraxılış 2.1 ilə müqayisədə təxminən 25% daha az yaddaş tələb edir və bir qədər daha sürətli işləyir. 1999-cu ildəki ilk buraxılışla müqayisədə sistem iki dəfədən çox sürətlidir və yaddaşın yarısından az istifadə edir. MUMmer 2.1-də olduğu kimi, buraxılış 3.0 sorğu ardıcıllığını istinad ardıcıllığının şəkilçi ağacına qarşı axın edir. Beləliklə, MUMmer-in ümumi boşluq tələbi şəkilçi ağacının ölçüsü üstəgəl istinadın və sorğu ardıcıllığının ölçüsüdür. Cədvəl 1 müxtəlif genom və ya xromosom cütləri üçün maksimal uyğunluqları hesablayarkən MUMmer buraxılış 2.1 və 3.0 üçün işləmə vaxtlarını və yaddaş tələblərini göstərir.

MUMmer-in əvvəlki versiyaları 1700 sətir koddan ibarət bir monolit proqramda əsas şəkilçi ağacın qurulması və keçid alqoritmlərini həyata keçirsə də, hazırkı versiya yaxşı strukturlaşdırılmış və yaxşı sənədləşdirilmiş proqram kitabxanasına əsaslanır. Bu, çoxlu DNT və ya zülal ardıcıllığını və onların şəkilçi ağaclarını idarə etmək üçün məlumat növlərini təmin edir. Kitabxana şəkilçi ağacını qurmaq və onu keçmək funksiyalarını ehtiva edir. Bu yolla, kod bazasını dəyişdirmək və ya genişləndirmək niyyətində olan bir proqramçı, şəkilçi ağacının bütün aşağı səviyyəli tətbiq detallarını öyrənməyə ehtiyac olmadan, kitabxana tərəfindən təmin edilmiş yaxşı sənədləşdirilmiş interfeyslərdən istifadə edə bilər.

3.0 buraxılışı ilə MUMmer indi çox konfiqurasiyalı arayışa qarşı çox konfiqurasiyalı sorğu işlətmək imkanına malikdir. Əvvəllər bu, Nucmer paketindən istifadə etməklə mövcud idi, lakin birbaşa əsas mummer proqramı çərçivəsində deyil. Cədvəl 1-də, məsələn, genom ardıcıllığı Aspergillus fumigatus (bu tədqiqat zamanı) 248 kontigsə uyğunlaşdırılmış 19 iskeledən ibarət idi. A. nidulans. Bu müqayisə 3.0 buraxılışındakı mummer proqramına sadə bir çağırışla idarə olundu, lakin 2.1-ci buraxılışda istinad ardıcıllığı əvvəlcə vahid kontigəyə yığılmalı və uyğunlaşdıqdan sonra koordinatlar yenidən xəritələnməlidir (Nucmer tərəfindən). düzgün contig yerləri. Hər iki buraxılış çox konfiqurasiyalı sorğu fayllarını idarə edir. Cədvəl 1, həmçinin meyvə milçəyinin 22,2 Mbp 2L xromosomunun uyğunlaşdırılması üçün vaxtları göstərir. Drosophila melanogaster aralıq məclisə (genom layihəsi tamamlanmamışdan əvvəl). D. psevdoobscura. Bu halda, təqribən 150 Mb/s ardıcıllığı olan 4653 skafolddan ibarət sorğu ardıcıllığı istinaddan xeyli uzun idi. Proqram 485 Mb ümumi yaddaş, şəkilçi ağacı üçün təxminən 310 Mb və giriş ardıcıllığını saxlamaq üçün qalan yaddaş tələb edirdi.

Unikal olmayan maksimal uyğunluqlar

MUMmer-in əvvəlki versiyaları uyğunlaşma üçün potensial lövbər kimi maksimal unikal uyğunluqları (MUMs) vurğulayırdı. MUM-lar unikaldır ki, onlar genomların hər birində bir dəfə baş verirlər. Bəzi hallarda unikallıq məhdudiyyəti MUMmerin təkrarlanan alt sətir üçün bütün uyğunluqları tapmasına mane olacaq. Məsələn, istinad genomunda müəyyən bir sətirin iki dəqiq nüsxəsi varsa və sorğuda yalnız bir nüsxə varsa, MUMmer-in əvvəlki versiyaları ətrafdakı ardıcıllıqdan asılı olaraq uyğun gələn nüsxələrdən birini əldən verər. Bu problemin öhdəsindən gəlmək üçün yeni MUMmer sistemi proqram mummerinə əmr xətti seçimini təmin etməklə, qeyri-unikal olanlar da daxil olmaqla, iki daxiletmə ardıcıllığı arasında bütün maksimal uyğunluqları tapa bilər. Digər komanda xətti seçimləri istifadəçiyə həm sorğuda, həm də istinad ardıcıllığında unikal olan MUM-lar və ya yalnız istinad ardıcıllığında unikal olan MUM-lar istehsal etməyə imkan verir.

Baxmayaraq ki, bütün maksimal uyğunluqları istehsal edən alqoritm unikal maksimal uyğunluqlar yaratma alqoritmindən daha mürəkkəbdir, lakin o, hələ də optimal vaxtın giriş sətirlərinin ölçülərinin cəminə və tapılan uyğunluqların sayına mütənasib olacağı demək olar ki, optimal vaxtda işləyir. . Üç növ maksimum uyğunluqdan hər hansı birini hazırlamaq üçün işləmə vaxtları ümumiyyətlə oxşardır. Bununla belə, nəzərə alın ki, proqram bütün qeyri-adi uyğunluqları, o cümlədən qısa olanları tapmağa yönəldildikdə, çıxışın ölçüsü olduqca böyük ola bilər və çıxış faylını yaratmaq vaxtı hesablamanın dominant hissəsi olacaqdır.

Uzaq matçlar

MUMmer 1.0-da səslənən tənqidlərdən biri o idi ki, o, yalnız dəqiq uyğunluqlar tapır, halbuki praktikada biz tez-tez təxmini uyğunluqlar, yəni 100%-dən az eyni olan ardıcıllıqlar arasında uyğunluqlar tapmaq istəyirik. MUMmer üzərində qurulmuş Nucmer və Promer paketlərinin tətbiqi ilə 2.1 buraxılışında bu narahatlığı həll etdik. Bunlar 3.0 buraxılışında əhəmiyyətli dərəcədə təkmilləşdirilib və indi əsas axtarışın özündən yalnız bir qədər yavaş performans nümayiş etdirir. Nucmer və Promer-in 2.1 buraxılışı ilə müqayisədə sürəti təxminən 10 dəfədir.

Həm Nucmer, həm də Promer aşağıda təsvir olunan alqoritmdən istifadə edərək yerli düzülmələr toplusunu yaradırlar. İki proqram arasındakı fərq ondadır ki, Nukmer iki dəst DNT ardıcıllığı arasında nukleotid uyğunlaşmalarını qurur, Promer isə amin turşusu düzülmələrini qurur. Hər bir ardıcıllıq dəsti eyni genomdan olan bir və ya bir neçə ardıcıllığın toplusudur, məsələn, genom montajçısı tərəfindən istehsal olunan kontiglər toplusudur. Promer əvvəlcə bütün altı çərçivədə həm istinadı, həm də sorğunu tərcümə edir, amin turşusu ardıcıllığında bütün uyğunluqları tapır və sonra uyğunluqları orijinal DNT koordinat sisteminə qaytarır. Aşağıdakı genişləndirmə addımı üçün Promer uyğunsuzluqları hesablamaq üçün standart amin turşusu əvəzetmə matrisindən (BLOSUM62 standartdır) istifadə edir.

Nucmer/Promer uyğunlaşdırma alqoritmi aşağıdakı kimidir. Birincisi, hər iki proqram müəyyən uzunluqdan daha uzun olan bütün dəqiq uyğunluqları tapmaq üçün MUMmer-i işə salır l, Nukmer üçün nukleotidlərlə və Promer üçün amin turşuları ilə ölçülür. İkincisi, matçlar onların uzadılması üçün qruplaşdırılıb. İki uyğunluq bir-birindən çox olmadıqda eyni klasterə birləşdirilir g nukleotidlər (Nucmer) və ya amin turşuları (Promer). Sonra hər bir çoxluqdan maksimum uzunluqlu kibrit zənciri çıxarılır və uyğunluqların ümumi uzunluğu ən azı olarsa, daha da işlənir. c nukleotidlər/amin turşuları. (Qeyd edək ki, əgər zəncir tək uyğun gələn bölgədən ibarət ola bilər l >c.) Parametrlər l, g, və c hamısı komanda xəttində təyin edilə bilər. Daha sonra zəncirvari uyğunluqlar Smith-Waterman dinamik proqramlaşdırma alqoritminin [28] tətbiqindən istifadə edilərək uzadılır ki, bu alqoritm dəqiq uyğunluqlar arasındakı bölgələrə və həmçinin xaricə uzana bilən zəncirlərin sərhədlərinə tətbiq edilir. Alqoritmdəki bu “uyğunlaşdırma və genişləndirmə” addımı mahiyyət etibarı ilə FASTA [29], BLAST [30] və bir çox digər ardıcıllıqla düzülmə proqramları tərəfindən istifadə edilən ilə eynidir.

İki növ çox oxşar olduqda, məsələn, iki izolat Bacillus anthracis Ames ştammı TIGR-də [31-33] ardıcıllıqla, sonra MUMmer genomları uyğunlaşdırmaq üçün idealdır. Qarayara izolatlarının bu müqayisəsində yalnız dörd tək nukleotid fərqi iki 5,3 Mbp əsas xromosomu bir-birindən ayırdı. Eynilə, bir klinik təcrid bizim müqayisəmizdə Mycobacterium tuberculosis laboratoriya ştammına [31], MUMmer tez bir zamanda təxminən 1100 SNP və ştammları fərqləndirən bir ovuc IS elementini tapdı. Bununla belə, müqayisə edilən növlər daha uzaqda olduqda, Nucmer və Promer tək MUMmerdən daha ətraflı və daha faydalı uyğunlaşma təmin edir. Aşağıda təsvir edilən nümunələrdə, burada təsvir edilən proqramların hər birinin müxtəlif təkamül məsafələrindəki genomlar üçün necə işlənə biləcəyini göstəririk.

Uçmaq və uçmaq

130 Mbp genomu D. melanoqaster altı əsas xromosom qolunda yalnız bir neçə boşluq var. Bu yaxınlarda Baylor Tibb Kollecindəki İnsan Genomu Sıralama Mərkəzi ov tüfənginin ardıcıllığını tamamladı. D. psevdoobscura, təxminən eyni ölçüdə genomu olan yaxından əlaqəli növ. Bu iki növ kifayət qədər yaxındır ki, demək olar ki, bütün genlər paylaşılır və ekzonlar yüksək səviyyəli ardıcıllıq şəxsiyyətini göstərir. Bununla belə, onlar kifayət qədər uzaqdırlar ki, intergenik bölgələr və intronlar yaxşı uyğunlaşmır və növlər ayrılandan bəri yüzlərlə geniş miqyaslı xromosomal düzəlişlər olmuşdur. Beləliklə, hər bir xromosom qolunu həmkarına uyğunlaşdırmaq sadəcə mümkün deyil. Məsələni daha da çətinləşdirən, D. psevdoobskura ov tüfəngi montajı minlərlə iskele və kontiglərdən ibarətdir. Müqayisəni asanlaşdırmaq üçün ilk hesablama işi bütün iskeleləri hər birinə uyğunlaşdırmaqdır. D. melanoqaster silah. (Hərtərəfli təhlili D. psevdoobskuraArdıcıllıq mərkəzinin alimləri və onların əməkdaşları tərəfindən təşkil edilən , gələcək məqalədə görünəcək. Buradakı təsvir ilk növbədə Nucmer-in istifadəsini və imkanlarını göstərmək üçün nəzərdə tutulub.)

Biz Nucmer proqramını minimum 25 uyğunluq uzunluğu ilə işlədik, bu, demək olar ki, bütün uyğun eksonları tutmaq üçün adekvat idi. Uyğun genlər daha uzun olduğundan, biz çoxluq zəncirlərinin ən azı 100 uyğun nukleotidin olmasını tələb etdik. Uzun intronları hesablamaq və proqrama birdən çox geni birləşdirməyə imkan vermək üçün biz dəqiq uyğunluqlar arasındakı boşluğun 3000 bp qədər olmasına icazə verdik. Bizim təhlilimiz zamanı (ardıcıllıq layihəsi başa çatmamışdan əvvəl), the D. psevdoobskura montaj 150 Mbp-ni əhatə edən 4,653 skafolddan ibarət idi. Tam iskele dəstini hər birinə uyğunlaşdırmaq üçün Nucmer-i ayrıca işə saldıq D. melanoqaster xromosom qolu. Bu parametrlərdən istifadə etməklə proqram hər qol üçün təxminən 6 dəqiqə çəkir və Linux ilə işləyən 2,8 GHz tezliyi olan Pentium 4 masaüstü kompüterində təxminən 490 Mb yaddaşdan istifadə edir.

Ağcaqanadlara qarşı uçmaq

İki növ daha uzaqdan əlaqəli olduqda, böyük miqyaslı oxşarlığı aşkar etməyin yeganə yolu amin turşusu səviyyəsində müqayisələrdir. Bu fenomenin bir nümunəsi malyariya ağcaqanadının genomlarını müqayisə edərkən ortaya çıxdı. Anopheles gambiae, və meyvə milçəyi D. melanoqaster. Çünki Anofel ardıcıllaşdırılan ikinci həşərat genomu idi, müqayisə üçün yeganə mövcud növ meyvə milçəyi idi. Heydelberqdəki Avropa Molekulyar Biologiya Laboratoriyasındakı həmkarlarımızla birgə apardığımız təfərrüatlı təhlilimiz BLAST və MUMmer analizinin birləşməsinə əsaslanırdı [34]. Bu iki növ təxminən 250 milyon il əvvəl bir-birindən ayrılıb və onların orta hesabla 56% zülal ardıcıllığı eyniliyi var ki, bu da insanlar və pufferfish arasında paylaşılandan daha azdır. Hər iki böcəyin eyni sayda xromosom olmasına baxmayaraq Anofel genom təqribən iki dəfə böyükdür və düzülmələrimiz aşkar edildiyi kimi gen sırası demək olar ki, tamamilə qarışdırılıb. Yalnız kiçik, lakin çoxsaylı "mikrosinteniya" bölgələri qalır: biz 948 bölgəni bildirdik, ən böyüyündə 8 gen ehtiva edir. Anofel və 31 düym Drosophila. Maraqlı bir tapıntı o idi ki, geniş qarışıqlığa baxmayaraq, hər bir xromosom qolunun digər növlərdə tək qolda homologların açıq üstünlük təşkil etməsi, xromosomdaxili genlərin qarışdırılmasının gen sırasına təsir edən əsas qüvvə olduğunu göstərir (bax [34] Şəkil 7). ).

Göbələk və göbələk

Hazırkı tətbiqdə biz iki əlaqəli göbələk genomunu müqayisə etmək üçün həm Nucmer, həm də Promerdən istifadə edirik, Aspergillus fumigatus (insan patogeni) və A. nidulans (qeyri-patogen model orqanizm). Bu iki genomun ov tüfəngi ardıcıllığı tamamlandı və A. fumigatus tam başa çatmaq üzrədir, yəni bütün boşluqlar bağlanır. (A. fumigatus TIGR və The Sanger İnstitutunun birgə ardıcıllıq layihəsidir A. nidulans Whitehead/MIT Genom Mərkəzində ardıcıllıqla aparılır.) Ən son müqayisəmiz zamanı, A. fumigatus genom, 28 Mbp-ni əhatə edən 19 skafoldda yığıldığı nöqtəyə qədər irəliləmişdi və A. nidulans genom 30 Mbp-ni əhatə edən 238 kontigdə yığılmışdır. Bu müqayisə üçün biz əvvəlcə Nucmer-i işə saldıq və aşkar etdik ki, iki genomun əksəriyyəti bir-biri ilə tam aydın şəkildə xəritələşib: sadə nöqtə süjetində oxşarlığın böyük seqmentlərini aşkar etmək üçün kifayət qədər uyğunluqlar var. Xromosomların geniş şəkildə yenidən qurulması baş verdi, lakin geniş miqyaslı sinteniya hələ də mövcuddur. Məsələn, ən böyük contig (A1058). A. fumigatus, 2.9 Mbp-də, mahiyyətcə tam bir xromosomu təmsil edir, beş fərqli skafold üzərində xəritələr A. nidulans. Əgər bunlardan ən böyüyü olan 2.1 Mbp sürətində 10 kontigasiyadan ibarət iskelenin Nukmer düzülüşünə nəzər salsaq, o, çoxlu seqmentlərə bölünmüş kimi görünür, lakin kibritlər o qədər səpələnmişdir ki, neçə seqment olduğunu söyləmək çətindir (Şəkil 1). 1, sol tərəf).

2.9 Mbp-lik xromosomun nöqtəli düzülüşü A. fumigatus (x-ox) 2,1 Mbp-lik bir iskele üçün A. nidulans (y-ox). Sol: Nukmer ilə nukleotid əsaslı uyğunlaşma. Sağda: Promer ilə amin turşusu əsaslı uyğunlaşma. Düzəldilmiş seqmentlər Nucmer hizalamasında 3000 bp-ə qədər və Promer düzülüşündə 9500 bp-ə qədər olan nöqtələr və ya xətlər kimi təmsil olunur. Bu düzülmələr mummerplot skripti və Unix proqramı gnuplot tərəfindən yaradılmışdır.

Sintenik uyğunlaşma daha aydın görünür, lakin əvəzinə Promer istifadə etsək. Ən sadə xülasə düzləşdirmələrə daxil edilmiş əsasların sayıdır: iskelelər arasında Nucmer düzülməsinə baxsaq, uyğun əsasların ümumi sayı 81 kbp-dir. Bunun əksinə olaraq, Promer düzülüşü 1,000,000 nukleotid mövqeyindən başlayaraq xromosomun sonuna qədər davam edən 1,87 Mbp A1058-ni əhatə edir. Qrafik illüstrasiya Şəkil 1-də göstərilmişdir, burada həm Promer, həm də Nukmer 2.1 Mbp-lik skafold arasında uyğunlaşma göstərilir. A. nidulans və iskele A1058 A. fumigatus. Şəkildən aydın göründüyü kimi, amin turşusu əsaslı düzülmə hər iki növün ardıcıllığının daha çox hissəsini əhatə edir və buna görə də genlər və xromosom əlaqələri arasında homoloji əlaqələri müəyyən etmək üçün daha faydalıdır.

İnsana qarşı insan

Bu gün yerinə yetirə biləcəyi ən çətin hesablama işlərindən biri məməlilərin genomlarının çarpaz müqayisəsidir. İnsan və siçan genomları kifayət qədər tamamlanıb ki, davam edən tədqiqatlar bu iki növ arasındakı xəritələrə əsaslanır. Cədvəl 1-də göstərildiyi kimi, MUMmer 3.0 bir neçə dəqiqə ərzində insan və siçan xromosomlarını müqayisə edə bilər.Cədvəl siçan xromosomunun 16-nı (Mm16) insan 21-ci xromosomuna (Hs21) uyğunlaşdırmaq üçün tələb olunan vaxtı (2,4 GHz Pentium prosessorunda 7 dəqiqə 10 saniyə) göstərir. Bu ikisi ona görə seçilmişdir ki, demək olar ki, bütün Hs21 xəritələri Mm16-nın bir ucuna bərabərdir, əslində tədqiqatçılar Mm16-nın bu hissəsinin əlavə surətinə malik olan Daun sindromunun siçan modelini işləyib hazırlamışlar.

Biz MUMmer 3.0 sınaq testini keçirdik və burada insan genomunu (3 yanvar 2003-cü il versiyası, GenBank-dan endirilmiş) hər bir xromosom və digərləri arasında ən azı 300 uzunluğa malik bütün maksimal uyğunluqları hesablayaraq özü ilə müqayisə etdik. Nəticədə 631.975 uyğunluq həm böyük, həm də kiçik miqyaslı xromosomlararası duplikasiyaları müəyyən etməyə imkan verir. Qeyd edək ki, [6]-da bildirilmiş iş vaxtları yalnız MUMmer-in uyğunluq tapmaq hissəsi üçündür. Klasterlərin işlənməsi və uyğunluqlar arasındakı boşluqlarda düzülmələrin yerinə yetirilməsi üçün vaxt buraxılıb, çünki bunlar istifadə olunan parametrlərdən asılı olaraq geniş şəkildə dəyişir.

Bu test üçün bizə maksimum təxminən 4 GB yaddaş lazım idi. Bu qədər yaddaşa malik kompüterimiz olmadığı üçün biz Solaris əməliyyat sistemi ilə işləyən, 64 GB yaddaş və 950 MHz prosessoru olan Sun-Sparc kompüterindən istifadə etdik.

Düzəltməni aşağıdakı kimi həyata keçirdik. Hər bir insan xromosomu istinad olaraq istifadə edildi və genomun qalan hissəsi sorğu olaraq istifadə edildi və ona qarşı axın edildi. Duplikasiyanın qarşısını almaq üçün sorğuya yalnız xromosomları əlavə etdik, əgər onlar müqayisə olunmayıbsa, biz ilk olaraq 1-ci xromosomu istinad kimi istifadə etdik və digər 23 xromosomu ona qarşı yayımladıq. Sonra 2-ci xromosomdan istinad olaraq istifadə etdik və buna qarşı 3-22, X və Y xromosomlarını axın etdik və s.

Bu test üçün bütün insan xromosomlarının ümumi uzunluğu 2,839 Mbp idi. Bütün şəkilçi ağacların qurulması üçün tələb olunan vaxt 4,7 saat idi. Suffiks ağacı üçün boşluq tələbi olduqca sabit idi, əsas cüt üçün təxminən 15,5 bayt (yalnız bir istisna ilə). Ümumi sorğu müddəti 101,5 saat idi və yaddaş istifadəsi heç vaxt 3,9 GB-ı keçməmişdir (ətraflı məlumat üçün bax [6]). Beləliklə, bir prosessorda təxminən 4,5 gün ərzində insan genomunu özünə qarşı uyğunlaşdırdıq. Bu asanlıqla çoxlu kompüterlər arasında bölünə bilər, hər bir xromosom ayrıca idarə olunur və vaxtı cəmi 11 saata endirir.

Qrafik izləyicilər

MUMmer 3.0-ın mətn formatında çıxışı çox vaxt həcmli olduğundan, biri iki genom yığıncağı və ya təxminən eyni ardıcıllığı müqayisə etmək, digəri isə iki fərqli növ kimi daha uzaqdan əlaqəli genomları müqayisə etmək üçün iki qrafik görüntüləyici hazırlamışıq. . İlk tamaşaçı, DisplayMUMs, açıq mənbəli, platformadan müstəqil Java proqramıdır. O, müxtəlif Unix/Linux platformalarında sınaqdan keçirilib və həmçinin Apple Macintosh (OS X) və ya Microsoft Windows kompüterlərində işləyir. MUMmer-in işlədilməsinin nəticələrini daxil edən proqram istifadəçiyə eyni və ya çox yaxından əlaqəli genomların iki fərqli birləşməsinin nəticələrini uyğunlaşdırmağa və nəzərdən keçirməyə və bir kontigs dəstini digərinə yapışdırmağa imkan verir. Bu, genomların yığılması və tamamlanması prosesində tez-tez istifadə olunan bir funksiya olan montaj müqayisəsi üçün güclü qrafik ön hissəni təmin edir. Bu, istifadəçiyə kontiglərin niyə düzgün bir şəkildə birləşmədiyini başa düşmək üçün montaja oxunan ardıcıllığın döşənməsini vizuallaşdırmağa imkan verir. Alternativ olaraq, eyni məlumat üzərində müxtəlif genom montajçılarının çıxışını müqayisə etmək olar, bu, genom böyük olduqda və montajçılar razılaşmadıqda olduqca çaşdırıcı ola bilər.

DisplayMUMs Şəkil 2-də təsvir edilmiş müstəqil displey yaradır. O, üç əsas sahəni ehtiva edir. Yuxarı sahə yaxınlaşdırılmış nukleotid düzülüşü də daxil olmaqla müxtəlif növ məlumatları göstərə bilər. Mərkəzi panel uyğunlaşdırmanın xülasəsini göstərir, istinad isə boz çubuq kimi göstərilir. Sorğuların istinadla uyğunluğu yaşıl (irəli) və qırmızı (geri) düzbucaqlılar kimi göstərilir, boşluqlar boz rənglə göstərilir. İkinci boz çubuq mavi rəngdə boşluqları göstərir, bu, lazımsız görünə bilər, lakin miqyas kiçildildikdə faydalıdır, məsələn, ardıcıllıqda yalnız bir kiçik boşluq varsa və miqyasda 1 Mbp göstərilirsə, o zaman kiçik boşluq ekranda görünməz olacaq. yuxarı çubuq, lakin hələ də aşağı çubuqda görünəcək. Aşağı panel istinaddakı bütün sorğu ardıcıllığının döşənməsini göstərir, qırmızı və yaşıl rənglər irəli və tərs uyğun gələn alt sətirləri göstərir. Şəkil 2-də göstərildiyi kimi, bəzi ardıcıllıqlar uzunluğunun yalnız kiçik bir hissəsinə uyğun ola bilər, digərləri isə bütün uzunluğu boyunca uyğunlaşacaq. DisplayMUM-lar proqram təminatında sənədləşdirilən siçan üzərində hərəkət və axtarış funksiyaları da daxil olmaqla bir çox başqa xüsusiyyətlərə malikdir. Bu nümunənin aydın olduğu kimi, onun əsas məqsədi MUMmer-in genom-montaj analizi üçün faydalılığını yaxşılaşdırmaqdır.

Ayrı-ayrı ov tüfənglərinin oxunuşlarının (sorğu ardıcıllığının) bütövlükdə genom düzülməsini göstərən DisplayMUM-lardan nümunə ekranı. Staphylococcus epidermidis genom. Ekran plitələr oxunuşlarının dəqiq uyğunluqların kontig konsensusuna qarşı necə görünə biləcəyini göstərir. Sorğu ardıcıllığında yaşıl və qırmızı rənglər müvafiq olaraq irəli və tərs tellərdə düzülməni göstərir.

İkinci tamaşaçı, MapView, Nucmer və ya Promer çıxışı əsasında iki növ arasında xəritəçəkmənin şəklini yaradır. Bu tamaşaçını yaratmaq üçün motivasiya, artıq tamamlanmış başqa bir genom haqqında anlayışımızı artırmaq üçün həyata keçirilən və sürətlə artan genom layihələri idi. Bu layihələrdə ikinci genom birinci ilə yalnız zəif DNT ardıcıllığına bənzərliyə malik ola bilər və bəzi hallarda oxşarlıq yalnız Promer tərəfindən istehsal olunanlar kimi zülal ardıcıllığının düzülüşü ilə aşkar edilə bilər. Belə bir layihənin yaxşı nümunəsi ardıcıllıq üçün son səylərdir D. psevdoobskura Yuxarıda göstərilib. Bu layihə üçün əsas motivasiya annotasiyasını təkmilləşdirməkdir D. melanoqaster, və MUMmer yeni yığılmışların xəritəsini çıxarmaq üçün istifadə edilən alətlərdən biridir D. psevdoobskura onun üzərinə. İstinad genomu yaxşı şərh edildiyi üçün biz izləyiciyə genlərin (və onların identifikatorlarının) yerlərini DNT və ya amin turşusu ardıcıllığı səviyyəsində xəritələşdirmə ilə birlikdə göstərmək seçimini daxil etdik. MapView tərəfindən bu uyğunlaşmanın şəkli Şəkil 3-də göstərilmişdir ki, bu da bu iki növ arasında amin turşusunun saxlanmasının annotasiya edilmiş ekzon strukturuna yaxından uyğun gəldiyini aydınlaşdırır. Bu görüntüləyici, əvvəlki analizlərdə ekzonların buraxılmış ola biləcəyi bir genom sahələrini vurğulamaq üçün istifadə edilə bilər.

MapView proqramı tərəfindən yaradılmış, 185 kbp-lik bir dilimi göstərən nümunə ekran D. melanoqaster xromosom 2L və onun uyğunlaşması D. psevdoobskura. Promer tərəfindən yaradılan düzülmə qorunmuş amin turşusu ardıcıllığının bütün bölgələrini göstərir. Şəkili əhatə edən mavi düzbucaqlı istinadı təmsil edir (D. melanoqaster), yuxarıda qeyd edilmiş genlərlə. Eyni genin alternativ splice variantları şaquli şəkildə yığılmışdır. Eksonlar, onları birləşdirən müdaxilə edən intronlar ilə qutular kimi göstərilir. 5' və 3' UTR-lər genin tərcümə istiqamətini göstərmək üçün çəhrayı və mavi rəngdədir. Promer uyğunluqları iki dəfə göstərilir, bir dəfə istinad genomunun bir az altında, burada bütün uyğunluqlar qırmızı qutulara yığılır və daha böyük ekranda hər bir kontigasiya daxilində ayrı-ayrı uyğunluqlar göstərilir, burada kontiglər kontig sərhədlərini göstərmək üçün fərqli rəngdədir. Uyğunluqların şaquli mövqeyi ekranın aşağı hissəsində 50%-dən qırmızı düzbucaqlıların bir az altında 100%-ə qədər dəyişən faiz eyniliyini göstərir.

MapView proqramı üç formatda çıxış edə bilər: incir (Unix xfig proqramı ilə baxmaq üçün), PostScript və ya PDF. Ən çevik format olan incir, məhdudiyyətsiz sürüşdürməyə və böyütməyə və geniş çeşidli əlavə formatlara ixrac etməyə imkan verir. Bu, böyük bir kontigs kolleksiyası və böyük bir xromosom arasındakı xəritəyə baxmağı asanlaşdırır.


Nəticələr

Bu nəticələr, bütün genom ardıcıllığı layihəsi üçün oxunan məlumatların genomun davamlı təkmilləşdirilməsi üçün qiymətli mənbəni necə təmin etdiyini və müstəqil şəkildə yaradılan məlumatların daha yaxşı bir montaj yaratmaq üçün WGS məlumatlarına necə birləşdirilə biləcəyini göstərir. Nəticədə əldə edilən təkmilləşdirmələr, montajı daha da təkmilləşdirmək üçün işləməyə ümid etdiyimiz tədqiqat icmasına dərhal fayda verməlidir. Assambleya həqiqətən başa çatana qədər - insan da daxil olmaqla heç bir məməli genomunun hələ çatmadığı bir vəziyyət - biz boşluqları doldurmaq, yanlış istiqamətlənmiş bölgələri düzəltmək və xromosomlara daha çox ardıcıllıq yerləşdirmək üçün yeni məlumatları daxil etməyə davam edəcəyik. Hal-hazırda ardıcıllaşdırılan alpaka və qoyunların genomları bu yaxından əlaqəli məməlilər arasında təkamül mühafizəsinə əsaslanaraq gələcək təkmilləşdirmələr üçün zəngin mənbə təmin etməlidir.


Nəticələr

Biz ilk dəfə olaraq metazoa pan-genomunda geniş yayılmış gen PAV-ın mövcudluğunu dəstəkləyən əhəmiyyətli sübutlar təqdim edirik. Midiya genomunun qeyri-adi quruluşu bir neçə min genom ehtiva edən hemizigot genom bölgələrinin kütləvi olmasının nəticəsidir. ayrıla bilən protein kodlayan genlər. Stressə davamlılıq və immun reaksiya ilə əlaqəli funksiyalarda bu genlərin zənginləşdirilməsi, bu növün mülayim dəniz sahil sularında kosmopolit yayılması ilə misal olaraq, kütləvi PAV və midyelərin təkamül uğuru arasında mümkün əlaqələrin daha çox araşdırılmasını təmin edir. Çox güman ki, geniş PAV digər kosmopolit dəniz onurğasızlarında tapıla bilər ki, bunlar yayımlanan kürü tökmə, çox böyük effektiv populyasiya ölçüsü və oxşar ətraf mühit təzyiqlərinə məruz qalır, o cümlədən, eyni dərəcədə yüksək heterozigotluq dərəcələrinin bildirildiyi digər ikiqapaqlı növlər.


4. Struktur olmayan zülallar

Kapsid əmələ gətirən struktur zülallara əlavə olaraq, virus genomu replikasiya və virus yığılma proseslərində çoxsaylı rolları yerinə yetirən bir çox NSP-ləri kodlayır [37]. Bu zülallar erkən transkripsiyanın tənzimlənməsi, helikaz aktivliyi, immunomodulyasiya, gen transaktivasiyası və antiviral reaksiyaya qarşı mübarizə aparmaqla viral patogenezdə iştirak edir [38], [39], [40] ].

SARS-CoV-2-də NSP-lərin bəzi əsas funksiyalarını araşdırdıq (Cədvəl 1). InterProScan axtarışı göstərdi ki, SARS-CoV-2-nin NSP-ləri virus genomunun təkrarlanması (GO:0019079 və GO:0039694), zülalların işlənməsi (GO:0019082), transkripsiya (GO:0006351) və proteoliz daxil olmaqla bir çox bioloji proseslərdə iştirak edir. (GO: 0006508). Bu zülallar RNT-nin bağlanmasında (GO:0003723), endopeptidazanın aktivliyində (GO:0004197), transferaz aktivliyində (GO:0016740), ATP-nin bağlanmasında (GO:0005524), sink ionunun bağlanmasında (GO:0008270), RNT-də iştirak edir. - istiqamətləndirilmiş 5'RNT-polimeraza aktivliyi (GO:0003968), ekzoribonukleaza fəaliyyəti, 5'fosfomonoesterlər (GO:0016896) və metiltransferaza fəaliyyəti (GO:000816).

Cədvəl 1

SARS-CoV-2-də struktur olmayan zülalların siyahısı və onların molekulyar funksiyaları.

S. Xeyr.AralığıZülal adı və IDTəsvirTəklif olunan funksiya
1.1�Nsp1
<"type":"entrez-protein","attrs":<"text":"YP_009725297.1","term_id":"1802476805","term_text":"YP_009725297.1">> YP_0097252971.
Nsp1 virus replikazının N-terminal məhsuludurLider protein host tərcümə inhibitoru. RNT replikasiyası və emalında vasitəçilik edir. mRNT deqradasiyasında iştirak edir [41].
2.181�Nsp2
<"type":"entrez-protein","attrs":<"text":"YP_009725298.1","term_id":"1802476806","term_text":"YP_009725298.1">> YP_0097252981.
Nsp2 virus replikasiyasını yoxlamaq üçün vacib olan replika məhsuludurEv sahibi PHB və PHB2 [42] ilə qarşılıqlı əlaqə quraraq ev sahibi hüceyrə sağ qalma siqnal yolunun modulyasiyası.
3.819�Nsp3
<"type":"entrez-protein","attrs":<"text":"YP_009725299.1","term_id":"1802476807","term_text":"YP_009725299.1">> YP_0097252991.
Nsp3 bir neçə domen ehtiva edən papainə bənzər bir proteinazdır.Tərcümə edilmiş poliproteini fərqli zülallara ayırmaq üçün proteaz kimi fəaliyyət göstərir [43, 44].
4.2764�Nsp4
<"type":"entrez-protein","attrs":<"text":"YP_009725300.1","term_id":"1802476808","term_text":"YP_009725300.1">> YP_0097253001.
Membran əhatə edən zülalda transmembran domen 2 (TM2) var.Viral replikasiya-transkripsiya kompleksini dəyişdirilmiş ER membranlarına bağladığına inanılır [45].
5.3264�Nsp5
<"type":"entrez-protein","attrs":<"text":"YP_009725301.1","term_id":"1802476809","term_text":"YP_009725301.1">> YP_0097253011.
3C-yə bənzər proteinaz və əsas proteinazReplikasiya zamanı viral poliprotein emalında iştirak edir [46].
6.3570�Nsp6
<"type":"entrez-protein","attrs":<"text":"YP_009725302.1","term_id":"1802476810","term_text":"YP_009725302.1">> YP_009725302.
Ehtimal olunan transmembran domeniEv sahibi endoplazmatik retikulumdan otofaqosomların ilkin induksiyasında rol oynayır.
7.3860�Nsp7
<"type":"entrez-protein","attrs":<"text":"YP_009725303.1","term_id":"1802476811","term_text":"YP_009725303.1">> YP_0097253031.
Nsp7 RNT-dən asılı RNT polimerazdırO, nsp8 ilə hexadecameric super-kompleks təşkil edir ki, bu da içi boş silindrşəkilli strukturu əks etdirən replikasiyanı qəbul edir [47, 48].
8.3943�Nsp8
<"type":"entrez-protein","attrs":<"text":"YP_009725304.1","term_id":"1802476812","term_text":"YP_009725304.1">> YP_0097253041.
Multimerik RNT polimeraz replikazıO, nsp7 ilə hexadecameric superkompleks təşkil edir ki, bu da içi boş silindrşəkilli strukturu əks etdirən replikasiyanı qəbul edir [47, 48].
9.4141�Nsp9
<"type":"entrez-protein","attrs":<"text":"YP_009725305.1","term_id":"1802476813","term_text":"YP_009725305.1">> YP_009725305.
Tək zəncirli RNT bağlayan viral proteinssRNA bağlayan zülal kimi çıxış edərək viral replikasiyada iştirak edin [49].
10.4254�Nsp10
<"type":"entrez-protein","attrs":<"text":"YP_009725306.1","term_id":"1802476814","term_text":"YP_009725306.1">> YP_0097253061.
Böyümə faktoruna bənzər zülalın tərkibində iki sink bağlayıcı motiv varHər iki nsp14 3′-5′ exoribonuklease və nsp16 2′- stimullaşdırmaqla viral transkripsiyadaO-metiltransferaza fəaliyyəti. Buna görə də viral mRNA-ların qapağının metilasiyasında mühüm rol oynayır [50].
11.4393�Nsp12
<"type":"entrez-protein","attrs":<"text":"YP_009725307.1","term_id":"1802476815","term_text":"YP_009725307.1">> YP_0097253071.
RNT-dən asılı RNT polimeraza
(Pol/RdRp)
Viral RNT genomunun replikasiyası və transkripsiyasından məsuldur [51].
12.5325�Nsp13
<"type":"entrez-protein","attrs":<"text":"YP_009725308.1","term_id":"1802476816","term_text":"YP_009725308.1">> YP_0097253081.
Sink bağlayan domen, NTPaz/helikaz domeni, RNT 5-trifosfatazATP-ni bağlayan helikaz nüvəsi sahəsi. Sink bağlayan domen replikasiya və transkripsiyada iştirak edir [52, 53].
13.5926�Nsp14
<"type":"entrez-protein","attrs":<"text":"YP_009725309.1","term_id":"1802476817","term_text":"YP_009725309.1">> YP_0097253091.
Eksoribonükleaz domeninin yoxlanılması (ExoN/nsp14)3-5 istiqamətdə hərəkət edən ekzoribonukleaz aktivliyi və N7-guanin metiltransferaza fəaliyyəti.
14.6453�Nsp15
<"type":"entrez-protein","attrs":<"text":"YP_009725310.1","term_id":"1802476818","term_text":"YP_009725310.1">> YP_0097253101.
EndoRNAse nsp15-A1 və nsp15B-NendoUMn(2+)-a bağlı endoribonükleaz aktivliyi
15.6799�Nsp16
<"type":"entrez-protein","attrs":<"text":"YP_009725311.1","term_id":"1802476819","term_text":"YP_009725311.1">> YP_0097253111.
2′-O-riboza metiltransferazaViral mRNA-ların 5-qapaqlı strukturuna mRNA qapağı 2-O-riboza metilasiyasına vasitəçilik edən metiltransferaza [54].
16.4393-4405Nsp11 <"type":"entrez-protein","attrs":<"text":"YP_009725312.1","term_id":"1802476820","term_text":"YP_009725312.1">> YP_009715.13 amin turşusundan (sadaqsflngfav) hazırlanmış və Nsp12-nin birinci seqmenti ilə eynidir.Naməlum

SARS-CoV-2 poliproteinin daxili struktursuz bölgələrini araşdırmaq üçün SARS-CoV-2 ORF1ab poliproteinin tərcümə edilmiş ardıcıllığı GenBank-dan əldə edildi (Qoşulma ID: <"type":"entrez-nucleotide","attrs":< "text":"NC_045512.2","term_id":"1798174254","term_text":"NC_045512.2">> NC_045512.2). PONDR® (Təbii Narahat Bölgələrin Proqnozlaşdırıcısı), VLXT, VL3, VLS2 [55] və IUPred2A veb serverləri [56] kimi bir çox proqnozlaşdırıcılar vasitəsilə SARS-CoV-2 poliproteinində strukturlaşdırılmamış bölgələri proqnozlaşdırdıq. Bu alətlər bizə yerli şəraitdə struktur formalaşdırmağa meylli olmayan qalıqları proqnozlaşdırmaqla nizamsız protein bölgələrini müəyyən etməyə imkan verdi. Ϡ,5 həddi olan qalıqlar mahiyyət etibarilə nizamsız, 0,2 ilə 0,5 arasında olan qalıqlar isə çevik hesab olunurdu. Qrafik SARS-CoV-2 poliproteinindəki hər bir qalığın pozulma tendensiyasını göstərir, burada daha yüksək dəyərlər pozulma ehtimalının daha yüksək olmasına uyğundur (Şəkil 3). Məlumatların təhlili göstərir ki, SARS-CoV-2 yerli şəraitdə yaxşı müəyyən edilmiş üçüncü quruluşa malik olmayan bir çox daxili nizamsız bölgələrə malikdir. Nsp3-ün N-terminal bölgəsi (920�) bütün dörd proqnozlaşdırıcının proqnozlaşdırdığı kimi nizamsızlığa daha yüksək meyl göstərir. Bundan əlavə, bu təhlil SARS-CoV-2 poliproteininin struktur olmayan proteomu, eləcə də strukturlaşdırılmamış zülal bölgələri haqqında qısa məlumat verir ki, bu da infeksiyanın struktur əsasını, struktur əsaslı dərman kəşfini və SARS-in qarşılıqlı təsirini başa düşmək üçün faydalı ola bilər. -Müxtəlif fizioloji şəraitdə ev sahibi zülalları olan CoV-2 zülalları.

SARS-CoV2 poliproteinindəki hər bir qalığın nizamsızlıq meylini göstərən qrafik. Nöqtəli xətt 0,5 eşik dəyəridir.


İstinadlar

Abbott AG, Zhebentyayeva T, Barakat A, Liu Z (2015) The genetik nəzarət ağaclarda bud-break. Adv Bot Res: 201–228

Anagnostakis SL (2012) Xəstəlik və həşərat müqaviməti üçün ABŞ-da şabalıd yetişdirilməsi. Plant Dis 96:1392–1403

Anders S, Pyl PT, Huber W (2015) HTSeq—yüksək məhsuldarlıqlı ardıcıllıq məlumatları ilə işləmək üçün Python çərçivəsi. Bioinformatika 31:166–169

Anwar A, She M, Wang K, Riaz B, Ye X (2018) Bitki stress tolerantlığında ornitin aminotransferazanın (OAT) bioloji rolları: indiki tərəqqi və gələcək perspektivlər. Int J Mol Sci 19. https://doi.org/10.3390/ijms19113681

Aranzana MJ, Decroocq V, Dirlewanger E, Eduardo I, Gao ZS, Gasic K, Iezzoni A, Jung S, Peace C, Prieto H, Tao R, Verde I, Abbott AG, Arús P (2019) Prunus de novo genom ardıcıllığından sonra genetika və tətbiqlər: nailiyyətlər və perspektivlər. Bağçılıq Tədqiqatı 6:58

Arentz F (2017) Phytophthora cinnamomi A1: Qondvana mənşəli Yeni Qvineya və Avstraliyanın qədim sakini? Pathol 47:e12342 üçün

Auwera GA, Carneiro MO, Hartl C, Poplin R, del Angel G, Levy-Moonshine A, Jordan T, Shakir K, Roazen D, Thibault J, Banks E, Garimella KV, Altshuler D, Gabriel S, DePristo MA (2013) FastQ məlumatlarından yüksək etibarlı variant zənglərinə qədər: genom analizi alət dəsti ən yaxşı təcrübələr boru xətti. Curr Protoc Bioinformatika 43

Bacete L, Mélida H, Miedes E, Molina A (2018) Bitki hüceyrə divarının vasitəçiliyi ilə toxunulmazlıq: hüceyrə divarının dəyişməsi xəstəliyə müqavimət reaksiyalarını tetikler. Bitki J 93:614–636

Baier K, Maynard C, Powell W (2012) Böyümə kameralarında yüksək intensivlikli, yüksək dozalı işıq altında yaranan şabalıd növlərində erkən çiçəkləmə. J Amer Chest Found 26:8-10

Bairoch A, Apweiler R (1998) SWISS-PROT protein ardıcıllığı məlumat bankı və onun 1998-ci ildə TrEMBL əlavəsi. Nuklein turşuları Res 26:38-42

Bao W, Kojima KK, Kohany O (2015) Repbase yeniləməsi, eukaryotik genomlarda təkrarlanan elementlərin verilənlər bazası. Mob DNT 6:11

Barakat A, DiLoreto DS, Zhang Y et al (2009) Amerika şabalıdının (Castanea dentata) və Çin şabalıdının transkriptomlarının müqayisəsi.Castanea mollissima) şabalıd blight infeksiyasına cavab olaraq. BMC Bitki Biol 9:51

Bielenberg DG, Wang Y(E), Li Z et al (2008) Şaftalıda həmişə böyüyən yerin ardıcıllığı və annotasiyası [Prunus persica (L.) Batsch] terminal qönçələrin formalaşmasının tənzimlənməsi üçün namizəd genlər kimi altı MADS qutusu transkripsiya faktorunun çoxluğunu aşkar edir. Ağacın Genetik Genomları 4:495–507

Bodenes C, Chancerel E, Gailing O, Vendramin GG, Bagnoli F, Durand J, Goicoechea PG, Soliani C, Villani F, Mattioni C, Koelewijn H, Murat F, Salse J, Roussel G, Boury C, Alberto F, Kremer A , Plomion C (2012) Fagaceae və ondan kənarda EST-SSRs ilə müqayisəli xəritəçəkmə. BMC Bitki Biol 12:153

Bodénès C, Chancerel E, Ehrenmann F, Kremer A, Plomion C (2016) Palıd genomunda seqreqasiya təhrif bölgələrinin yüksək sıxlıqlı əlaqə xəritəsi və paylanması. DNT Res 23:115-124

geniş institut geniş institut/picard. In: GitHub. https://github.com/broadinstitute/picard. 19 dekabr 2019-cu ildə əldə edilib

Cahill DM, McComb JA (1992) Köklərdə fenilalanin ammonyak-liaz aktivliyində, liqnində və fenolik sintezdə dəyişikliklərin müqayisəsi. Eucalyptus calophylla (sahəyə davamlı) və E. marginata (həssas) ilə yoluxduqda Phytophthora cinnamomi. Physiol Mol Plant Pathol 40:315–332

Camacho C, Coulouris G, Avagyan V, Ma N, Papadopulos J, Bealer K, Madden TL (2009) BLAST+: memarlıq və tətbiqlər. BMC Bioinformatika 10:421

Campoy JA, Ruiz D, Egea J, Rees DJG, Celton JM, Martínez-Gómez P (2011) Ərikdə çiçəkləmə vaxtının irsiyyəti (Prunus armeniaca L.) və sadə ardıcıllığın təkrarı (SSR) markerlərindən istifadə etməklə əlaqəli kəmiyyət əlamətlərin yerlərinin (QTL) təhlili. Bitki Mol Biol Hesabatı 29:404–410

Casasoli M, Derory J, Morera-Dutrey C, Brendel O, Porth I, Guehl JM, Villani F, Kremer A (2006) Palıd və şabalıd arasında uyğunlaşma əlamətləri üçün kəmiyyət əlamət lokuslarının ifadə edilmiş ardıcıllıq etiketi konsensus xəritəsi əsasında müqayisəsi. Genetika 172:533–546

Xarakteristikası TFPCFGG, Üzüm Genomunun Xarakteristikası üzrə Fransız-İtaliya İctimai Konsorsiumu (2007) Üzüm genomunun ardıcıllığı əsas angiosperm filasında əcdadların hexaploidizasiyasını təklif edir. Təbiət 449:463–467

Clarke JD (2009) Bitki DNT izolyasiyası üçün Setiltrimetil ammonium bromid (CTAB) DNT miniprep. Cold Spring Harb Protoc 2009: db.prot5177

Cooke JEK, Eriksson ME, Junttila O (2012) Ağaclarda qönçələrin yuxusuzluğunun dinamik təbiəti: ətraf mühitə nəzarət və molekulyar mexanizmlər. Bitki Hüceyrəsinin Ətrafı 35:1707–1728

Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo MA, Handsaker RE, Lunter G, Marth GT, Sherry ST, McVean G, Durbin R, 1000 Genomes Project Analysis Group (2011) Variant zəng formatı və VCFtools . Bioinformatika 27:2156–2158

Delgado-Cerrone L, Alvarez A, Mena E, Ponce de León I, Montesano M (2018) Bitki toxunulmazlığını tetikleyen biotik stress siqnalları ilə soya CRK ailəsinin genom miqyasında təhlili və transkripsiya tənzimləməsi. PLoS One 13: e0207438

Derory J, Scotti-Saintagne C, Bertocchi E, le Dantec L, Graignic N, Jauffres A, Casasoli M, Chancerel E, Bodenes C, Alberto F, Kremer A (2010) Namizəd genlərin müxtəlifliyi və qönçə partlayışının dəyişməsi arasında ziddiyyətli əlaqələr Avropa palıdlarının təbii və ayrı-ayrı populyasiyalarında. İrsiyyət 105:401–411

Diskin M, Steiner KC, Hebard FV (2006) Amerika şabalıdı xüsusiyyətlərinin hibridləşmə və ters yetişdirmədən sonra bərpası. Castanea dentata. Ecol Manag 223:439–447 üçün

Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, ​​Chaisson M, Gingeras TR (2013) STAR: ultrafast universal RNT seq aligner. Bioinformatika 29:15–21

Eddy SR (2011) HMM profilinin sürətləndirilmiş axtarışları. PLoS Comput Biol 7:e1002195

Emms DM, Kelly S (2015) OrthoFinder: bütün genom müqayisələrində əsas qərəzlərin həlli ortoqrup nəticə çıxarma dəqiqliyini kəskin şəkildə yaxşılaşdırır. Genom Biol 16:157

Endelman JB, Plomion C (2014) LPmerge: xətti proqramlaşdırma ilə genetik xəritələri birləşdirmək üçün R paketi. Bioinformatika 30:1623–1624

Engelbrecht J, van den Berg N (2013) Beş avokado anaçında Phytophthora cinnamomi-yə qarşı müdafiə ilə əlaqəli genlərin ifadəsi. S Afr J Sci 109:1–8

Fan S, Bielenberg DG, Zhebentyayeva TN, Reighard GL, Okie WR, Holland D, Abbott AG (2010) Şaftalıda soyutma tələbi, istilik tələbi və çiçəkləmə tarixi ilə əlaqəli kəmiyyət əlamətlərin yerlərinin xəritəsi (Prunus persica). Yeni Phytol 185:917–930

Fan S, Georgi L, Hebard FV, et al (2020) Şabalıdda zərərvericilərə qarşı müqavimət və morfoloji və fenoloji əlamətlər üçün QTL-lərin xəritələşdirilməsi (Castanea spp.). (hazırlıqda)

Fang GC, Blackmon BP, Staton ME, Nelson CD, Kubisiak TL, Olukolu BA, Henry D, Jebentyayeva T, Saski CA, Cheng CH, Monsanto M, Ficklin S, Atkins M, Georgi LL, Barakat A, Wheeler N, Carlson JE , Sederoff R, Abbott AG (2013) Çin şabalıdının fiziki xəritəsi (Castanea mollissima) genom və onun genetik xəritə ilə inteqrasiyası. Ağacın Genetik Genomları 9:525–537

Freinkel S (2009) Amerika şabalıdı: mükəmməl bir ağacın həyatı, ölümü və yenidən doğulması. Kaliforniya Universiteti Mətbuat

Gabay G, Dahan Y, Izhaki Y, Faigenboim A, Ben-Ari G, Elkind Y, Flaishman MA (2018) Avropa armudunun yüksək qətnaməli genetik əlaqə xəritəsi (Pyrus communis) və QTL vegetativ qönçələrin qırılma vaxtının dəqiq xəritəsi. BMC Bitki Biol 18:175

Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, Rokhsar DS (2012) Fitozom: yaşıl bitki genomikası üçün müqayisəli platforma. Nuklein turşuları Res 40: D1178–D1186

Gremme G, Brendel V, Sparks ME, Kurtz S (2005) Yüksək orqanizmlərdə gen strukturunun proqnozlaşdırılması üçün proqram aləti mühəndisliyi. Inf Softw Technol 47:965–978

Groover A, Cronk Q (eds) (2017) Anjiosperm ağaclarının müqayisəli və təkamül genomikası. Springer, Cham

Hamann T (2015) Bitki hüceyrə divarının bütövlüyünü qoruyan mexanizm - təşkilat və fəaliyyət rejimi üçün anlayışlar. Bitki Hüceyrəsinin Physiol 56:215–223

Hebard FV (1994) Çin və Amerika şabalıdının xaçlarında yetkinlik yaşına çatmayan yarpaq və gövdə morfoloji əlamətlərinin irsiyyəti. J Hered 85:440–446

Hebard FV (2005) Amerika Şabalıdı Fondunun backcross breeding proqramı. Proc. Amerika Şabalıdının Meşə Torpaqlarına Bərpası Konfransı. Steiner, K.C. və J. E. Carlson (red.)

Hoff KJ, Lange S, Lomsadze A, Borodovsky M, Stanke M (2016) BRAKER1: GeneMark-ET və AUGUSTUS ilə nəzarətsiz RNT-Seq-əsaslı genom annotasiyası. Bioinformatika 32:767–769

Hung C-Y, Aspesi P Jr, Hunter MR et al (2014) Fosfoinositid siqnalı güclü bitki müdafiə reaksiyasının komponentlərindən biridir. Ön Bitki Elmi 5:267

Beynəlxalq Şaftalı Genom Təşəbbüsü, Verde I, Abbott AG et al (2013) Şaftalının yüksək keyfiyyətli qaralama genomu (Prunus persica) genetik müxtəlifliyin, əhliləşdirmənin və genom təkamülünün unikal nümunələrini müəyyən edir. Nat Genet 45:487–494

Islam-Faridi MN, Childs KL, Klein PE, Hodnett G, Menz MA, Klein RR, Rooney WL, Mullet JE, Stelly DM, Price HJ (2002) Sorghum xromosomunun molekulyar sitogenetik xəritəsi 1. Flüoressensiya yerində Xəritəli bakterial süni xromosomlarla hibridləşmə analizi. Genetika 161:345–353

Islam-Faridi MN, Nelson CD, DiFazio SP et al (2009) Sitogenetik analiz Populus trichocarpa--ribosomal DNT, telomer təkrar ardıcıllığı və markerlə seçilmiş BAC-lar. Cytogenet Genome Res 125:74-80

Jewell DC, Islam-Faridi N (1994) Qarğıdalıda somatik xromosomların hazırlanması və C-bandlaşdırılması üçün texnika. Qarğıdalı Təlimatı: 484-493

Jiang H, Lei R, Ding S-W, Zhu S (2014) Skewer: sonrakı nəsil ardıcıllığı üçün cütləşdirilmiş oxunuşlar üçün sürətli və dəqiq adapter trimmer. BMC Bioinformatika 15:182

Jiao W-B, Schneeberger K (2017) Üçüncü nəsil genomik texnologiyaların bitki genomunun yığılmasına təsiri. Curr Opin Plant Biol 36:64–70

Jones P, Binns D, Chang HY, Fraser M, Li W, McAnulla C, McWilliam H, Maslen J, Mitchell A, Nuka G, Pesseat S, Quinn AF, Sangrador-Vegas A, Scheremetjew M, Yong SY, Lopez R, Hunter S (2014) InterProScan 5: genom miqyaslı protein funksiyasının təsnifatı. Bioinformatika 30:1236–1240

Kanehisa M, Sato Y, Morishima K (2016) BlastKOALA və GhostKOALA: Genom və metagenom ardıcıllığının funksional xarakteristikası üçün KEGG alətləri. J Mol Biol 428:726–731

Kang J, Park J, Choi H, Burla B, Kretzschmar T, Lee Y, Martinoia E (2011) Bitki ABC daşıyıcıları. Arabidopsis Kitabı 9: e0153

Kaye Y, Golani Y, Singer Y, Leshem Y, Cohen G, Ercetin M, Gillaspy G, Levine A (2011) İnositol polifosfat 5-fosfataz7 reaktiv oksigen növlərinin istehsalını və duza dözümlülüyünü tənzimləyir. Ərəbidopsis. Bitki Physiol 157:229–241

Korneliussen TS, Albrechtsen A, Nielsen R (2014) ANGSD: növbəti nəsil ardıcıllıq məlumatlarının təhlili. BMC Bioinformatika 15:356

Kremer A, Casasoli M, Barreneche T et al (2007) Fagaceae-də müqayisəli genetik xəritəçəkmə. In: Kole CR (ed) Genom Xəritəçəkmə və Bitkilərdə Molekulyar Yetişdirmə, Cild. 7: Meşə ağacları. Springer, Heidelberg, səh 161-187

Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, Horsman D, Jones SJ, Marra MA (2009) Sirkos: müqayisəli genomika üçün məlumat estetikası. Genom Res 19:1639–1645

Kubisiak TL, Hebard FV, Nelson CD, Zhang J, Bernatzky R, Huang H, Anagnostakis SL, Doudrick RL (1997) Castanea cinsində növlərarası xaçda zərərvericiliyə qarşı müqavimətin molekulyar xəritəsi. Fitopatologiya 87:751–759

Kubisiak TL, Nelson CD, Staton ME, Zhebentyayeva T, Smith C, Olukolu BA, Fang GC, Hebard FV, Anagnostakis S, Wheeler N, Sisco PH, Abbott AG, Sederoff RR (2013) Çin sinəsinin transkriptom əsaslı genetik xəritəsi (Castanea mollissima) və şaftalı (Prunus persica) ilə seqmentar homologiya bölgələrinin müəyyən edilməsi. Ağacın Genetik Genomları 9:557–571

LaBonte NR, Zhao P, Woeste K (2018) Çin şabalıdının genomlarında seçim imzaları (Castanea mollissima Blume): qoz ağacının əhliləşdirilməsinin kökləri. Front Plant Sci 9

Labuschagné IF, Louw JH, Schmidt K, Sadie A (2003) Mülayim qış iqlimlərinə təkmilləşdirilmiş uyğunlaşma üçün seçim meyarı kimi alma fidanlarında qönçələrin qırılması sayı. HortScience 38: 1186-1190

Lamesch P, Berardini TZ, Li D, Swarbreck D, Wilks C, Sasidharan R, Muller R, Dreher K, Alexander DL, Garcia-Hernandez M, Karthikeyan AS, Lee CH, Nelson WD, Ploetz L, Singh S, Wensel A, Huala E (2012) Arabidopsis informasiya resursu (TAIR): təkmilləşdirilmiş gen annotasiyası və yeni alətlər. Nuklein turşuları Res 40: D1202–D1210

Lang P, Dane F, Kubisiak TL, Huang H (2007) Asiya mənşəli və cinsdəki növlərin unikal qərbə miqrasiyası üçün molekulyar sübutlar Castanea Avropa vasitəsilə Şimali Amerikaya. Mol Phylogenet Evol 43:49–59

Lee DS, Kim YC, Kwon SJ, Ryu CM, Park OK (2017) Arabidopsis sisteinlə zəngin reseptor kimi kinaz CRK36 sitoplazmik kinaz BIK1 ilə qarşılıqlı əlaqə vasitəsilə toxunulmazlığı tənzimləyir. Front Plant Sci 8:1856

Li H, Durbin R (2009) Burrows-Wheeler çevrilməsi ilə sürətli və dəqiq qısa oxunuş. Bioinformatika 25:1754–1760

Liu Z, Zhu H, Abbott A (2015) Dormansiya davranışları və əsas tənzimləmə mexanizmləri: epigenetik tənzimləmə yolları baxımından. Bitki yuxusuzluğunda irəliləyişlər 75–105

Luo MC, You FM, Li P, Wang JR, Zhu T, Dandekar AM, Leslie CA, Aradhya M, McGuire PE, Dvorak J (2015) Rosidsdə qozun fiziki xəritəsi ilə sinteniya analizi uzun ömürlü oduncaqlarda yavaş genom təkamülünü ortaya qoyur. çoxilliklər. BMC Genomics 16:707

Madoui M-A, Engelen S, Cruaud C, Belser C, Bertrand L, Alberti A, Lemainque A, Wincker P, Aury JM (2015) Nanopora idarə olunan uzun və səhvsiz DNT oxunuşlarından istifadə edərək genom montajı. BMC Genomics 16:327

McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA (2010) Genom analizi alətlər dəsti: yeni nəsil DNT ardıcıllığının təhlili üçün MapReduce çərçivəsi data. Genom Res 20:1297–1303

Miedes E, Vanholme R, Boerjan W, Molina A (2014) Patogenlərə qarşı bitki müqavimətində ikincil hüceyrə divarının rolu. Front Plant Sci 5:358

Naveed ZA, Huguet-Tapia JC, Ali GS (2019) Carrizo citrange köklərinin transkriptom profilinə cavab olaraq Phytophthora parazitica infeksiya. J Plant Interact 14:187–204

Nielsen R, Korneliussen T, Albrechtsen A, Li Y, Wang J (2012) SNP çağırışı, genotip çağırışı və yeni nəsil sıralama məlumatlarından nümunə allel tezliyinin qiymətləndirilməsi. PLoS One 7: e37558

Olukolu BA, Nelson CD, Abbott AG (2012) Şabalıdda Phytophthora cinnamomi-yə qarşı müqavimətin xəritəsi (Castanea sp.). In: Sniezko, Richard A. Yanchuk, Alvin D. Kliejunas, John T. Palmieri, Katharine M. Alexander, Janice M. Frankel, Susan J., tech. kordlar. Meşə təsərrüfatında ev sahibi-parazit qarşılıqlı təsirlərinin genetikası üzrə dördüncü beynəlxalq seminarın materialları: Meşə ağaclarında xəstəliklər və həşəratlara qarşı müqavimət. General Tech. Rep. PSW-GTR-240. Albany, CA: Sakit okean Cənub-Qərb Araşdırma Stansiyası, Meşə Xidməti, ABŞ Kənd Təsərrüfatı Departamenti. səh. 177. səh 177

Pereira-Lorenzo S, Kosta R, Anagnostakis S, et al (2016) Şabalıdın spesifik hibridləşməsi. Məhsulun yaxşılaşdırılması üçün poliploidiya və hibridləşmə Boca Raton 377-407

Plomion C, Aury JM, Amselem J, Leroy T, Murat F, Duplessis S, Faye S, Francillonne N, Labadie K, le Provost G, Lesur I, Bartholome J, Faivre-Rampant P, Kohler A, Leple JC, Chantret N , Chen J, Diévart A, Alaeitabar T, Barbe V, Belser C, Bergès H, Bodénès C, Bogeat-Triboulot MB, Bouffaud ML, Brachi B, Chancerel E, Cohen D, Couloux A, da Silva C, Dossat C, Ehrenmann F, Gaspin C, Grima-Pettenati J, Guichoux E, Hecker A, Herrmann S, Hugueney P, Hummel I, Klopp C, Lalanne C, Lascoux M, Lasserre E, Lemainque A, Desprez-Loustau ML, Luyten I, Madoui MA , Mangenot S, Marchal C, Maumus F, Mercier J, Michotey C, Panaud O, Picault N, Rouhier N, Rué O, Rustenholz C, Salin F, Soler M, Tarkka M, Velt A, Zanne AE, Martin F, Wincker P, Quesneville H, Kremer A, Salse J (2018) Palıd genomu uzun ömrün tərəflərini ortaya qoyur. Nat Bitkilər 4:440–452

Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MAR, Bender D, Maller J, Sklar P, de Bakker PIW, Daly MJ, Sham PC (2007) PLINK: bütün genom birliyi və populyasiya üçün alət dəsti -əsaslı əlaqə təhlilləri. Am J Hum Genet 81:559–575

Raaymakers TM, Van den Ackerveken G (2016) Bitkilərin biotrofik infeksiyası zamanı Oomisetlərin hüceyrədənkənar tanınması. Front Plant Sci 7:906

Raes J, Rohde A, Christensen JH, van de Peer Y, Boerjan W (2003) Arabidopsisdəki lignification alətlər qutusunun genom xarakteristikası. Bitki Physiol 133:1051–1071

Ramos AM, Usié A, Barbosa P, Barros PM, Capote T, Chaves I, Simões F, Abreu I, Carrasquinho I, Faro C, Guimarães JB, Mendonça D, Nobrega F, Rodrigues L, Saibo NJM, Varela MC, Egas C , Matos J, Miguel CM, Oliveira MM, Ricardo CP, Gonçalves S (2018) Mantar palıdının qaralama genom ardıcıllığı. Sci Data 5: 180069

Ribeiro T, Loureiro J, Santos C, Morais-Cecílio L (2011) Fagaceae-də rDNT FISH nümunələrinin təkamülü. Ağacın Genetik Genomları 7:1113–1122

Robinson SM, Bostock RM (2014) Bitki-oomiset qarşılıqlı təsirlərində MAMP kimi β-qlükanlar və eikosapolien turşuları: keçmiş və indiki. Ön. Bitki Elmi 5:797

Santos C, Nelson CD, Zhebentyayeva T, Machado H, Gomes-Laranjo J, Costa RL (2017) üçün ilk növlərarası genetik əlaqə xəritəsi Castanea sativa x Castanea crenata müqavimət üçün QTL-ləri aşkar etdi Phytophthora cinnamomi. PLoS One 12: e0184381

Scotti-Saintagne C, Bodénès C, Barreneche T et al (2004) Qönçələrin partlamasına və hündürlüyünə nəzarət edən kəmiyyət əlamət lokuslarının aşkarlanması Quercus robur L. Theor Appl Genet 109:1648–1659

Serrazina S, Santos C, Machado H, Pesquita C, Vicentini R, Pais MS, Sebastiana M, Costa R (2015) Castanea kök transkriptomuna cavab olaraq Phytophthora cinnamomi çağırış. Ağac genomları 11

Shi R, Sun Y-H, Li Q, Heber S, Sederoff R, Chiang VL (2010) Liqnin biosintezi üçün sistem yanaşmasına doğru Populus trichocarpa: monolignol biosintetik genlərinin transkript bolluğu və spesifikliyi. Bitki Hüceyrəsinin Fiziol 51:144–163

Shim D, Ko J-H, Kim W-C, Wang Q, Keathley DE, Han KH (2014) Çoxillik bitkilərdə mövsümi böyümə-yuxusuzluğun tənzimlənməsi üçün molekulyar çərçivə. Hortic Res 1:14059

Simão FA, Waterhouse RM, Ioannidis P, Kriventseva EV, Zdobnov EM (2015) BUSCO: tək nüsxə ortoloqları ilə genom birləşməsinin və annotasiya tamlığının qiymətləndirilməsi. Bioinformatika 31:3210–3212

Smit AFA, Hubley R, Green P (2015) RepeatMasker Open-4.0. 2013--2015

Solovyev V (2004) Eukaryotik genlərin proqnozlaşdırılmasında statistik yanaşmalar. Statistik Genetika Təlimatı

Staton M, Zhebentyayeva T, Olukolu B, Fang GC, Nelson D, Carlson JE, Abbott AG (2015) Ağaclı angiosperm növləri arasında əhəmiyyətli genom sinteninin qorunması: Çin şabalıdının müqayisəli genomikası (Castanea mollissima) və bitki istinad genomları. BMC Genomics 16:744

Steiner KC, Westbrook JW, Hebard FV, Georgi LL, Powell WA, Fitzsimmons SF (2017) Amerika şabalıdının təbiiləşdirilmiş patogen tərəfindən məhv edilməsindən sonra ekstraspesifik genlərlə xilas edilməsi. 48:317–336 üçün yeni

Tajima F (1989) Neytral mutasiya fərziyyəsini DNT polimorfizmi ilə yoxlamaq üçün statistik üsul. Genetika 123:585–595

Tauzin AS, Giardina T (2014) Saxaroza və invertazlar, bitkilərin biotik streslərə qarşı müdafiə reaksiyasının bir hissəsidir. Ön Bitki Elmi 5:293

Teixeira MA, Rajewski A, He J, Castaneda OG, Litt A, Kaloshian I (2018) Təsnifat və filogenetik analizlər Ərəbidopsis və pomidor G tipli lektin reseptor kinazları. BMC Genomics 19:239

Tennessen JA, Madeoy J, Akey JM (2010) İnsan ekzomlarının kiçik bir nümunəsində aydın olan müsbət seçim imzaları. Genom Res 20:1327–1334

Toljamo A, Blande D, Kärenlampi S, Kokko H (2016) Çiyələyin yenidən proqramlaşdırılması (Fragaria vesca) kök transkriptomuna cavab olaraq Phytophthora cactorum. PLoS One 11: e0161078

Tuskan GA, Difazio S, Jansson S et al (2006) Qara pambıq ağacının genomu, Populus trichocarpa (Torr və boz). Elm 313:1596–1604

Tuskan GA, Groover AT, Schmutz J, DiFazio SP, Myburg A, Grattapaglia D, Smart LB, Yin T, Aury JM, Kremer A, Leroy T, le Provost G, Plomion C, Carlson JE, Randall J, Westbrook J, Grimwood J, Muchero W, Jacobson D, Michener JK (2018) Hardwood ağacı genomikası: odunlu bitki biologiyasının kilidini açmaq. Front Plant Sci 9:1799

Vaattovaara A, Brandt B, Rajaraman S, Safronov O, Veidenberg A, Luklová M, Kangasjärvi J, Löytynoja A, Hothorn M, Salojärvi J, Wrzaczek M (2019) DUF26 tərkibli bitkilərdəki zülalların təkamülünə dair mexaniki fikirlər. Commun Biol 2:56

van den Berg N, Christie JB, Aveling TAS, Engelbrecht J (2018) Kalloza və β-1,3-qlükanazı inhibə edir Phytophthora cinnamomi davamlı avokado anaçında. Plant Pathol 67:1150–1160

Veillet F, Gaillard C, Coutos-Thévenot P, La Camera S (2016) Köklərdə və Botrytis cinerea infeksiyası zamanı saxaroza daşınmasında invertazların rolunu araşdırmaq üçün AtCWIN1 geninin hədəflənməsi. Front Plant Sci 7

Verde I, Jenkins J, Dondini L, et al (2017) Şaftalı v2.0 buraxılışı: yüksək keyfiyyətli əlaqə xəritəsi və dərin təkrar ardıcıllıq xromosom miqyaslı birləşməni və bitişikliyi yaxşılaşdırır. BMC Genomics 18

Westbrook JW, Zhang Q, Mandal MK, et al (2019) Genomik seçim təhlilləri şabalıd zərərvericilərinə qarşı dözümlülük və Amerika şabalıdından genom irsi arasında uzlaşma aşkar edir.Castanea dentata) içində (C. dentatax Prunus) x C. dentata əks populyasiyalar

Wilkinson L (2011) ggplot2: WICKHAM, H. Biometrics 67:678–679 tərəfindən məlumatların təhlili üçün zərif qrafika

Williams SP, Gillaspy GE, Perera IY (2015) Bitkilərdə inositol pirofosfatların biosintezi və mümkün funksiyaları. Ön Bitki Elmi 6:67

Xing Y, Liu Y, Zhang Q, Nie X, Sun Y, Zhang Z, Li H, Fang K, Wang G, Huang H, Bisseling T, Cao Q, Qin L (2019) Çin şabalıdının hibrid de novo genom toplusu (Castanea mollissima). Gigascience 8. https://doi.org/10.1093/gigascience/giz112

Zentmyer GA (1988) Phytophthora-nın dörd növünün mənşəyi və yayılması. Trans Br Mycol Soc 91:367–378

Zhebentyayeva T, Chandra A, Abbott AG, et al (2012) Müqavimətin xəritələşdirilməsi üçün genetik və genomik resurslar Phytophthora cinnamomi şabalıdda. In: V Beynəlxalq Şabalıd Simpoziumu 1019. s. 263-270

Zhebentyayeva TN, Sisco PH, Georgi LL, Jeffers SN, Perkins MT, James JB, Hebard FV, Saski C, Nelson CD, Abbott AG (2019) Dissecting müqavimət Phytophthora cinnamomi ardıcıllığa əsaslanan genotipləmə və QTL xəritəsindən istifadə edərək növlərarası hibrid şabalıd xaçlarında. Fitopatologiya 109:1594–1604


Hər növ xəritədə olduğu kimi, genetik xəritə də fərqli xüsusiyyətlərin mövqelərini göstərməlidir. Coğrafi xəritədə bu markerlər çaylar, yollar və binalar kimi landşaftın tanınan komponentləridir. Genetik mənzərədə hansı markerlərdən istifadə edə bilərik?

5.2.1. Genlər istifadə edilən ilk markerlər idi

20-ci əsrin əvvəllərində meyvə milçəyi kimi orqanizmlər üçün qurulan ilk genetik xəritələrdə marker kimi genlərdən istifadə edilirdi. Bu, genlərin DNT molekullarının seqmentləri olduğu başa düşülməzdən çox illər əvvəl idi. Bunun əvəzinə genlərə irsi xüsusiyyətlərin valideyndən nəslə ötürülməsindən məsul olan mücərrəd varlıqlar kimi baxılırdı. Genetik analizdə faydalı olmaq üçün irsi xüsusiyyət ən azı iki alternativ formada və ya fenotipdə mövcud olmalıdır, nümunə ilk olaraq Mendel tərəfindən tədqiq edilən noxud bitkilərində hündür və ya qısa gövdələrdir. Hər bir fenotip müvafiq genin fərqli bir alleli ilə müəyyən edilir. Başlamaq üçün, öyrənilə bilən yeganə genlər vizual müayinə ilə fərqlənən fenotipləri təyin edənlər idi. Beləliklə, məsələn, ilk meyvə milçəyi xəritələri bədən rəngi, göz rəngi, qanad forması və buna bənzər genlərin mövqelərini göstərirdi ki, bütün bu fenotiplər sadəcə milçəklərə aşağı güclü mikroskopla və ya çılpaq gözlə baxmaqla görünürdü. . İlk günlərdə bu yanaşma yaxşı idi, lakin genetiklər tezliklə anladılar ki, mirasları öyrənilə bilən məhdud sayda vizual fenotiplər var və bir çox hallarda onların təhlili çətinləşdi, çünki bir fenotip birdən çox gendən təsirlənə bilər. Məsələn, 1922-ci ilə qədər 50-dən çox gen meyvə milçəklərinin dörd xromosomuna uyğunlaşdırıldı, lakin sonrakı araşdırmalarda bunlardan doqquzu göz rəngi üçün idi, meyvə milçəklərini araşdıran genetiklər qırmızı və açıq qırmızı rəngli milçək gözlərini ayırd etməyi öyrənməli idilər. , qırmızı, qranat, qərənfil, cinnabar, yaqut, sepiya, qırmızı, çəhrayı, kardinal, bordo, bənövşəyi və ya qəhvəyi. Gen xəritələrini daha əhatəli etmək üçün vizual olanlardan daha fərqli və daha az mürəkkəb olan xüsusiyyətləri tapmaq lazımdır.

Cavab fenotipləri ayırd etmək üçün biokimyadan istifadə etmək idi. Bu, iki növ orqanizm üçün xüsusilə vacib olmuşdur - mikroblar və insanlar. Bakteriya və maya kimi mikroblar çox az vizual xüsusiyyətlərə malikdirlər, ona görə də bu orqanizmlərlə gen xəritəsi Cədvəl 5.1-də sadalananlar kimi biokimyəvi fenotiplərə əsaslanmalıdır. İnsanlarda vizual xüsusiyyətlərdən istifadə etmək mümkündür, lakin 1920-ci illərdən bəri insanın genetik dəyişkənliyi ilə bağlı tədqiqatlar əsasən qan tiplənməsi ilə qiymətləndirilə bilən biokimyəvi fenotiplərə əsaslanır. Bu fenotiplərə yalnız ABO seriyası (Yamamoto və b., 1990), həm də qan serum zülallarının və insan leykosit antigenləri (HLA sistemi) kimi immunoloji zülalların variantları. Bu markerlərin böyük üstünlüyü ondan ibarətdir ki, müvafiq genlərin çoxunda çoxsaylı allellər var. Məsələn, gen adlanır HLA-DRB1 ən azı 290 allele malikdir və HLA-B 400-dən artıqdır. Bu, insanlarla gen xəritəsinin aparılması üsulu ilə əlaqədardır (Bölmə 5.2.4). Meyvə milçəkləri və ya siçanlar kimi eksperimental orqanizmlərlə prosedur olan bir çox yetişdirmə təcrübələri qurmaq əvəzinə, insan genlərinin irsiyyətinə dair məlumatlar tək bir ailənin üzvləri tərəfindən nümayiş etdirilən fenotipləri araşdıraraq əldə edilməlidir. Əgər bütün ailə üzvləri tədqiq olunan gen üçün eyni allele malikdirsə, onda heç bir faydalı məlumat əldə edilə bilməz. Buna görə də müvafiq nikahların təsadüfən, fərqli allellərə malik olan fərdlər arasında baş verməsi zəruridir. Tədqiq olunan genin iki alleli deyil, 290 olması bu ehtimal daha yüksəkdir.

Cədvəl 5.1

Genetik analiz üçün istifadə olunan tipik biokimyəvi markerlər Saccharomyces cerevisiae.

5.2.2. Genetik xəritə üçün DNT markerləri

Genlər çox faydalı markerlərdir, lakin heç də ideal deyillər. Xüsusilə onurğalılar və çiçəkli bitkilər kimi daha böyük genomlarla bağlı problemlərdən biri, tamamilə genlərə əsaslanan xəritənin çox detallı olmamasıdır. Bu, hətta hər genin xəritələşdirilməsi mümkün olsa belə doğru olardı, çünki 2-ci Fəsildə gördüyümüz kimi, əksər eukaryotik genomlarda genlər aralarında böyük boşluqlarla geniş şəkildə yerləşdirilir (bax Şəkil 2.2). Problem genlərin ümumi sayının yalnız bir hissəsinin rahat şəkildə fərqləndirilə bilən allel formalarda olması faktı ilə daha da pisləşir. Buna görə gen xəritələri çox əhatəli deyil. Bizə başqa növ marker lazımdır.

Gen olmayan xəritələnmiş xüsusiyyətlərə DNT markerləri deyilir. Gen markerlərində olduğu kimi, DNT markerinin də faydalı olması üçün ən azı iki alleli olmalıdır. Bu tələbi ödəyən üç növ DNT ardıcıllığı xüsusiyyəti vardır: məhdudlaşdırma fraqment uzunluğu polimorfizmləri (RFLP), sadə ardıcıllıq uzunluğu polimorfizmləri (SSLPs) və tək nukleotid polimorfizmləri (SNP).

Məhdudiyyət fraqment uzunluğu polimorfizmləri (RFLPs)

RFLP-lər tədqiq edilən ilk DNT marker növü idi. Xatırladaq ki, məhdudlaşdırıcı fermentlər DNT molekullarını xüsusi tanınma ardıcıllığında kəsirlər (Bölmə 4.1.2). Bu ardıcıllığın spesifikliyi o deməkdir ki, bir DNT molekulunun məhdudlaşdırıcı fermentlə müalicəsi həmişə eyni fraqmentlər dəsti çıxarmalıdır. Bu, genomik DNT molekullarında həmişə belə olmur, çünki bəzi məhdudlaşdırma yerləri polimorfdur, iki allel kimi mövcuddur, bir allel məhdudlaşdırma yeri üçün düzgün ardıcıllığı göstərir və buna görə də DNT fermentlə müalicə edildikdə kəsilir və ikinci allel məhdudiyyət sahəsi artıq tanınmaması üçün ardıcıl dəyişiklik. Ardıcıllığın dəyişməsinin nəticəsi ondan ibarətdir ki, iki bitişik məhdudlaşdırma fraqmenti fermentlə müalicədən sonra bir-birinə bağlı qalır və uzunluq polimorfizminə gətirib çıxarır (Şəkil 5.4). Bu, bir RFLP-dir və genom xəritəsindəki mövqeyi, genlər marker kimi istifadə edildikdə olduğu kimi, allellərinin irsiyyətinə əməl etməklə işlənib hazırlana bilər. İnsan genomunda təxminən 10 5 RFLP olduğu düşünülür, lakin əlbəttə ki, hər bir RFLP üçün yalnız iki allel ola bilər (yeri olan və olmayan). Buna görə də insan geninin xəritələşdirilməsində RFLP-lərin dəyəri öyrənilən RFLP-nin maraqlı ailənin üzvləri arasında heç bir dəyişkənlik göstərməməsi ehtimalının yüksək olması ilə məhdudlaşır.

Şəkil 5.4

Məhdudiyyət fraqmentinin uzunluğu polimorfizmi (RFLP). Sol tərəfdəki DNT molekulunun sağdakı molekulda olmayan polimorfik məhdudlaşdırma yeri (ulduz işarəsi ilə işarələnmiş) var. RFLP məhdudlaşdırıcı ferment ilə müalicədən sonra aşkar edilir (daha çox. )

RFLP-ni qiymətləndirmək üçün bir çox uyğun olmayan fraqmentlərin fonunda yalnız bir və ya iki fərdi məhdudlaşdırıcı fraqmentin ölçüsünü müəyyən etmək lazımdır. Bu əhəmiyyətsiz bir problem deyil: kimi bir ferment Eko6-bp tanınma ardıcıllığı ilə RI, təxminən hər 4 6 = 4096 bp-də bir dəfə kəsilməlidir və insan DNT-si ilə istifadə edildikdə, demək olar ki, 800 000 fraqment verəcəkdir. Agaroz gel elektroforezi ilə ayrıldıqdan sonra (bax. Texniki Qeyd 2.1), bu 800 000 fraqment yaxma əmələ gətirir və RFLP-ni ayırd etmək olmur. Polimorfik məhdudiyyət sahəsini əhatə edən bir zonddan istifadə edərək cənub hibridizasiyası RFLP-nin vizuallaşdırılmasının bir yolunu təmin edir (Şəkil 5.5A), lakin indiki vaxtda PCR daha tez-tez istifadə olunur. PCR üçün primerlər polimorfik sahənin hər iki tərəfini birləşdirəcək şəkildə dizayn edilmişdir və RFLP gücləndirilmiş fraqmenti məhdudlaşdırıcı fermentlə müalicə etməklə və sonra nümunəni agaroza geldə işlətməklə yığılır (Şəkil 5.5B).

Şəkil 5.5

RFLP-ni qiymətləndirmək üçün iki üsul. (A) RFLP-lər Cənubi hibridləşdirmə ilə qiymətləndirilə bilər. DNT müvafiq məhdudlaşdırıcı fermentlə həzm olunur və agaroza geldə ayrılır. Məhdudiyyət fraqmentlərinin yaxması neylon membrana köçürülür və (daha çox. )

Sadə ardıcıllıq uzunluğu polimorfizmləri (SSLPs)

SSLP-lər uzunluq variasiyalarını, müxtəlif sayda təkrar vahidləri ehtiva edən müxtəlif allelləri göstərən təkrar ardıcıllıq massivləridir (Şəkil 5.6A). RFLP-lərdən fərqli olaraq, SSLP-lər çoxalel ola bilər, çünki hər bir SSLP-nin bir sıra müxtəlif uzunluq variantları ola bilər. SSLP-nin iki növü vardır, hər ikisi Bölmə 2.4.1-də təsvir edilmişdir:

Şəkil 5.6

SSLP-lər və onların necə yazıldığı. (A) Mikrosatellit SSLP-nin iki alleli. 1-ci alleldə ‘GA’ motivi üç dəfə, 2-ci alleldə isə beş dəfə təkrarlanır. (B) SSLP-nin PCR ilə necə yazıla biləcəyi. SSLP-ni əhatə edən bölgə (daha çox. )

Mikropeyklər iki səbəbə görə DNT markerləri kimi minipeyklərdən daha populyardır. Birincisi, mini peyklər genom ətrafında bərabər yayılmır, lakin xromosomların uclarında telomerik bölgələrdə daha tez-tez rast gəlinir. Coğrafi baxımdan bu, adanın ortasında yol tapmaq üçün mayakların xəritəsindən istifadə etməyə çalışmaqla bərabərdir. Mikropeyklər bütün genomda daha rahat yerləşdirilib. İkincisi, uzunluqlu polimorfizmi yazmağın ən sürətli yolu PCR-dir (Şəkil 5.6B), lakin uzunluğu 300 bp-dən az olan ardıcıllıqla PZR ilə yazmaq daha sürətli və daha dəqiqdir. Əksər minipeyk allelləri bundan daha uzundur, çünki təkrar vahidlər nisbətən böyükdür və onların bir çoxu bir massivdə olur, ona görə də onları yazmaq üçün bir neçə kb-lik PCR məhsulları lazımdır. Tipik mikropeyklər adətən uzunluğu 4 bp-dən çox olmayan təkrarın 10 nüsxəsindən ibarətdir və buna görə də PCR ilə analiz üçün daha əlverişlidir. İnsan genomunda 6,5 ​​× 10 5 mikropeyk var (Cədvəl 1.3-ə baxın).

Tək nukleotid polimorfizmləri (SNP)

Bunlar, bəzi fərdlərin bir nukleotidinə (məsələn, G), digərlərinin isə fərqli bir nukleotidin (məsələn, a C) malik olduğu genomdakı mövqelərdir (Şəkil 5.7). Hər bir genomda çoxlu sayda SNP var, onlardan bəziləri RFLP-lərə də səbəb olur, lakin bir çoxu deyil, çünki onların yerləşdiyi ardıcıllıq heç bir məhdudlaşdırıcı ferment tərəfindən tanınmır. İnsan genomunda ən azı 1,42 milyon SNP var, onlardan yalnız 100 000-i RFLP ilə nəticələnir (SNP Group, 2001).

Şəkil 5.7

Tək nukleotid polimorfizmi (SNP).

Baxmayaraq ki, hər bir SNP potensial olaraq dörd allele malik ola bilər (çünki dörd nukleotid var), əksəriyyəti yalnız iki formada mövcuddur, buna görə də bu markerlər insan genetik xəritələşdirilməsi ilə bağlı RFLP-lərlə eyni çatışmazlıqdan əziyyət çəkir: SNP-nin olması ehtimalı yüksəkdir. öyrənilən ailədə heç bir dəyişkənlik göstərmir. SNP-lərin üstünlükləri onların çoxlu sayda olması və gel elektroforezini ehtiva etməyən üsullarla yazıla bilməsidir. Bu vacibdir, çünki gel elektroforezinin avtomatlaşdırılması çətin olduğu üçün ondan istifadə edən hər hansı aşkarlama metodu nisbətən yavaş və əmək tutumlu olacaqdır. SNP aşkarlanması daha sürətli olur, çünki oliqonukleotid hibridləşmə analizinə əsaslanır. Oliqonukleotid, test borusunda sintez edilən, adətən uzunluğu 50 nukleotiddən az olan, qısa bir zəncirli DNT molekuludur. Şərtlər tam uyğun olarsa, oliqonukleotid başqa bir DNT molekulu ilə hibridləşəcək, o zaman oliqonukleotid ikinci molekulla tamamilə əsas qoşalaşmış bir quruluş meydana gətirərsə. Tək uyğunsuzluq varsa - oliqonukleotid daxilində baza cütü yaratmayan tək mövqe varsa, hibridləşmə baş vermir (Şəkil 5.8). Oliqonukleotid hibridləşməsi buna görə də bir SNP-nin iki alleli arasında fərq yarada bilər. Müxtəlif skrininq strategiyaları hazırlanmışdır (Mir və Southern, 2000), o cümlədən DNT çip texnologiyası (Texniki Qeyd 5.1) və məhlulların hibridləşdirilməsi üsulları.

Şəkil 5.8

Oliqonukleotid hibridləşməsi çox spesifikdir. Çox sərt hibridləşmə şəraitində, sabit hibrid yalnız oliqonukleotid hədəf DNT ilə tamamilə əsas cütləşmiş struktur yarada bildiyi halda baş verir. Tək uyğunsuzluq varsa, (daha çox.)

Haşiyə 5.1

DNT mikroarrayları və çipləri. Paralel hibridləşmə analizləri üçün DNT molekullarının yüksək sıxlıqlı massivləri. DNT mikroarrayları və çipləri paralel olaraq bir çox hibridləşmə təcrübələrini həyata keçirmək üçün nəzərdə tutulmuşdur. Onların əsas tətbiqləri skrininqdə olub (daha çox. )

Şəkil 5.9

Məhlul hibridləşməsi ilə SNP-nin aşkarlanmasının bir yolu. Oliqonukleotid zondunun iki son etiketi var. Bunlardan biri flüoresan boya, digəri isə söndürmə birləşməsidir. Oliqonukleotid əsasının iki ucu bir-birinə cütləşir, buna görə də flüoresan (daha çox)

Haşiyə 5.1

Niyə SNP-lərin yalnız iki alleli var? Dörd nukleotiddən hər hansı biri genomda hər hansı bir mövqedə ola bilər, buna görə də hər bir nukleotid polimorfizminin (SNP) dörd allelinin olması lazım olduğunu təsəvvür etmək olar. Nəzəri olaraq bu mümkündür, lakin praktikada (daha çox.)

5.2.3. Bağlantı təhlili genetik xəritələşdirmənin əsasını təşkil edir

İndi biz genetik xəritə yaratmaq üçün bir sıra markerlər topladıqdan sonra xəritəçəkmə üsullarının özlərinə baxmağa davam edə bilərik. Bu üsulların hamısı genetik əlaqəyə əsaslanır ki, bu da öz növbəsində 19-cu əsrin ortalarında Qreqor Mendel tərəfindən genetikadakı əsas kəşflərdən irəli gəlir.

Varislik prinsipləri və əlaqənin kəşfi

Genetik xəritələşdirmə ilk dəfə 1865-ci ildə Qreqor Mendel tərəfindən təsvir edilən irsiyyət prinsiplərinə əsaslanır (Orel, 1995). Mendel noxudla apardığı seleksiya təcrübələrinin nəticələrindən belə nəticəyə gəldi ki, hər noxud bitkisi hər gen üçün iki allele malikdir, lakin yalnız bir fenotip göstərir. Bitkinin müəyyən bir xüsusiyyətə görə saf damazlıq və ya homozigot olub olmadığını başa düşmək asandır, çünki o, iki eyni allele malikdir və müvafiq fenotipi göstərir (Şəkil 5.10A). Bununla belə, Mendel göstərdi ki, fərqli fenotiplərə malik iki təmiz damazlıq bitki keçərsə, bütün nəsillər (F1 nəsil) eyni fenotipi göstərir. Bunlar F1 bitkilər heterozigot olmalıdır, yəni hər bir fenotip üçün bir, anadan və atadan miras qalmış iki fərqli allele sahibdirlər. Mendel, bu heterozigot vəziyyətdə bir allelin digər allelin təsirini üstələdiyini irəli sürdü, buna görə də F-də ifadə olunan fenotipi təsvir etdi.1 ikinci, resessiv fenotip üzərində dominant olan bitkilər (Şəkil 5.10B). Bu, Mendelin tədqiq etdiyi allel cütləri arasındakı qarşılıqlı əlaqənin mükəmməl düzgün təfsiridir, lakin biz indi başa düşürük ki, bu sadə dominant-resessiv qayda onun qarşılaşmadığı vəziyyətlərlə çətinləşə bilər. Bunlardan biri natamam dominantlıqdır, burada heterozigot fenotip iki homozigot forma arasında aralıqdır. Məsələn, qırmızı qərənfillər ağ olanlarla çarpazlaşdıqda, F1 heterozigotlar çəhrayı olur. Digər bir komplikasiya, hər iki allelin heterozigotda aşkar edildiyi zaman kodominantlıqdır. Kodominans DNT markerləri üçün tipik vəziyyətdir.

Şəkil 5.10

Homoziqotluq və heterozigotluq. Mendel noxud bitkilərində yeddi cüt təzadlı xüsusiyyətləri tədqiq etdi, onlardan biri bənövşəyi və ağ çiçək rəngi idi, burada göstərildiyi kimi. (A) Saf damazlıq bitkilər həmişə ana rəngi olan çiçəklər verir. (daha çox.)

Dominantlıq və resessivliyi kəşf etməklə yanaşı, Mendel ona iki Genetika Qanunu yaratmağa imkan verən əlavə xaçlar həyata keçirdi. Birinci Qanunda belə deyilir allellər təsadüfi olaraq ayrılır. Başqa sözlə, əgər valideynin allelləri varsa Aa, sonra F-nin üzvü1 nəslin varislik şansı eynidir A irsiyyətə malik olduğu kimi a (Şəkil 5.11A). İkinci Qanun budur allel cütləri müstəqil şəkildə ayrılır, belə ki, A geninin allellərinin irsiyyəti B geninin allellərinin irsiyyətindən asılı deyildir (Şəkil 5.11B). Bu qanunlara görə, genetik xaçların nəticələri proqnozlaşdırıla bilər (Şəkil 5.11C).

Şəkil 5.11

Mendel qanunları genetik xaçların nəticəsini proqnozlaşdırmağa imkan verir. (A) Mendelin Birinci Qanununda deyilir ki, allellər təsadüfi olaraq ayrılır. Nümunə allellərin miras qalmasını göstərir Aa iki heterozigot valideynlərin iştirak etdiyi xaçda. F-nin hər bir üzvü1 nəsil (daha çox)

Mendelin işi 1900-cü ildə yenidən kəşf edildikdə, onun İkinci Qanunu erkən genetikləri narahat etdi, çünki tezliklə genlərin xromosomlarda yerləşdiyi müəyyən edildi və bütün orqanizmlərin xromosomlardan daha çox genə malik olduğu başa düşüldü. Xromosomlar bütöv vahidlər kimi miras alınır, ona görə də belə əsaslandırılmışdır ki, bəzi cüt genlərin allelləri eyni xromosomda olduqları üçün birlikdə miras alınacaq (Şəkil 5.12). Bu, genetik əlaqə prinsipidir və nəticələr gözlənildiyi kimi olmasa da, tez bir zamanda düzgün olduğu göstərildi. Bir çox gen cütləri arasında gözlənilən tam əlaqə reallaşa bilmədi. Cüt genlər müxtəlif xromosomlardakı genlər üçün gözlənildiyi kimi ya müstəqil şəkildə miras qalmışdılar, ya da əgər onlar əlaqə göstərmişlərsə, bu, yalnız qismən əlaqə idi: bəzən birlikdə miras qalmış, bəzən də yox idi (Şəkil 5.13). Nəzəriyyə ilə müşahidə arasındakı bu ziddiyyətin həlli genetik xəritəçəkmə üsullarının inkişafında mühüm addım idi.

Şəkil 5.12

Eyni xromosomdakı genlər əlaqə göstərməlidir. A və B genləri eyni xromosomdadır və buna görə də birlikdə miras alınmalıdır. Buna görə də Mendelin İkinci Qanunu A və B-nin mirasına şamil edilməməlidir, lakin A və C-nin mirasına aiddir, (daha çox. )

Şəkil 5.13

Qismən əlaqə. Qismən əlaqə 20-ci əsrin əvvəllərində aşkar edilmişdir. Burada göstərilən xaç 1905-ci ildə Bateson, Saunders və Punnett tərəfindən şirin noxud ilə həyata keçirilmişdir. Valideyn çarpazı tipik dihibrid nəticə verir (bax Şəkil 5.11C), hamısı ilə (daha çox. )

Qismən əlaqə meioz zamanı xromosomların davranışı ilə izah olunur

Kritik irəliləyiş, hüceyrənin nüvəsi bölünən zaman xromosomların qismən əlaqəsi və davranışı arasında konseptual sıçrayış edən Tomas Hunt Morqan tərəfindən əldə edildi. 19-cu əsrin sonlarında sitoloqlar nüvə bölünməsinin iki növünü ayırd etdilər: mitoz və meioz. Mitoz daha çox yayılmışdır, somatik hüceyrənin diploid nüvəsinin bölünərək hər ikisi diploid olan iki qız nüvəsinin əmələ gəlməsi prosesidir (Şəkil 5.14). İnsan həyatı boyu lazım olan bütün hüceyrələri istehsal etmək üçün təxminən 10 17 mitoz lazımdır. Mitoz başlamazdan əvvəl nüvədəki hər bir xromosom təkrarlanır, lakin nəticədə yaranan qız xromosomları dərhal bir-birindən ayrılmır. Əvvəlcə onlar sentromerlərində və replikasiya olunmuş xromosomların qollarını birləşdirən molekulyar yapışqan rolunu oynayan kohezin zülalları ilə bağlı qalırlar (bax Şəkil 13.23). Qızlar xromosomlar iki yeni nüvə arasında paylanana qədər mitozda ayrılmırlar. Aydındır ki, yeni nüvələrin hər birinin tam xromosom dəstini alması vacibdir və mitozun incəliklərinin əksəriyyəti bu məqsədə çatmağa həsr edilmişdir.

Şəkil 5.14

Mitoz. İnterfaza zamanı (nüvə bölünmələri arasındakı dövr) xromosomlar uzadılmış formada olurlar (Bölmə 2.2.1). Mitozun başlanğıcında xromosomlar kondensasiya olunur və gec profilaktika mərhələsində işıqla görünən strukturlar əmələ gəlir (daha çox).

Mitoz nüvə bölünməsi zamanı baş verən əsas hadisələri təsvir edir, lakin genetik xəritəçəkmə ilə birbaşa əlaqəli deyil. Bunun əvəzinə bizi maraqlandıran meiozun fərqli xüsusiyyətləridir. Meyoz yalnız reproduktiv hüceyrələrdə baş verir və diploid hüceyrə dörd haploid gametə səbəb olur ki, onların hər biri cinsi çoxalma zamanı əks cinsdən olan bir gametlə birləşə bilər. Meyozun dörd haploid hüceyrə ilə nəticələnməsi, mitozun isə iki diploid hüceyrəyə səbəb olması faktını izah etmək asandır: meioz bir-birinin ardınca iki nüvə bölünməsini əhatə edir, mitoz isə yalnız bir nüvə bölünməsidir. Bu vacib bir fərqdir, lakin mitoz və meioz arasındakı kritik fərq daha incədir. Xatırladaq ki, diploid hüceyrədə hər bir xromosomun iki ayrı nüsxəsi var (Fəsil 1). Biz bunları homoloji xromosom cütləri adlandırırıq. Mitoz zamanı homolog xromosomlar bir-birindən ayrı qalır, cütlüyün hər bir üzvü homoloqundan asılı olmayaraq çoxalır və qız nüvəsinə keçir. Meyozda isə homoloji xromosom cütləri heç bir halda müstəqil deyillər. I meyoz zamanı hər bir xromosom öz homoloqu ilə düzülərək bivalent əmələ gətirir (Şəkil 5.15). Bu, hər bir xromosom replikasiya edildikdən sonra, lakin təkrarlanan strukturlar parçalanmadan əvvəl baş verir, buna görə də bivalent faktiki olaraq dörd xromosom nüsxəsini ehtiva edir, bunların hər biri meiozun sonunda əmələ gələcək dörd gametdən birinə yol tapmaq üçün təyin olunur. . Bivalent daxilində xromosom qolları (xromatidlər) fiziki qırılmaya və DNT seqmentlərinin mübadiləsinə məruz qala bilər. Proses krossinq-over və ya rekombinasiya adlanır və 1909-cu ildə belçikalı sitoloq Janssens tərəfindən kəşf edilmişdir. Bu, Morqanın qismən əlaqə haqqında düşünməyə başlamasından cəmi 2 il əvvəl idi.

Şəkil 5.15

Meioz. Bir cüt homolog xromosomun iştirak etdiyi hadisələr, cütün bir üzvü qırmızı, digəri mavi rəngdə göstərilir. Meyozun başlanğıcında xromosomlar sıxlaşır və hər bir homoloji cüt birləşərək bivalent meydana gətirir. Bivalent, crossing-over daxilində (daha çox.)

Krossinq-overin kəşfi Morqana qismən əlaqəni izah etməyə necə kömək etdi? Bunu başa düşmək üçün krossinq-overin genlərin miras qalmasına təsiri barədə düşünməliyik. Hər birində iki alleli olan iki geni nəzərdən keçirək. İlk geni A və onun allelləri adlandıracağıq Aa, və ikinci gen B allelləri ilə Bb. Təsəvvür edin ki, iki gen 2 nömrəli xromosomda yerləşir Drosophila melanogaster, Morqanın tədqiq etdiyi meyvə milçəyi növü. 2-ci xromosomun bir nüsxəsində allellərin olduğu diploid nüvənin meyozunu izləyəcəyik. AB, ikincisi isə var ab. Bu vəziyyət Şəkil 5.16-da təsvir edilmişdir. İki alternativ ssenarini nəzərdən keçirin:

Şəkil 5.16

Krossoverin əlaqəli genlərə təsiri. Rəsmdə biri qırmızı, digəri mavi olan bir cüt homoloji xromosom göstərilir. A və B allellərlə əlaqəli genlərdir A, a, Bb. Solda A və B arasında heç bir krossover olmayan bir meioz var: nəticədə ikisi (daha çox. )

A və B genləri arasında krossover baş vermir. Əgər bu baş verərsə, onda yaranan gametlərdən ikisi allelləri olan xromosom nüsxələrini ehtiva edəcəkdir AB, və digər iki ehtiva edəcək ab. Başqa sözlə, gametlərdən ikisi genotipə malikdir AB və ikisi genotipə malikdir ab.

A və B genləri arasında krossover baş verir. Bu, B genini ehtiva edən DNT seqmentlərinin homoloji xromosomlar arasında mübadiləsinə gətirib çıxarır. Nəticə budur ki, hər gametin fərqli genotipi var: 1 AB, 1 aB, 1 Ab, 1 ab.

İndi düşünün, yüz eyni hüceyrədə mayozun nəticələrinə baxsaq nə baş verərdi. Əgər krossoverlər heç vaxt baş vermirsə, onda yaranan gametlər aşağıdakı genotiplərə sahib olacaqlar:

Bu tam əlaqədir: A və B genləri meioz zamanı vahid vahid kimi davranırlar. Lakin bəzi nüvələrdə A və B arasında (daha çox ehtimal olunur) krossoverlər baş verərsə, o zaman allel cütləri tək vahidlər kimi miras alınmayacaq. Deyək ki, krossoverlər 100 meiozdan 40-da baş verir. Aşağıdakı gametlər nəticələnəcək:

Bağlantı tam deyil, yalnız qisməndir. Eləcə də ikisi valideyn genotiplər (AB, ab) rekombinant genotipləri olan gametləri görürük (Ab, aB).

Qismən əlaqədən genetik xəritəyə qədər

Morgan, mayoz zamanı krossinq-over ilə qismən əlaqənin necə izah oluna biləcəyini başa düşdükdən sonra, bir xromosomda genlərin nisbi mövqelərinin xəritəsini tərtib edə bildi. Əslində, ən vacib işi Morqanın özü deyil, onun laboratoriyasında bir bakalavr Artur Sturtevant (Sturtevant, 1913) etdi. Sturtevant güman edirdi ki, krossinqover təsadüfi bir hadisədir və bunun bir cüt düzülmüş xromatid boyunca istənilən mövqedə baş vermə şansı bərabərdir. Bu fərziyyə doğrudursa, bir-birinə yaxın olan iki gen, bir-birindən daha uzaq olan iki gendən daha az tez-tez krossoverlərlə ayrılacaq. Bundan əlavə, genlərin krossoverlərlə əlaqəsini kəsmə tezliyi onların xromosomlarında nə qədər uzaqda olduqları ilə birbaşa mütənasib olacaqdır. Beləliklə, rekombinasiya tezliyi iki gen arasındakı məsafənin ölçüsüdür. Müxtəlif gen cütləri üçün rekombinasiya tezliklərini işləsəniz, onların xromosomdakı nisbi mövqelərinin xəritəsini qura bilərsiniz (Şəkil 5.17).

Şəkil 5.17

Rekombinasiya tezliklərindən genetik xəritənin işlənməsi. Nümunə Artur Sturtevantın meyvə milçəkləri ilə apardığı orijinal təcrübələrdən götürülmüşdür. Bütün dörd gen meyvə milçəyinin X xromosomundadır. (daha çox) arasında rekombinasiya tezlikləri

Məlum olub ki, Sturtevantın krossoverlərin təsadüfi olması ilə bağlı fərziyyəsi tamamilə özünü doğrultmayıb. Genetik xəritələr və DNT molekulları üzərində genlərin faktiki mövqeləri arasındakı müqayisələr, fiziki xəritələşdirmə və DNT ardıcıllığının aşkar edildiyi kimi, rekombinasiya qaynar nöqtələri adlanan xromosomların bəzi bölgələrinin digərlərinə nisbətən krossoverlərdə iştirak etmə ehtimalının daha çox olduğunu göstərdi. Bu o deməkdir ki, genetik xəritə məsafəsi iki marker arasındakı fiziki məsafəni mütləq göstərmir (bax Şəkil 5.22). Həmçinin, biz indi başa düşürük ki, bir xromatid eyni vaxtda birdən çox krossoverdə iştirak edə bilər, lakin bu krossoverlərin bir-birinə nə qədər yaxın ola biləcəyinə dair məhdudiyyətlər var ki, bu da xəritələşdirmə prosedurunda daha çox qeyri-dəqiqliyə gətirib çıxarır. Bu keyfiyyətlərə baxmayaraq, əlaqə təhlili adətən gen sırası haqqında düzgün çıxarışlar edir və məsafə təxminləri genom ardıcıllığı layihələri üçün çərçivə kimi dəyərli olan genetik xəritələr yaratmaq üçün kifayət qədər dəqiqdir.

Şəkil 5.22

Genetik və fiziki xəritələrin müqayisəsi Saccharomyces cerevisiae III xromosom. Müqayisə genetik və fiziki xəritələr arasındakı uyğunsuzluğu göstərir, sonuncu DNT ardıcıllığı ilə müəyyən edilir. Qeyd edək ki, yuxarı iki markerin sırası (daha çox. )

5.2.4. Müxtəlif orqanizm növləri ilə əlaqənin təhlili

Bağlantı təhlilinin əslində necə aparıldığını görmək üçün üç tamamilə fərqli vəziyyəti nəzərdən keçirməliyik:

Planlaşdırılan damazlıq təcrübələri mümkün olduqda əlaqə təhlili

Bağlantı təhlilinin birinci növü Morqan və onun həmkarları tərəfindən hazırlanmış metodun müasir qarşılığıdır. Metod məlum genotiplərin valideynləri arasında qurulmuş eksperimental xaçların nəslinin təhlilinə əsaslanır və ən azı nəzəri cəhətdən bütün eukariotlara şamil edilir. Etik mülahizələr insanlarda bu yanaşmanı istisna edir və hamiləlik dövrünün uzunluğu və yeni doğulmuş körpənin yetkinlik yaşına çatması (və deməli, sonrakı xaçlarda iştirak etmək üçün) kimi praktik problemlər bəzi heyvan və bitkilərlə metodun effektivliyini məhdudlaşdırır.

Şəkil 5.16-ya qayıtsaq, görərik ki, gen xəritələşdirilməsinin açarı meioz nəticəsində əmələ gələn gametlərin genotiplərini təyin etməkdir. Bəzi hallarda bu, gametləri birbaşa tədqiq etməklə mümkündür. Məsələn, maya da daxil olmaqla bəzi mikrob eukariotları tərəfindən istehsal olunan gametlər Saccharomyces cerevisiae, genotipləri biokimyəvi testlərlə müəyyən edilə bilən haploid hüceyrələrin koloniyalarına çevrilə bilər. DNT markerləri istifadə olunarsa, gametlərin birbaşa genotiplənməsi daha yüksək eukariotlarla da mümkündür, çünki PCR fərdi spermatozoidlərin DNT-si ilə həyata keçirilə bilər ki, bu da RFLPs, SSLPs və SNP-ləri çap etməyə imkan verir. Təəssüf ki, sperma tiplənməsi zəhmətlidir. Buna görə də daha yüksək eukaryotlarla müntəzəm əlaqə təhlili gametləri birbaşa tədqiq etməklə deyil, bir cüt valideynin hər birindən olan iki gametin birləşməsi nəticəsində yaranan diploid nəslinin genotiplərini təyin etməklə həyata keçirilir. Başqa sözlə, genetik xaç aparılır.

Genetik çarpazın mürəkkəbliyi ondan ibarətdir ki, yaranan diploid nəsli bir meyozun deyil, ikisinin (hər valideyndə bir) məhsuludur və əksər orqanizmlərdə kişi və qadın gametlərinin istehsalı zamanı krossover hadisələrinin baş vermə ehtimalı eynidir. Bu iki meiozun hər birində baş verən krossover hadisələri birtəhər diploid nəslin genotiplərindən ayıra bilməliyik. Bu o deməkdir ki, xaç ehtiyatla qurulmalıdır. Standart prosedur test çarpazından istifadə etməkdir. Bu, Şəkil 5.18, Ssenari 1-də təsvir edilmişdir, burada biz əvvəllər tanış olduğumuz iki geni xəritələşdirmək üçün sınaq xaç qurmuşuq: gen A (alellər) Aa) və gen B (allellər Bb), hər ikisi meyvə milçəyinin 2-ci xromosomunda. Test xaçının kritik xüsusiyyəti iki valideynin genotipləridir:

Şəkil 5.18

Test çarpazının iki nümunəsi. Ssenari 1-də A və B allelləri olan genetik markerlərdir A, a, Bb. Yaranan nəsil onların fenotiplərini tədqiq etməklə hesablanır. Çünki ikiqat homozigot valideyn (Valideyn 2) hər iki resessiv allele malikdir - a və daha çox. )

İkiqat heterozigot Şəkil 5.16-da meyozunu izlədiyimiz hüceyrə ilə eyni genotipə malikdir. Buna görə də məqsədimiz bu valideyn tərəfindən istehsal olunan gametlərin genotiplərini çıxarmaq və rekombinant olan fraksiyaları hesablamaqdır. Qeyd edək ki, ikinci valideyn (ikiqat homozigot) tərəfindən istehsal olunan bütün gametlər genotipə sahib olacaqlar. ab valideyn və ya rekombinant gamet olmasından asılı olmayaraq. Allellər ab hər ikisi resessivdir, buna görə də nəslin genotipləri tədqiq edildikdə bu valideyndə meyoz faktiki olaraq görünməz olur. Bu o deməkdir ki, Şəkil 5.18-də 1-ci Ssenaridə göstərildiyi kimi, diploid nəslinin genotipləri birmənalı olaraq ikiqat heterozigot valideyndən olan gametlərin genotiplərinə çevrilə bilər. Buna görə də test çarpazı tək bir meiozun birbaşa tədqiqini aparmağa və beləliklə, tədqiq olunan iki gen üçün rekombinasiya tezliyini və xəritə məsafəsini hesablamağa imkan verir.

Yalnız bir əlavə məqamı nəzərə almaq lazımdır. Əgər, Şəkil 5.18-də 1-ci Ssenaridə olduğu kimi, dominantlıq və resessivlik göstərən gen markerlərindən istifadə edilərsə, o zaman ikiqat homozigot valideynin iki resessiv fenotip üçün allelləri olmalıdır, lakin əgər kodominant DNT markerləri istifadə olunursa, ikiqat homozigot valideynin istənilən kombinasiyası ola bilər. homozigot allellərdən (məs AB/AB, Ab/Ab, aB/aBab/ab). Şəkil 5.18-də 2-ci ssenari bunun səbəbini göstərir.

Haşiyə 5.2

Çox nöqtəli xaçlar. Bir çarpazda ikidən çox markerə əməl olunarsa, əlaqə təhlilinin gücü artır. Bu, nəinki rekombinasiya tezliyini daha tez yaradır, həm də xromosomdakı markerlərin nisbi sırasını təmin edir (daha çox. )

İnsan damazlıq analizi ilə gen xəritəsi

İnsanlarda, əlbəttə ki, valideynlərin genotiplərini əvvəlcədən seçmək və xəritəçəkmə məqsədləri üçün xüsusi olaraq hazırlanmış xaçlar qurmaq mümkün deyil. Bunun əvəzinə, mövcud ailələrin ardıcıl nəsillərinin üzvlərinin genotiplərini tədqiq etməklə rekombinasiya tezliklərinin hesablanması üçün məlumatlar əldə edilməlidir. Bu o deməkdir ki, yalnız məhdud məlumatlar mövcuddur və onların təfsiri çox vaxt çətindir, çünki insan nikahı nadir hallarda rahat sınaq çarpazlığı ilə nəticələnir və çox vaxt bir və ya bir neçə ailə üzvünün genotipləri əldə edilə bilməz, çünki həmin şəxslər ölür və ya əməkdaşlıq etmək istəmirlər.

Problemlər Şəkil 5.19-da təsvir edilmişdir. Bu nümunədə iki valideyn və altı uşaqdan ibarət bir ailədə mövcud olan genetik xəstəliyi öyrənirik. Genetik xəstəliklər insanlarda gen markerləri kimi tez-tez istifadə olunur, xəstəlik vəziyyəti bir allel, sağlam vəziyyət isə ikinci alleldir. Şəkil 5.19A-dakı şəcərə bizə göstərir ki, ana, dörd övladı kimi xəstəlikdən təsirlənir. Ailə hesablarından bilirik ki, ana tərəfdən nənə də bu xəstəlikdən əziyyət çəkirdi, lakin həm o, həm də əri – ana tərəfdən baba – indi ölüblər. Biz onları ölü olduqlarını göstərən kəsik işarələri ilə damazlıq şəcərəyə daxil edə bilərik, lakin genotipləri haqqında əlavə məlumat əldə edə bilmərik. Məqsədimiz genetik xəstəlik üçün genin mövqeyini xəritələşdirməkdir. Bu məqsədlə onun dörd alleli olan M mikropeyk markeri ilə əlaqəsini öyrənirik. M1, M2, M3M4 - canlı ailə üzvlərində mövcuddur. Sual olunur ki, uşaqların neçəsi rekombinantdır?

Şəkil 5.19

İnsan damazlıq analizinin nümunəsi. (A) Nəsil şəcərəsi iki canlı valideyn və altı uşaqdan ibarət ailədə genetik xəstəliyin miras qalmasını göstərir və ailə qeydlərindən əldə edilən ana tərəfdən nənə və babalar haqqında məlumat. Xəstəlik alleli (qapalı (daha çox)

Altı uşağın genotiplərinə nəzər salsaq görərik ki, 1, 3 və 4 nömrələrində xəstəlik alleli və mikrosatellit alleli var. M1. 2 və 5 nömrələri sağlam allele malikdir və M2. Beləliklə, biz iki alternativ fərziyyə qura bilərik. Birincisi, anadakı müvafiq homoloji xromosomların iki nüsxəsində genotiplər var. Xəstəlik-M1Sağlam-M2 buna görə də 1, 2, 3, 4 və 5-ci uşaqlar valideyn genotiplərinə malikdir və 6-cı uşaq tək və yeganə rekombinantdır (Şəkil 5.19B). Bu, xəstəlik geni və mikrosatellitin nisbətən sıx əlaqəli olduğunu və onlar arasında krossoverlərin nadir hallarda baş verdiyini göstərir. Alternativ fərziyyə ananın xromosomlarında genotiplərin olmasıdır Sağlam-M1Xəstəlik-M2 bu o deməkdir ki, uşaqlar 1𠄵 rekombinantdırlar, 6-cı uşaq isə valideyn genotipinə malikdir. Bu o deməkdir ki, gen və mikrosatellit xromosomda nisbətən uzaqdır. Bu fərziyyələrdən hansının doğru olduğunu müəyyən edə bilmirik: məlumatlar məyusedici dərəcədə birmənalı deyil.

Şəkil 5.19-da şəcərə tərəfindən qoyulan problemin ən qənaətbəxş həlli nənənin genotipini bilmək olardı. Gəlin elə edək ki, bu serial serial ailəsidir və nənə həqiqətən ölməyib. Hər kəsi təəccübləndirəcək ki, o, azalan tamaşaçı reytinqlərini saxlamaq üçün vaxtında yenidən peyda olur. Onun mikrosatellit M üçün genotipi olduğu ortaya çıxır M1M5 (Şəkil 5.19C). Bu, xəstəlik allelinin eyni xromosomda olduğunu göstərir M1. Beləliklə, biz əminliklə belə nəticəyə gələ bilərik ki, Hipotez 1 doğrudur və yalnız 6-cı uşaq rekombinantdır.

Əsas şəxslərin dirilməsi adətən real həyatda olan genetiklər üçün açıq bir seçim deyil, baxmayaraq ki, DNT slaydlar və Guthrie kartları kimi köhnə patoloji nümunələrindən əldə edilə bilər. Qeyri-kamil cinslər statistik olaraq, lod hesabı adlanan ölçüdən istifadə edərək təhlil edilir (Morton, 1955). Bu dayanır loqarifmi odgenlərin əlaqəli olduğunu və ilk növbədə öyrənilən iki markerin eyni xromosomda olub olmadığını, başqa sözlə, genlərin bağlı olub olmadığını müəyyən etmək üçün istifadə olunur. Lod analizi əlaqə yaradırsa, o, həmçinin ən çox ehtimal olunan rekombinasiya tezliyinin ölçüsünü təmin edə bilər. İdeal olaraq, mövcud məlumatlar birdən çox nəsildən əldə ediləcək və nəticəyə olan inamı artıracaqdır.Təhlil daha çox uşaqlı ailələr üçün daha az qeyri-müəyyəndir və Şəkil 5.19-da gördüyümüz kimi, ən azı üç nəslin üzvlərinin genotiplənməsi vacibdir. Bu səbəbdən, Parisdəki (Dausset) Centre d'Études du Polymorphisme Humaine (CEPH) tərəfindən saxlanılan kimi ailə kolleksiyaları yaradılmışdır. və b., 1990). CEPH kolleksiyası dörd nənə və babanın, eləcə də ən azı səkkiz ikinci nəsil uşağının nümunə götürülə biləcəyi ailələrdən yetişdirilmiş hüceyrə xətlərini ehtiva edir. Bu kolleksiya əldə edilən məlumatları mərkəzi CEPH verilənlər bazasına təqdim etməyə razı olan hər hansı tədqiqatçı tərəfindən DNT markerinin xəritələşdirilməsi üçün əlçatandır.

Bakteriyalarda genetik xəritəçəkmə

Nəzərə almalı olduğumuz son genetik xəritə növü bakteriyalarla istifadə olunan strategiyadır. Genetiklərin bakteriyalar üçün genetik xəritəçəkmə üsullarını inkişaf etdirməyə çalışarkən qarşılaşdıqları əsas çətinlik bu orqanizmlərin normal olaraq haploid olması və buna görə də meioz keçirməməsidir. Buna görə də bakterial DNT-nin homoloji seqmentləri arasında krossoverlər yaratmaq üçün başqa bir yol hazırlanmalı idi. Cavab DNT hissələrini bir bakteriyadan digərinə köçürmək üçün mövcud olan üç təbii üsuldan istifadə etmək idi (Şəkil 5.20):

Şəkil 5.20

Bakteriyalar arasında DNT transferinə nail olmağın üç yolu. (A) Konjuqasiya xromosom və ya plazmid DNT-nin donor bakteriyadan resipiyentə ötürülməsi ilə nəticələnə bilər. Konjugasiya, transfer düşüncəsi ilə iki bakteriya arasında fiziki təması ehtiva edir (daha çox. )

Köçürmədən sonra, donor bakteriyasından DNT-nin alıcı hüceyrənin xromosomuna inteqrasiyası üçün ikiqat krossover baş verməlidir (Şəkil 5.21A). Bu baş vermirsə, alıcı hüceyrə bölündükdə köçürülmüş DNT itir. Yeganə istisna episomların köçürülməsindən sonra, plazmidlərin ev sahibi xromosomundan asılı olmayaraq yayıla bilməsidir.

Şəkil 5.21

Bakteriyalarda gen xəritəsinin əsasları. (A) Triptofan biosintezi üçün funksional genin yabanı tipli bakteriyadan köçürülməsi (genotip aşağıdakı kimi təsvir olunur). trp + ) bu genin funksional surəti olmayan alıcıya (trp - ). Alıcı triptofan adlanır (daha çox.)

Biokimyəvi markerlər daim istifadə olunur, dominant və ya vəhşi tip fenotipin biokimyəvi xüsusiyyətə malik olması (məsələn, triptofanı sintez etmək qabiliyyəti) və resessiv fenotip tamamlayıcı xüsusiyyətdir (məsələn, triptofanı sintez edə bilməmək). Gen transferi adətən vəhşi tip allellərə malik donor ştamm ilə resessiv allellərə malik olan alıcı arasında qurulur, tədqiq olunan genlər tərəfindən müəyyən edilmiş biokimyəvi funksiyaların (funksiyaların) əldə olunmasını axtarmaq yolu ilə monitorinq edilən alıcı ştama transfer edilir. . Xəritəçəkmə prosedurunun dəqiq təfərrüatları istifadə olunan gen transferinin növündən asılıdır. Konyuqasiya xəritəsində donor DNT-si davamlı ip kimi alıcıya ötürülür və yabanı tipli allellərin alıcıya daxil olma vaxtı təyin edilməklə gen mövqeləri xəritələnir (Şəkil 5.21B). Transduksiya və transformasiya xəritələri bir-birinə nisbətən yaxın olan genlərin xəritələşdirilməsinə imkan verir, çünki ötürülən DNT seqmenti qısadır (< 50 kb), buna görə də iki genin birlikdə köçürülmə ehtimalı onların bakterial xromosomda bir-birinə nə qədər yaxın olmasından asılıdır. (Şəkil 5.21C).


Əlaqələr

Inria Grenoble Rhône-Alpes, Montbonnot, Fransa

Alex Di Genova və Marie-France Sagot

Université de Lyon, Université Lyon 1, CNRS, Laboratoire de Biométrie et Biologie Evolutive UMR 5558, Villeurbanne, Fransa

Alex Di Genova və Marie-France Sagot

Tibbi Genetika və Tətbiqi Genomika İnstitutu, Tübingen Universiteti, Tübingen, Almaniya

Elena Buena-Atienza və Stephan Ossowski

NGS Competence Center Tübingen (NCCT), Tübingen Universiteti, Tübingen, Almaniya



Şərhlər:

  1. Boden

    The wind will blow out all the ailments



Mesaj yazmaq