Məlumat

1.6: Məhdudiyyətli endonukleazdan istifadə edərək mutant RNT sensoru sintezi üçün DNT şablonunun hazırlanması - Biologiya

1.6: Məhdudiyyətli endonukleazdan istifadə edərək mutant RNT sensoru sintezi üçün DNT şablonunun hazırlanması - Biologiya


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

6.1 Təlim məqsədi

Bu laboratoriyada RNT sintezi üçün hazır mutant sensor RNT-ni ehtiva edən DNT şablonumuzu əldə edirsiniz. Bu proseslə siz məhdudlaşdırıcı endonükleazların - müəyyən bir ardıcıllıqla DNT-ni parçalayan fermentlərin qeyri-adi spesifikliyinə necə nail olduqlarını öyrənəcəksiniz.

6.2 Mini Layihə Blok Diaqramı

Aşağıdakı sxemdəki qalın işarəli blok mini layihədə cari təcrübənin rolunu vurğulayır.

6.3 Konspekt

Mini layihənin məqsədi toksin sensorunda antibiotik tetrasiklini tanımaq üçün vacib olan nukleotidləri müəyyən etmək idi. Bu məqsədə doğru axtarışda siz sensorda təkamüllə qorunan elementləri müəyyən etdiniz və onları dəyişdirdiniz. Siz sensorun ardıcıllığını dəyişdirmək üçün primerlər hazırladınız və PCR gücləndirilməsi və plazmid hazırlığından istifadə edərək mutant sensor DNT-ləri yaratdınız. Bu mutant sensorların tetrasiklini tanıyıb-tanımadığını yoxlamaq üçün mutant sensor RNT-lərini sintez etməlisiniz. Xatırladaq ki, sensor bir RNT molekuludur, lakin onun ardıcıllığı DNT səviyyəsində genomda kodlanır. RNT xətti DNT şablonu və RNT polimerazasından istifadə edərək sintez olunur. Buna görə, mutant sensoru kodlayan plazmid DNT məhdudlaşdırıcı endonükleazdan istifadə edərək kəsilməlidir (xəttiləşdirilməlidir). RNT polimerazının bütün plazmid vektorunu RNT-yə köçürməsinin qarşısını almaq üçün plazmid vektoru toksin sensoru ardıcıllığının sonunda parçalanır (yalnız sensor lazımdır). RNT polimerazaları DNT polimerazaları kimi işləyir və siz növbəti laboratoriya zamanı onlar haqqında ətraflı öyrənəcəksiniz.

6.4 Məhdudiyyətli endonukleazlar necə işləyir?

Məhdudiyyətli endonükleaza təcavüzkar DNT-ni parçalamaq üçün təkamül etdi, lakin ev sahibi orqanizmin DNT-ni toxunulmaz buraxdı. Onlar molekulyar bioloqlar tərəfindən xüsusi olaraq plazmid və ya parçalamaq üçün bir vasitə kimi geniş istifadə olunur. in vitro klonlama zamanı DNT sintez olunur. Məhdudiyyətli endonükleazlar dsDNT-ni milyon qat spesifikliklə müəyyən ardıcıllıqla kəsən fermentlərdir. Bu o deməkdir ki, məhdudlaşdırıcı endonükleazlar öz hədəf ardıcıllığını digər ardıcıllıqlara nisbətən milyon dəfə üstün tuturlar. Qohum DNT-lər xüsusi ardıcıllığa malikdir və səmərəli şəkildə parçalanır qohum olmayan DNT-lər xüsusi ardıcıllığa malik deyillər və buna görə də məhdudlaşdırıcı ferment tərəfindən effektiv şəkildə parçalanmırlar. Məhdudiyyət fermentləri nükleofil kimi metalla aktivləşdirilmiş su molekulundan istifadə edir. Metalla əlaqəli su molekulu adi su molekulundan daha turşudur. Buna görə də metala bağlı su protonunu daha asan itirir və hidroksil qrupuna çevrilir. Hidroksil qrupu güclü nükleofildir və fosfodiester bağının parçalanmasını çox səmərəli şəkildə kataliz edə bilir (Şəkil 6.1).

6.5 Məhdudlaşdırıcı fermentlər milyon qat spesifikliyə necə nail olurlar?

Məhdudiyyətli endonükleazlar öz qohum ardıcıllığını digər ardıcıllıqlara nisbətən milyon dəfə üstün tuturlar. Bu qeyri-adi spesifikliyə necə nail olunur? Məhdudiyyətli endonükleaz parçalanma yerləri ikiqat simmetriyaya malikdir. Eynilə, məhdudlaşdırıcı fermentlər dimerdir və tamamlayıcı ikiqat simmetriyaya malikdir (Şəkil 6.2).

Məhdudiyyətli endonükleaz, qohum olmayan DNT ilə müqayisədə, öz qohumu ilə daha geniş H-bağ şəbəkəsi əmələ gətirir. Nəticədə, qohum DNT bükülür (dsDNT strukturunda əyilmə var) və qayçı bağı (parçalanan bağ) parçalanma üçün fermentin aktiv sahəsinin tam ortasına yerləşdirilir. Qohum DNT-ni əymək üçün tələb olunan enerji məhdudlaşdırıcı ferment və qohum DNT arasındakı geniş H-bağlanmasından gəlir (Şəkil 6.3; Şəkil 6.4).

6.6 Plazmid DNT-nin uğurla xəttiləşib-xəttiləşdiyini necə mühakimə edirik?

Agaroz gel elektroforezi DNT-ni ölçü və/yaxud formaya görə ayırmaq üçün güclü texnikadır (bax. Fəsil 5.). Mutant sensor RNT üçün plazmid DNT kodlaması bakteriyalar tərəfindən sintez olunduğundan, o, super qıvrılmış və yığcamdır. Bu DNT məhdudlaşdırıcı endonükleaza ilə kəsildikdən sonra nicked olunur və buna görə də daha uzun bir forma malikdir. Nəticədə superdolaqlı (kəsilməmiş) plazmid DNT, agaroz geldə xəttiləşdirilmiş (kəsilmiş) DNT-dən daha uzağa miqrasiya edir. DNT linearizasiyası uğurlu olarsa, kəsilmiş DNT olan nümunədə kəsilməmiş DNT nümunəsinə nisbətən geldə daha az miqrasiya edən tək zolaq olmalıdır (Şəkil 6.5).

6.7 Laboratoriyada nə edəcəyik?

Əvvəlcə siz BamHI məhdudlaşdırıcı fermenti ilə mutant toksin sensoru üçün kodlaşdırma plazmid DNT-ni həzm edəcəksiniz və agaroz gel elektroforezindən istifadə edərək reaksiyanın uğurunu qiymətləndirəcəksiniz. Gel işləyərkən siz fenol-xloroformun çıxarılması ilə məhdudlaşdırıcı fermenti çıxaracaqsınız və etanol çöküntüsü ilə DNT konsentrasiyasını artıracaqsınız.

PROTOKOLLAR

Reagentlərə və avadanlıqlara ehtiyac altı tələbə komandası üçün hesablanır. ~20% artıqlıq daxildir.

Avadanlıq/şüşə qab tələb olunur

  1. Üç 100 ml tıxaclı Erlenmeyer kolbası
  2. Üç 100 ml dərəcə silindr
  3. Üç dəst mikropipet (20-100 μl və 2-20 μl)
  4. Gel sənədləşdirmə sistemi
  5. Su hamamı (məhdud həzm üçün) 37 °C-yə qoyulur
  6. Otuz 1,5 ml sentrifuqa borusu (Eppendorf)
  7. 10000 q tuta bilən 1 mikrosentrifuqa

Lazım olan həllər

  1. 3 l 1 x TAE (Tris-asetat-EDTA) pH=8.0
  2. 30 ml 1% EtBr və ya ekvivalent nuklein turşusu ləkəsi
  3. 20 ml agaroza gel yükləmə boyası (6x, Biorad)
  4. 30 ml 1 kb molekulyar çəki nərdivanı (Biorad)
  5. 2 ml Fenol:Xloroform:izoamil spirti qarışığı
  6. 150 ml 3M Na-asetat, pH=5,2
  7. 1,5 ml izopropanol

pUC19-ykkCD plazmid vektorunun həzminin məhdudlaşdırılması

Komandanın hər bir üzvü həzm edir

Aşağıdakı məhlulları bir sentrifuqa borusunda qarışdırın

  1. 5 μl bufer 3 (New England Biolabs)
  2. 5 μl 1 mq/ml iribuynuzlu serum albumin məhlulu
  3. 5 μl BamHI məhdudlaşdırıcı ferment (New England Biolabs)
  4. 75 μl plazmid DNT

37 ° C su banyosunda 1 saat inkubasiya edin.

Agaroz gel elektroforezi

  1. 1 q agarozu çəkin və təqdim edilmiş tıxaclı Erlenmeyer kolbasına qoyun.
  2. Dərəcəli silindrdən istifadə edərək 100 ml 1xTAE tamponu əlavə edin.
  3. Mikrodalğalı sobada 1 dəqiqə qızdırın, kolbaya çevirin və suyun altında qısa müddətə sərinləyin.
  4. 10 μl EtBr əlavə edin. (Əlcək geyin. EtBr mutagendir.) Qarışdırmaq üçün kolbaya çevirin.
  5. Gel kasetinə maye tökün və daraqları yerləşdirin. Agaroz gelin bərkidilməsi təxminən 20 dəqiqə çəkir.
  6. Gel təyin edildikdən sonra nümunələrinizi molekulyar çəki nərdivanı ilə yükləyin. Gel 100 V ilə 20 dəqiqə işlədilməlidir.
  7. Gel sənədləşdirmə sistemindən istifadə edərək gelin şəklini çəkin.

1 ml yükləmə boyası ilə qarışdırılmış 5 ml aşağıdakı nümunələri agaroza gelə yükləyin

  1. Molekulyar çəki markeri
  2. Plazmid hazırlığından plazmid DNT (kəsilməmiş DNT nümunəsi)
  3. məhdudlaşdırıcı endonükleazlarla həzm olunan plazmid DNT (kəsilmiş DNT)

Fenol-xloroformun çıxarılması və etanolun çökməsi

  1. Nümunənizə 100 μl fenol/xloroform qarışığı əlavə edin.
  2. 20 saniyə burulğan.
  3. Mikrosentrifuqada maksimum sürətlə 2 dəqiqə fırladın.
  4. Alt təbəqəni atın. (Bu addım məhdudlaşdırıcı endonükleazı ehtiva edən üzvi təbəqəni çıxarır.)
  5. 100 μl xloroform əlavə edin, burulğan edin və əvvəlki kimi fırladın. Alt təbəqəni çıxarın. Bu addım fenol qalıqlarını çıxarır.
  6. Qarışıqınıza 10 μl 3 M NaAc və 100 μl izopropanol əlavə edin.
  7. Nümunəni burulğan edin və yağıntı üçün -20 ºC dondurucuya qoyun.

Təlimatçıya qeydlər

6-cı fəsildəki təcrübə tələbələrə BamHI məhdudlaşdırıcı fermentdən istifadə edərək pUC19-ykkCD plazmid vektorunun enzimatik parçalanmasını necə həyata keçirməyi öyrətmək üçün nəzərdə tutulmuşdur. Minimum dəyişikliklərlə eyni protokol fərqli DNT və/yaxud məhdudlaşdırıcı endonükleaza ilə istifadə oluna bilər. BamHI məhdudlaşdırıcı ferment New England Biolabs-dan alınmışdır, lakin digər satıcılar istifadə edilə bilər. İki tələbə komandası bu vacib texnikaya məruz qalmağı maksimum dərəcədə artırmaqla yanaşı, avadanlıq ehtiyacını məhdudlaşdırmaq üçün bir agaroz geli paylaşdı. Avadanlıqların sayı məhduddursa, altı tələbə komandası asanlıqla bir agaroz gel aparatını paylaşa bilər. Endonükleaz həzminin məhdudlaşdırılması bir saat çəkdiyindən, reaksiyaları qurmaq və reaksiyalar davam edərkən laboratoriyadan əvvəl mühazirə verməklə laboratoriya sessiyasına başlamaq rahatdır. Bu laboratoriyada agaroz geli qurulub işləyərkən iki fasilə var. Bu vaxtlar məhdudlaşdırıcı endonükleaz və ya elektroforez iş vərəqini tamamlamaq üçün istifadə edilə bilər.

DNT Linearizasiyası üçün Laboratoriya Sualları

Aşağıdakı terminləri müəyyənləşdirin.

  1. Məhdudiyyətli endonükleaz

  2. Scissil bağı

  3. Qohum DNT və qohum olmayan DNT

  4. DNT keyfiyyətini yoxlamaq üçün DNT nümunəsini agaroz geldə həll etməlisiniz. Agaroz gel hazırlamaq və işə salmaq üçün sizə 1 l 1 x TAE tamponu (Tris-asetat EDTA) lazımdır. Siz 40 x konsentratlaşdırılmış TAE bufer ehtiyatı aldınız. Gel üçün lazım olan 1 l 1 x TAE məhlulunu necə hazırladığınızı təsvir edin (hesablamanızı göstərin).

Laboratoriya hesabatının konturları və nöqtələrin paylanması

1. Bu təcrübənin məqsədini/məqsədini müəyyən edən bir neçə cümlə. Mini layihə çərçivəsində bu təcrübənin əhəmiyyətini təsvir edin. (3 xal)

2. Məhdudiyyət endonükleazını qısaca müəyyənləşdirin/təsvir edin. Spesifikliyin necə əldə olunduğunu izah edin. (4 xal)

3. Nümunələriniz işarələnmiş, agaroz gel skanınızın surətini daxil edin. (4 xal)

4. Plazmid DNT-nin konsentrasiyasını bildirin. (2 xal)

5. Plazmid DNT məhsuldarlığını DNT konsentrasiyası əsasında qiymətləndirin (neçə mq DNT almısınız). Məhsuldarlıq hesablamanızı göstərin və DNT məhsuldarlığınızın nə qədər yaxşı olduğunu şərh edin. (6 xal)

6. Plazmid DNT təmizliyini agaroza gel skanına və UV udma ilə müəyyən edilmiş 260/280 göstəricisinə əsasən qiymətləndirin. izah edin. (6 xal)

7. Agaroz gel skanına əsaslanaraq DNT xəttiləşdirmənizin uğurunu qiymətləndirin. (4 xal)

8. Plazmid DNT-nin ölçüsünü mühakimə edin, o şərtlə ki, DNT pilləkəninin ölçüləri var: 1000 bp, 2000 bp, 3000 bp, 4000 bp, 5000 bp, 6000 bp, 7000 bp, 8000 bp, 9010 bp, (4 xal)

9. Elektroforez Problem Dəsti (17 xal)

Məhdudiyyətli endonükleazlar çox spesifikdir və xüsusi nukleotid ardıcıllığında DNT-ni parçalayır. Bu fermentlər böyük DNT üzərində hərəkət etdikdə, o, müxtəlif ölçülü çoxlu sayda fraqmentlərə parçalanır. Bu cür fraqmentlərin ölçü bölgüsü hər bir fərqli DNT üçün mahiyyətcə unikaldır. Bu paylama hər bir fərd üçün unikal olan DNT “barmaq izi” təmin edir. DNT barmaq izləri genetik mutasiyaları müəyyən etmək, irsi əlamətləri izləmək, ata-babalığı müəyyən etmək və şübhəliləri cinayət yerində yerləşdirmək üçün istifadə edilmişdir.DNT barmaq izinə səbəb olan bir neçə fərqli texnika var. Aşağıdakı problemlərdən bəziləri texnikaları təsvir edəcək və sizdən nəticələri şərh etməyi xahiş edəcək.1. (3 xal) Hər birinin özünəməxsusluğu olan minlərlə müxtəlif məhdudlaşdırıcı endonükleazlar var. Məsələn, BamHI, EcoRI və XhoI aşağıdakı xüsusiyyətlərə malikdir (yarılma yerləri oxlarla işarələnmişdir):Aşağıdakı DNT-də parçalanma yerlərini müəyyən edin (hər yeri bir xətt və xüsusi endonükleazın adı ilə qeyd edin):5'CCCGAGGATCCTTAGGAATTCATCTA3'3'GGGCTCCTAGGAATCCTTAAGTAGAT5'2. (4 xal) BamHI parçalanmasından məhsul fraqmentlərinin ardıcıllığını göstərin. Niyə bu məhsulların "yapışqan ucları var?"3. (6 xal) Məhdudiyyət fraqmentinin uzunluğu polimorfizmi (RFLP, tez-tez “riflip” tələffüz olunur) DNT barmaq izinin ən qədim formasıdır. Bu, hər bir fərdin DNT-nin unikal ardıcıllıqla çoxlu seqmentlərə malik olmasından asılıdır. Hər bir seqment irsi olan müxtəlif ardıcıllığa malik ola bilər. Bu xüsusiyyət "polimorfizm" adlanır. Polimorfizm o deməkdir ki, hər bir fərddə fərqli məhdudlaşdırıcı ferment parçalanma yerləri olan DNT var. Qısaca, RFLP daxildirDNT-nin xüsusi məhdudlaşdırıcı endonükleaza ilə müalicəsi;Alınan fraqmentlərin agaroz geldə ölçüsünə görə ayrılması;Tamamlayıcı DNT zondlarından istifadə edərək xüsusi fraqmentlərin vizuallaşdırılması.Aşağıdakı agaroz geldən atalıq yaratmaq üçün istifadə edilmişdir. O, tək lokus RFLP istifadə edərək yaradılmışdır. Yəni istifadə edilən prob DNT-də yalnız bir polimorfik seqmentə həssas idi.Bu nəticələri şərh etmək üçün bilmək lazımdır– Hər bir fərd DNT-nin iki nüsxəsini daşıyır və yəni hər bir DNT seqmenti üçün iki fərqli polimorfizm var;– Hər bir fərd hər valideyndən bir DNT nüsxəsini miras alır.http://www.biology.arizona.edu/)a. Bu valideynlərin bioloji övladları kimi görünməyən uşaqlar varmı? izah edin.b. Uşağın ana və ata ilə qohumluğunu müəyyən etmək üçün onun DNT barmaq izi nə olmalıdır?4. (4 xal) Aşağıdakı DNT barmaq izlərində C/AF Mix həm atanın DNT-sini, həm də uşağın DNT-sini ehtiva edən zolaqdır.(Geneleks Korporasiyasının izni ilə)Hər iki halda atalıq sübut olunurmu? Qısaca izah edin.5. (6 xal) DNT barmaq izinin həssaslığını artırmaq üçün PCR RFLP ilə birləşdirilib. Bu texnikada PCR maraq kəsb edən xüsusi bir DNT seqmentini gücləndirir. Sonra ardıcıllıqdakı dəyişikliklər RFLP ilə müəyyən edilir.Məsələn, bu üsulla oraq hüceyrəli anemiya diaqnozu qoyula bilər. Oraq hüceyrəli anemiya, hemoglobin zülal zəncirlərindən birini kodlayan DNT-də tək bir mutasiya nəticəsində yaranır. Bu mutasiya həmçinin ferment üçün məhdudlaşdırıcı endonükleaz parçalanma yerini aradan qaldırır; Cvn. Parçalanma yerinin itirilməsi oraq hüceyrə geninin diaqnostikasıdır.Aşağıda, ana, ata və uşaqlar DNT barmaq izi vasitəsilə oraq hüceyrə geni üçün sınaqdan keçirilmişdir. Elektroforez nümunəsinin yuxarısındakı diaqram valideynlər (sətir I) və uşaqları (sətir II) göstərir. Qadınlar dairə ilə, kişilər isə kvadratla simvollaşdırılır. Normal gen açıq simvolla, oraq hüceyrə geni isə doldurulmuş simvolla göstərilir. (Unutmayın ki, hər bir şəxs genin iki nüsxəsini daşıyır.)Hər bir fərdin simvolu elektroforez gelindəki zolağa uyğun gəlir. Zolaqlar həmçinin oraq hüceyrə mutasiyasının olması üçün “S” və normal genin olması üçün “A” ilə qeyd olunur. (DNT nərdivanı sağdadır və əsasların sayı ilə verilmişdir. Qeyd edək ki, gel "alt-aşağı"dır - kiçik fraqmentlər yuxarıya daha yaxındır.)(Dr. Carole Oberin izni ilə)Yalnız oraq hüceyrə mutasiyası olmayan fərddə mövcud olan parçalanma fraqmentlərinin ölçüsünü təxmin edin. Seçiminizi qısaca izah edin.Bu dekolte parçaları hansı zolaqdan gəlir? Qrupu müəyyən edib ölçüsünü təxmin edə bilərsinizmi? Məntiqinizi izah edin.Tədqiqatçı bu elektroforez əsasında bu subyektlərə (SS, AS və ya AA) diaqnoz qoydu. Diaqnozda hər hansı uyğunsuzluq görürsünüzmü? Qısaca izah edin.

YkkCD toksin sensorunu pUC19 klonlama vektoruna yerləşdirmək üçün şərti (kəsmə və yapışdırma) mutagenez üçün primerlər tərtib edin. Bu kimi təcrübələr adətən laboratoriyada zülal və ya RNT-nin öyrənilməsində ilk addımdır. Toksin sensorunun ardıcıllığı və klonlama vektorunun xəritəsi aşağıda verilmişdir.ykkCD sensorunun DNT ardıcıllığı:TgtaaagttttctagggttccgcatgtcaattgacatggactggtccgagagaaaacacatacgcgtaaatagaagcgcgtatgcacacggagggaaaaaagcccgggagagpUC19 klonlama vektorunun xəritəsiYkkCD toksin sensoru çoxlu klonlama yeri və ya polilinker MCS adlı klonlaşdırma vektorunun bir hissəsindən istifadə edərək pUC19-a daxil edilməlidir. Klonlama vektorunun bu hissəsi bir neçə məhdudlaşdırıcı ferment üçün kəsilmiş yerləri ehtiva edir və DNT ardıcıllığının daxil edilməsinə imkan vermək üçün nəzərdə tutulmuşdur. pUC19 halında mövcud məhdudlaşdırıcı fermentlər bunlardır: EcoRI, SacI, KpnI, SmaI, BamHI və s.YkkCD ardıcıllığını pUC19-a yapışdırmaq tapşırığını yerinə yetirmək üçün aşağıdakı suallara cavab verin:1. Adi klonlaşdırma layihəsində birinci addım, maraq ardıcıllığını (ykkCD sensoru) ayırmayan polilinker MCS-də olanlardan bir cüt məhdudlaşdırıcı ferment seçməkdir. YkkCD ardıcıllığını kəsən məhdudlaşdırıcı fermentlər klonlama üçün istifadə edilə bilməz, çünki onlar maraq ardıcıllığını parçalayacaq və bütün ardıcıllığın klonlama vektoruna yapışdırılmasına imkan verməyəcəklər. Müvafiq məhdudlaşdırıcı endonükleazları seçmək üçün aşağıdakı iki addımı yerinə yetirin.a. YkkCD sensorunun ardıcıllığını Webcutter adlı proqrama yapışdırın (http://www.firstmarket.com/cutter/cut2.html). YkkCD ardıcıllığını kəsməyən məhdudlaşdırıcı fermentlərin adlarını sadalayın.b. MCS polilinkerində hansı fermentlər klonlaşdırma layihənizi həyata keçirmək üçün istifadə edilə bilər? Qısa izahat verin.2. Klonlaşdırma təcrübəsini yerinə yetirmək üçün primerlərin layihələndirilməsi.a. Üst və alt primer ardıcıllığını təmin edin. Bu primerləri necə hazırladığınızı qısaca izah edin. Bu primerlər DNT-nin hansı hissəsinə bağlanır? Unutmayın ki, Quickchange ilə adi PCR arasında fərq var.b. T-ni hesablayınM (ərimə temperaturu) hər bir primer üçün. T-ni proqnozlaşdırmaq üçün Oligo kalkulyatorundan (http://www.basic.northwestern.edu/biotools/oligocalc.html) istifadə edə bilərsiniz.M.c. Adi PCR, məhdudlaşdırma yeri adlanan hər bir məhdudlaşdırıcı ferment tərəfindən tanınan xüsusi ardıcıllığın əlavə edilməsini tələb edir. Siz hər bir məhdudlaşdırıcı ferment üçün tanınma ardıcıllığını http://www.neb.com saytında tapa bilərsiniz.Yenidən işlənmiş primer ardıcıllığınız bu nümunəyə uyğun olmalıdırMəhdudiyyət sahəsinin ardıcıllığı + “b” dən primer ardıcıllığı.d. Hər iki primerin ardıcıllığını 5'-dən 3' istiqamətində yazın.