Məlumat

DNT texnologiyasından istifadə edərək canlı dinozavrı necə yarada bilərik?

DNT texnologiyasından istifadə edərək canlı dinozavrı necə yarada bilərik?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Maraqlıdır, DNT texnologiyasından istifadə edərək canlı dinozavr yaratmaq üçün nə etməliyik? Mövcud texnologiya ilə mümkün deyilsə, nə vaxtsa mümkün olacaqmı?

Jurassic Park filmində elm adamları kəhrəba içərisində qorunan və dinozavrdan qan udmuş ​​ağcaqanaddan dinozavr DNT-sini çıxarırlar. DNT natamamdır, ona görə də elm adamları onu qurbağa DNT-si ilə birləşdirir. Daha sonra DNT timsah yumurtasına daxil edilir və embrion yaranır və s.

Yura parkı metodu şübhəlidir. Dinozavr DNT-si tapılıb təcrid olunsa da, mövcud texnologiyadan istifadə edərək onu orijinal formasına qaytarmaq üçün çox zədələnmişdi. Qurbağa DNT-si ilə birləşmənin işləyəcəyi aydın deyil. Dinozavr embrionunu necə inkişaf etdirəcəyinizi və yumurtaların inkubasiya və yumurtadan çıxmasını bir anlıq unudaq. Mən bilmək istəyirəm ki, hansısa dinozavrın genomunu necə tam ardıcıllıqla sıralayacağıq?


Quşlar geniş şəkildə qəbul edilir əslində var dinozavrlar. Kladistik desək, canlı dinozavr yaratmaq üçün heç bir DNT texnologiyası tələb olunmur, çünki onlar artıq mövcuddur.

Eyni şeyi a-ya etmək istədiyinizi fərz etsək qeyri-quş dinozavr (parafiletik qrup), bununla belə, World Building SE-də soruşmaq daha yaxşı fikir olardı, çünki bu mövzuda çox az elmi araşdırma aparılmışdır və spekulyativ cavablar ümumiyyətlə burada mövzudan kənar hesab olunur.


Əlaqədar DNT ilə müqayisə etmək, onun keçmişdə yunlu mamontla necə edildiyidir. Beləliklə, kifayət qədər çıxarmaq və bunu etmək üçün kifayət qədər yaxın qohumlar tapmaq məsələsi ola bilər. Amma oxuduqlarıma görə, DNT o qədər parçalanmışdır ki, hətta yaxın qohumlara belə xəritə çəkmək nisbətən mümkün deyil. Bunu başa düşə bilərsiniz, çünki DNT nə qədər çox parçalanmışsa, parçalar bir o qədər kiçikdir. Beləliklə, belə bir ipiniz varsa:

ACTGATCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTACTTAGCT

O, uzundur və qohumun genomunda yalnız bir və ya iki yeri göstərə bilər. Ancaq bu kimi daha qısa olan çox parçalanmış ipləriniz varsa:

AGTC

Təsəvvür edə bilərsiniz ki, bu, milyonlarla müxtəlif yerlərə xəritə verəcəkdir. Beləliklə, bunları sıraya qoymaq, mahiyyətcə, qeyri-mümkün olardı.

Çətinliyi həqiqətən başa düşmək üçün bunları bir zaman çizelgesine qoymalıyıq, Yunlu Mamontlar 500.000 il əvvəl yaşamış, dinozavrlar isə 60 milyon il əvvəl idi.


Dinozavrı necə etmək olar

ADDIM 1)Dinozavr dövründən qalan qan əmici həşərat ilə kəhrəba parçası tapın.

ADDIM 2)Həşəratın dinozavrdan əmdiyi qanı çıxarın.

ADDIM 3)Qanda tapılan dinozavrın genetik kodunu (DNT) başqa bir dinozavr üçün plan kimi istifadə edin. DNT parçaları yoxdursa, boşluqları qurbağa DNT ilə doldurun.

ADDIM 4)Dinozavr yumurtası yaratmaq üçün bu mavi izlərdən istifadə edin.

ADDIM 5)Dinozavrı inkubatorda ovlayın.

ADDIM 6)Dinozavrı tam ölçüyə qaldırın.

Həqiqətən dinozavrları yenidən yaratmaq üçün bu düsturdan istifadə edə bilərikmi? Əgər bu gün edə bilməsək, gələcəkdə bunu edə biləcəyimiz texnologiyamızın kifayət qədər yaxşı olmasını gözləyə bilərikmi?

Birinci addıma baxaq. Kəhrəbada tələyə düşmüş həşəratların dişləməsindən dinozavr DNT-sini əldə etmək ideyası yaranıb George O. Poinar 1980-ci illərdə. Kəhrəba daşlaşmış ağac şirəsidir. Adətən sarımtıl bir rəng ilə aydın olur. Bəzən böcəklər ağac şirəsi bərkimədən əvvəl sıxılırlar. Bəzi kəhrəbalar, dinozavrların yaşadığı Mezozoy erasına aiddir və dinozavr qanı daşıyan həşəratların kəhrəbada tələyə düşməsi qeyri-mümkün deyil. Düzgün kəhrəba parçalarını axtarmaq üçün vaxt və pul sərf etməyə hazırıqsa, birinci addım yaxşı görünür.

Kəhrəba qədim DNT tədqiqatları üçün son dərəcə faydalıdır. Fosilləşmiş sümüklərin əksəriyyətində faktiki üzvi material minerallarla əvəz edilmişdir. Kəhrəba bir heyvanın yumşaq toxumasını uzun müddət qoruyur.

İkinci addım dinozavr DNT-sini həşəratdan çıxarmaqdır. Çox vaxt həyatın planı adlandırılan DNT canlı orqanizmin bir çox hüceyrəsində olur. Polis laboratoriyaları cinayət işlərində sübut kimi istifadə etmək üçün əslində müasir ağcaqanadlardan insan DNT-sini çıxarıb. Beləliklə, çıxara biləcəyimiz çox çətin olsa da, mümkün deyil bəziləri qədim ağcaqanaddan bərpa etdiyimiz qandakı ağ qan hüceyrələrindən dino DNT (DNT-ni qırmızı qan hüceyrələrindən əldə edə bilsək, bunu etmək çox asan olardı, çünki qanda ağ qan hüceyrələrindən daha çox var, lakin Təəssüf ki, qırmızı qan hüceyrələri DNT daşımır).

Bundan sonra isə problemlə üzləşirik. Elm adamları, təxminən 120-135 milyon il əvvəl kəhrəbada qapalı qalan nəsli kəsilmiş yabanı böcəkdən DNT fraqmentləri çıxarıblar. Qeyd edək ki, bu, yalnız a fraqment buğdanın DNT-si (bütün ardıcıllığın milyonda birindən az) və yox dişlədiyi bir şeyin qanı.

Tam DNT dəsti, bir hissəsi olduğu canlının mavi izlərini daşıyır. Bununla belə, bu kod milyardlarla fərdi "əsas cütlərdən" (əlifbadakı hərflər kimi) ibarətdir və bunların sırası kod üçün çox vacibdir. DNT nisbətən kövrəkdir və zamanla parçalanır. Bir həşəratın mədəsindən çıxara biləcəyimiz DNT kiçik parçalara parçalanacaq və çoxu yox olacaq. Təəssüf ki, itkin hissəni qurbağa DNT ilə əvəz edə bilmərik. Əgər bunu etsəydik, bir neçə qurbağa bölməsi olan dinozavr DNT-si əvəzinə bir neçə kiçik dinozavr bölməsi olan qurbağa DNT-si ilə nəticələnərdik.

Elm adamları üçün həşəratın bir hissəsi və ya tədqiqatçıların dırnaqlarının altındakı bir şeydən çirklənmə deyil, dino DNT parçasının olduğuna əmin olmaq çətin olacaq. Unutmayın ki, indiyə qədər heç kim dinozavr DNT-sini görməmişdi, ona görə də biz onu ancaq bugünkü canlı heyvanların DNT-si ilə müqayisə edərək müəyyən edə bilərik.

Əgər dinozavr DNT-nin çatışmayan hissəsini dolduracaq olsaq, onu quşlardan götürmək daha məntiqli olardı, çünki onlar dinozavrlara ən yaxın canlılar kimi görünürlər.

Üçüncü Mərhələyə çatdığımız zaman hər şey çətinləşir. DNT çox vaxt kompüterdəki proqram proqramına bənzədilir, çünki orada canlı məxluqun necə qurulacağına dair təlimatlar var. (Kompüter proqramındakı təlimatlar maşına vergilərinizi necə edəcəyinizi söyləyə bilər.) Kompüterdə nəsə etmək üçün sizə təkcə proqram təminatı yox, onu işə salmaq üçün aparat (kompüterin özü) lazımdır. Eyni şəkildə, DNT-nin icrası üçün lazım olan “texniki təchizat”dan məhrum oluruq. Bu, bir qayda olaraq, içində DNT olan bir yumurta istehsal edən bir ana dinozavr olardı. Təəssüf ki, heç bir köhnə toyuq yumurtası bunu etməyəcək. Bizə dinozavr yumurtası lazımdır. Çox güman ki, təkrar etməyə çalışdığımız eyni növdən biridir. Bu məqsədlə dəvəquşu yumurtası kimi bir şeyi dəyişdirə bilərikmi? Ola bilər, amma bu gün bunu necə edəcəyimizi və ya hansı dəyişikliklərə ehtiyac olduğunu bilmirik.

Fərz edək ki, biz bu maneəni aşmaq üçün bir yol tapırıq, bundan sonra nə olacaq? İnkubatorda dinozavrın yumurtadan çıxarılması. Bununla bağlı kifayət qədər təcrübəmiz var. Yumurtalar yaxşı olarsa, yəqin ki, onları yumurtadan çıxara bilərik.

İndi bala dinozavrlarımızı yetkinliyə çatdırmalıyıq. Digər növlərin yetişdirilməsi ilə bağlı təcrübəmiz kömək edəcəkdir. Əsirlikdə olan Kaliforniya kondorları valideynlərin rolunu oynamaq üçün kuklalardan istifadə edərək böyüdülər. Beləliklə, onlar insanlarla çox da rahatlaşa bilmədilər və təbiətdə təkbaşına yaşamağa keçid asanlaşdırıldı. Bu məqsədlə səksən fut uzunluğunda Apatasaurs kuklasının təmin edilməsinin maddi-texniki təminatı çətin ola bilər, lakin keçilməz deyil.

Yenə də dinozavrımızın sağlamlığından narahat olmalıyıq. Onu nə ilə qidalandırırıq? Mezozoyda onun yediyi bitkilərin çoxu özləri yox olacaq. Dinozavrımızın müqavimət göstərə bilmədiyi son 65 milyon il ərzində hansı yeni mikroblar yaranıb? Dinozavrımız xəstələnsə, hansı dərmanı verə bilərik? Dinozavr davranışının keçmiş tarixi olmadan, dinozavrımızın "normal" hərəkət edib-etmədiyini söyləmək çətin olacaq.

Heç vaxt fosilləşmiş DNT-dən dinozavr yarada bilməsək də, alimlər qədim DNT-nin əsrlər boyu necə dəyişdiyini görmək üçün bu canlılar və ümumiyyətlə həyat haqqında çox şey öyrənə bilərlər.

Və kim bilir? Əgər bütün bu maneələri keçə bilsək, bəlkə də nə vaxtsa bir dinozavr yarada bilərik. Bu arada, bunu edənə qədər biz onları filmlərdə izləməklə kifayətlənməliyik.

Kəhrəba dinozavr DNT-sinin yeganə potensial mənbəyi olmaya bilər. Fosilləşmiş sümüklərin əksəriyyətində artıq heç bir bioloji material olmadığı halda, üzvi materialın fosilləşmə prosesindən sağ qaldığı nadir hallar ola bilər. Skott VudvordBrigham Young Universitetinin əməkdaşı, yeraltı kömür mədənindən çıxarılan sümüklərdə DNT tapdığını bildirdi.

Vudvord bilirdi ki, torf bataqlıqlarında tapılan cəsədlər çox vaxt uzun müddət yaxşı saxlanılır. O, qədim bataqlıqların müasir kömür damarlarına çevrildiyini də bilirdi. Kömür mədənində tapılan bəzi sümük parçalarına sahib olan Vudvord DNT axtarmağa qərar verdi.

Vudvordun ümid etdiyi kimi, sümük tamamilə fosilləşməmiş və hissələri "bərk sabun kimi mumlu" idi. Sümüyün mikroskopik müayinəsi hüceyrə strukturlarının hələ də qorunduğunu göstərdi, ona görə də DNT-ni axtarmağa başladı.

174 əsas cüt uzunluğunda bir gen seqmenti tapıldı. Bu, heç bir canlı heyvanın eyni geninə bənzəmirdi, bu, laboratoriya çirklənməsinin nəticəsi olmadığının güclü göstəricisidir.

Dinozavr sümüyünün bir parçası. (Müəllif hüququ Lee Krystek 1996)

Vudvord kömürdə tapılan sümük parçalarının müəyyən bir dinozavrdan olduğunu dəqiq deyə bilməsə də, o bilir ki, hansı heyvan böyük idi və təxminən 80 milyon il əvvəl Certaceous dövründə yaşamışdır. Dinozavr yaxşı namizəd kimi görünür.

Vudvord həqiqətən dinozavr DNT-sinə malik olduğunu göstərə bilsə, onun texnikası nəsli kəsilmiş canlılar haqqında daha çox öyrənmək üçün çox faydalı ola bilər. Kəhrəbadakı böcəklərdən fərqli olaraq, birbaşa dinozavr sümüyündən DNT əldə etmək müəyyən bir DNT ardıcıllığının xüsusi dinozavr növləri ilə əlaqələndirilməsinə imkan verəcəkdir.

Paleontoloq Cek Horner və aspirant Meri Şvitzer artıq təcrid etməyə çalışırdıTyrannosaurus Rex Vudvord işə başlamazdan əvvəl sümüklərdən DNT.

Dinozavrlardan DNT əldə etmək çətin olsa da, onu daha yaxınlarda nəsli kəsilmiş növlərdən bərpa etmək kifayət qədər asan ola bilər. Münhen Universitetindən Hendrik Polinar canlının voleybol böyüklüyündəki zibilindəki DNT-dən Nəhəng Tənbəlliyi müəyyən etməyi bacarıb. Peyin təxminən 20.000 il əvvəl Las Veqas yaxınlığındakı bir mağarada qalmışdı. Zülal və şəkər molekulları bir-birinə qarışdıqca DNT-də "karamelləşdi". Bu, DNT-ni çürümədən qorudu. Polinar daha sonra bağları ayıra və genetik ardıcıllığı oxuya bildi. Qorunmasına baxmayaraq, DNT materialının çox hissəsi hələ də itirildi və bu prosesin "Yura Parkı" üçün Nəhəng Tənbəllik yaratmaq üçün istifadə oluna biləcəyi ehtimalı azdır.


Dino-Cücələri Gəlir

Bir neçə il əvvəl Bhart-Anjan Bhullar, sonra Ph.D. Harvarddakı Arhat Abjanovun laboratoriyasında tələbə, olduqca inanılmaz bir şey etdi: embrion toyuq götürdü və inkişafı zamanı bir neçə geni inhibə etdi. Bu, olduqca heyrətamiz nəticə verən kiçik bir tənzimləmə idi: "Bu şəkildə dəyişdirilən toyuqlar böyüyüb dinozavr burnuna bənzəyən bir buruna sahib oldular" dedi. Tərs.

Bhuların tədqiqatı molekulyar biologiya və paleontologiyanın qəribə kəsişməsində mövcuddur. Yaledə dərs demədiyi zaman, heyvan qruplarının əsas fərqləndirici xüsusiyyətlərinin - bu halda quş dimdiyi necə meydana gəldiyini araşdırır. Bu, böyük bir iş kimi görünməyə bilər, lakin quş dimdiyi necə meydana gəldiyini anlamaq təkcə müasir heyvanların necə təkamül etdiyini anlamaq üçün deyil, həm də əvvəllər Yer kürəsində dolaşan dinozavrları və bundan sonra hansı heyvanların bu planetdə dolaşa biləcəyini anlamaq üçün inanılmaz dərəcədə ayrılmazdır.

Aydın olmaq üçün, Bhullar dəqiq deyil cəhd bir toyuqdan bir dinozavrı tərsinə çevirmək. Bununla belə, onun hesablamalarına görə, 15-20 ildən sonra canlı, nəfəs alan, ətrafda qaçan və dişli burnunda kiçik bir velociraptor kimi yırtıcı ovlayan dino-toyuq yumurtadan çıxarmaq üçün bütün lazımi alətlərə və məlumatlara sahib olacağıq. "Bu nəzəri deyil" deyir. “Mən burada yarım əsrdən danışmıram, onilliklərdən danışıram. Bu baş verəcək”.

Quşlar təkcə dinozavrların ən yaxın qohumları deyil var dinozavrlar. "Dinozavr" termini, hamısı ortaq bir əcdaddan törəmiş və milyonlarla ildir dünyanı idarə edən çox müxtəlif əlamətlərə malik olan çox böyük bir heyvan qrupunu təyin edir. Qısa tarix dərsi: Asteroid toqquşduqdan sonra onların demək olar ki, hamısı öldü. Amma hamısı deyil. Bəzi dinozavrlar - qanadları, lələkləri və dimdiyi olan xırda şeylər - hər şeyi yaxşı etdi və onlardan 65 milyon il ərzində bu gün Planet Earth vətəni adlandıran 20.000 quş növü ortaya çıxdı. Əgər toyuqun genetik əcdadını kifayət qədər geriyə götürə bilsəniz, onun fosil qeydlərimizdəki dinozavrlara və təsəvvürlərimizə çox bənzədiyini əldə edəcəksiniz.

Bhullar deyir: "Canlıların tarixinin sirləri hələ də mirasda, xüsusən də genomda gizlidir". Bu, toyuqun uzaq əcdadının bütün genetik məlumatlarının hələ də onun DNT-sində gizləndiyi deyil, lakin bir çoxu var və ya ən azı potensial olaraq.

Xüsusilə, onurğalılar zamanla çox incə təkamül etməyə meyllidirlər, Bhullar izah edir. "Onurğalıların istehsal etdiyi anatomiyada yalnız müəyyən dəyişikliklər var və çox güman ki, biz çox mürəkkəb olduğumuza görə, o qədər mürəkkəb olduğumuza görə, erkən bir şeyi əsaslı şəkildə sındırmaq asanlıqla canlı bir canlı yaratmayacaq."

Molekulyar inkişaf səviyyəsində quş dimdiyi ilə dinozavr burnu arasındakı fərq kiçikdir - inkişaf etməkdə olan embrionda müəyyən genlərin ifadəsini bir az tənzimləmək kifayətdir ki, birini deyil, birini yaratmaq. Göründüyü kimi, dimdik, üz qabığının çox böyüdülmüş uyğunlaşmasıdır - üzün ən ön hissəsində oturan və kəsici dişləri yerləşdirən bir cüt kiçik sümük.

Təxminən 85 milyon il əvvəl dinozavrların nəsil ağacının bir qolu quşun bədən planını artıq müəyyənləşdirmişdi. Bunlar kiçik, ətyeyən teropodlarla əlaqəli idi VelociraptorTyrannosaurus rex. Onların lələkləri, qanadları, quşa bənzər bədənləri və quşa bənzər beyinləri var idi. Onlar uça bilirdilər. Lakin onların hələ də kiçik dişli dinozavr burunları var idi. Məşhur Arxeopteriks yaxşı nümunədir.

Sonra, birdən - ən azı geoloji baxımdan - ilk dimdiklər göründü. Bhullar izah edir ki, bu keçid heyvanlarının hələ də dişli çənələri var idi, ancaq qabaqda dimdiyi, sanki yapışdırılmış kimi.

Milyonlarla il keçdi, quş növlü dinozavrlar dişlərini itirdi və çənə sümükləri kiçildi. Onlarda böyük bir dimdikdən başqa heç nə qalmayıb. Ancaq görünür, bu böyük dimdik apokalipsisdən sağ çıxmaq üçün lazım olan şey idi.

Bhullar deyir: "Tabaşir dövrünün sonunda sağ qalan şeylər, ümumiyyətlə, toxum və həşərat kimi qida mənbələrindən və kataklizmdən sonrakı dünyada mövcud olan digər qida növlərini istifadə edə bilən şeylər idi". “Və dimdiyi necə işlədirsə, o, çox mürəkkəb fonda kiçik qida maddələrini sürətli, dəqiqliklə əldə etməyə imkan verir. Siz dağıdılmış meşənin bəzi zibilləri ilə gəzdiyinizi təsəvvür edə bilərsiniz və yerdə sadəcə çınqıllar, kül və hər cür axmaqlıq var və siz Böyük Quş gözləriniz və Böyük Quş beyninizlə kiçik kiçik parçaları seçməlisiniz. əslində yeməli olan şeylərdən.”

Qeyd etmək lazımdır ki, quşa bənzər dinozavrların digər formaları - dişli burunlu olanlar və hibrid burnu/dimdiyi olanlar - asteroid Yer qabığında bir deşik açanda hələ də ətrafda idi və yaxşı işləyirdi. Lakin onların heç biri qarşı tərəfə keçə bilmədi. Bhullar deyir: "Tamamilə müasir dimdiyi olmayan şeylərin hamısı öldü və müstəqil olaraq müasir quş dimdiyi olan bir neçə şey sağ qaldı".

Niyə dinozavrların ilk dimdiyi 85 milyon il əvvəl yetişdirdiyini söyləmək çətindir. Amma Bhullar bunun əllərlə əlaqəsi olduğunu düşünür. Velociraptor kimi teropodların ovlarını qapmaq üçün uzun, caynaqlı dino əlləri var idi. "O nəhəng əllər quş qanadının qurulduğu iskeledir" deyir və nəticədə daha səmərəli uçuş üçün əllər və barmaqlar da itirildi.

Bhullar deyir ki, dimdiklər məhz həmin təkamül anında meydana çıxdı. Əgər qarğanın aləti manipulyasiya etmək üçün dimdiyindən istifadə etdiyini görmüsünüzsə, dimdiyin dəqiq alətinin bir cüt əlin dəqiq alətini necə əvəz edə biləcəyini görmək çətin deyil.

Sual, "gaga nədir?" onların haradan gəldiklərini və molekulyar səviyyədə genlərin inkişaf etməkdə olan embrion üzərində necə hərəkət etdiyini başa düşmək üçün başlanğıc nöqtəsidir. Və oradan bir dimdik açıla bilər.

Bhullar heç vaxt dino-burunlu toyuqlarını yumurtadan çıxarmadı, çünki təcrübənin məqsədi bu mutant canlıların yumurtadan çıxa, nəfəs ala, yemək yeyə və gəzə bildiyini görmək yox, inkişaf yollarını araşdırmaq idi. Bəli, başlarının balaca körpə dinozavr başlarına bənzədiyini təsdiqləmək üçün onların kəllə sümükləri qabıqda kifayət qədər inkişaf etdikdən sonra onlar dayandırıldı.

Qeyd edək ki, Bhullar bunu yaxşı bacaracaqlarını düşünür. "Hər şey bir növ mütəşəkkil görünür, onlar çox qarışıq və ya deformasiyaya uğramış görünmürdülər, sadəcə dəyişdiriliblər."

O deyir ki, bir toyuqdan daha dinozavr kimi görünən bir şeyə keçmək üçün bu kiçik düzəlişlərin çoxu lazım deyil. Və bu gün bunu etmək üçün texnologiyamız var. Yeganə problem, genetik kodun hansı kiçik hissələrinin dəyişdirilməsi və dəyişdirilməsinin lazım olduğunu tapmaqdır.

“Bunu etmək üçün mövcud resurslardan və mövcud resurslardan istifadə etməkdən danışırıq və bizi həqiqətən məhdudlaşdıran yeganə şey, genomun hansı hissələrinin bu dəyişiklikləri həqiqətən idarə etdiyinə dair əsas elmi anlayışımızdır. Əgər kimsə gələcəkdən gəlsə və bizə sözün əsl mənasında Word sənədi versəydi - bu, yəqin ki, cəmi iki səhifə uzunluğunda olmalıdır - alliqator və quş arasında dəyişmək üçün genomun uzantılarının siyahısı ilə, biz qızıl olardıq. Biz bunu indi edə bilərdik”.

Bu bölmələri tam olaraq nə ilə dəyişdirmək eksperiment məsələsi olardı. Quşların və dinozavrların ən yaxın qohumları olan alliqator və ya timsahdan istifadə edə bilərsiniz. Siz həmçinin quşların və timsahların son ortaq əcdadının genomunu rəqəmsal olaraq rekonstruksiya etmək üçün kompüter proqramından istifadə edə və onu əvəzedici DNT-niz üçün istifadə edə bilərsiniz.

Bütün bunlar kiçik seqmentləri daxil etməklə, çıxarmaqla və ya əvəz etməklə genomları çox incə səviyyədə redaktə etməyə imkan verən CRISPR adlı yeni texnologiya sayəsində baş verə bilər. Bhuların dediyinə görə, bu, "tamamilə dəyişdiricidir, şırınga realdır - CRISPR heyrətamizdir."

Əlbəttə, amma burada bir şey var: biz bütün genomları sıfırdan sintez edə biləcəyimiz dünyadan çox da uzaqda deyilik. Və o zaman işlər daha da qəribələşəcək. Bir quş və timsahın ortaq əcdadı üçün yenidən qurulmuş genom? Biz bunu edə bilərdik. Bhullar hazırda timsahın erkən əcdadına aid fosil üzərində işləyir və bu, tazı kimi qurulmuş kiçik quruda yaşayan yırtıcı dinozavrlara bənzəyir - bu, belə bir şeylə nəticələnə bilər.

“Və ya, genomlara baxmaq üçün əlimizdə olan müqayisəli kompüter proqramından istifadə edərək, siz deyə bilərsiniz: “Yaxşı, əvvəlcə ata-baba formasını yenidən qurun, amma sonra onu bir az daha quş tərəfinə bənzətmək üçün onu qaldırın”. Bir növ ağacı quşlara doğru uzatmaq, dinozavrların təkamülündən keçmək kimi bir şeydir” deyir. "Məhz edirəm ki, nəhayət bir az, məsələn, velociraptor alacaqsınız."

Genomları bütövlükdə sintez edə bilsək belə, biz tam olaraq T.rex yarada bilmərik, çünki bizdə dinozavr DNT-si qorunub saxlanmayıb. Nəyə baxmayaraq Yura parkı İnanırsınız ki, genetik material 65 milyon ildən çox yaxşı saxlanmır.

Bəs bu yaxınlarda nəsli kəsilmiş canlılar? Biz onları düzəldə bilərdik. “Bizdə heyrətamiz olan Neandertal genomu var. Bizdə ağılları qarışdıran mamont genomu var”, - Bhullar deyir. "Kimsə mütləq Neandertalları geri qaytaracaq və bu, çox maraqlı olacaq və birdən Yer üzündə iki insan növü olacaq."

Aydındır ki, bunların hər hansı birinin edilməsinin etik mülahizələri olduqca ağırdır, buna görə də Bhullar, hələlik, dimdiyi olmayan toyuq embrionlarının yalnız fərziyyəni təsdiqləmək üçün lazım olan nöqtəyə qədər inkişaf etməsinə icazə verilən fundamental elm dünyasında yaşamaqdan məmnundur. .

"Bu, mənim atılmaq istədiyim bir şey deyil, amma hələ də bu baş verəcək, dizayner orqanizmlərin dövrü bizi gözləyir" deyir. “Kəşflərə əsaslanan işimlə məşğul olmaq və dünyanı anlamaq və insanların biliklərini və insanların həyatlarından məmnunluğunu, inşallah onların şəfqətini və anlayışını artırmaqla dəyişdirməyi üstün tuturam, nəinki bütün bunları genetik olaraq sərbəst buraxaraq dəyişdirmək istərdim. dəyişdirilmiş orqanizmlər."

"Gələcək həqiqətən maraqlı olacaq və insanların özlərinə verməli olduqları çoxlu suallar və açıq cavabı olmayan çoxlu suallar olacaq."


Yaradılış Araşdırmaları İnstitutu

Dinozavrların DNT-sini tapmaq təkamülçü üçün düz bir yer tapmağın bir coğrafiyaçı üçün ağlasığmaz olduğu qədər ağlasığmazdır. Bunun səbəbi, DNT-nin milyonlarla il davam edə bilməyəcək qədər tez çürüməsidir. Beləliklə, mümkün dinozavr DNT-si haqqında son hesabat dünyəvi elm adamlarının müqavimətini görəcəyini vəd edir. Lakin yeni DNT-nin çürüməsi məlumatları ilə birləşərək, təkamül zamanına qarşı güclü bir arqument yaradır.

Fosil mütəxəssisləri uzun müddət orijinal dinozavr toxumalarını və biokimyəvi maddələri tədqiq ediblər. Montanadan olan tiranozavr və hadrozaur sümüklərinə mikroskop altında baxıldıqda, onlarda osteosit adlanan təzə görünüşlü sümük hüceyrələrinin olduğu aşkar edildi. Tədqiqatçılar hətta 2009-cu ildə kollagen və elastin adlı orijinal və minerallaşdırılmış və mdashdinosaur zülallarını təsdiqlədilər.

Jurnalda yeni hesabat Sümük aktin və PHEX adlı onurğalılara xas zülalları müəyyən etdi. O, həmçinin dinozavr hüceyrələrindəki DNT-ni təsvir edir. 2

Bir çox dünyəvi elm adamları, fosillərin dərinliklərində tapılan sürətlə çürüyən biokimyəvi maddələrin dilemmasını həll etməyə çalışaraq, bakteriyaların canlıların fəlakətli şəkildə basdırılmasından bir müddət sonra sümüyə süründükdən sonra onları əmələ gətirdiyini iddia etdilər. Bakteriya ideyasını təkzib etməyin bir yolu yalnız heyvan zülallarını tapmaqdır.

Tədqiqatçılar məhz bunu etdilər. Onlar həmçinin osteositlərə iki fərqli DNT-həssas ləkə tətbiq etdilər. Hər iki ləkə DNT-ni çoxdan ölmüş dinozavr hüceyrələrinin içərisində və hüceyrənin nüvəsinin olması lazım olan mərkəzi yerdə vizuallaşdırdı.

Onlar həmçinin histon H4 adlı DNT-qablaşdırma zülalına bağlanan bir antikor tətbiq etdilər bakteriyalarda histon H4 yoxdur, lakin onurğalılarda var. Antikor hədəfini bağladı və başqa bir orijinal onurğalı zülalını təyin etdi. Histon isə hüceyrələrin içərisində eyni nüvəyə bənzər mərkəzi bölgədə oturmuşdu. Ləkələr və antikorlar nə hüceyrənin digər hissələrini, nə də dinozavr fosillərini əhatə edən çöküntüləri bağlamırdı. Bir sözlə, bu araşdırma orijinal dinozavr zülallarının və DNT-nin varlığını güclü şəkildə dəstəklədi.

Dinozavr hüceyrələrində, şübhəsiz ki, DNT var və o, orijinal dinozavr DNT olsaydı, gözlənilən yerdə oturur. DNT ardıcıllığı olmadan tam əmin olmaq çətindir. Bununla belə, elm adamları müxtəlif fosillərdən, o cümlədən dinozavr sümüyündən qədim DNT-nin olduğunu bildirdilər. 3

Əgər dinozavr DNT-sidirsə, ayrı bir araşdırmanın nəticələrinə görə onun milyonlarla il yaşı ola bilməz. Alimlər Yeni Zelandiyanın Cənubi Adasında yaşayan nəsli kəsilmiş nəhəng moa quşunun 158 qədim ayaq sümüyünü tədqiq ediblər. Tədqiqat müəllifləri görünməmiş ciddiliklə DNT-nin çürümə sürətini yaratdılar. 4

Moa tədqiqat qrupu orta yerli temperaturda DNT-nin yarı ömrünü 521 il olaraq ölçdü. 5 Bu müddətdən sonra heyvanın öldüyü zaman mövcud olan DNT miqdarının yalnız yarısı qalmalıdır. Və başqa 521 ildən sonra, yalnız yarısı ki qalır və s. heç biri qalmayana qədər. Bu sürətlə, sümükdəki DNT molekulları yalnız 10.000 ildən sonra müasir texnologiyanın ardıcıllığı üçün çox qısa olan kiçik kimyəvi seqmentlərə parçalanır. Və bu nəticə biokimyəvi uzunömürlülüyü optimallaşdıran qorunma amillərini nəzərdə tutur.

DNT yarım milyon il davam edə bilmədi, lakin paleontoloqlar DNT-ni milyonlarla il yaşı olan nümunələrdə təsvir edirlər. Milyonlarla illik ehkamdan imtina etmək bu dilemmanı həll edərdi. Aydın şəkildə aşkar edilmiş dinozavr zülalları və dinozavr DNT-yə bənzəyən şeylər, əgər onları ehtiva edən yer təbəqələri yalnız minlərlə il əvvəl Nuhun Daşqını tərəfindən yatırılıbsa, məna kəsb edir.

  1. Schweitzer, M. H. et al. 2009. Kampanian Hadrosaur B. Canadensisin Biomolekulyar Xarakteristikası və Zülal Ardıcıllığı. Elm. 324 (5927): 626-631.
  2. Schweitzer, M. H. et al. 2013 Dinozavr osteositlərinin molekulyar analizləri endogen molekulların mövcudluğunu dəstəkləyir. Sümük. 52 (1): 414-423.
  3. Vudvord, S. R., N. J. Veyand və M. Bunnell. 1994. Təbaşir Dövrü Sümük Fraqmentlərindən DNT Ardıcıllığı. Elm. 266 (5188): 1229-1232.
  4. Allentoft, M. E. və başqaları. 2012 Sümükdə DNT-nin yarı ömrü: 158 tarixli fosildə çürümə kinetikasının ölçülməsi. Kral Cəmiyyətinin əsərləri B. 279 (1748): 4224-4733.
  5. Bu təqvim illərini təxmin etmək üçün radiokarbon illərindən istifadə etməklə kalibrlənmiş moa mitoxondrial DNT-nin 242 bp bölgəsinin yarı ömrüdür.

* Cənab Tomas Yaradılış Araşdırmaları İnstitutunda Elm Yazıçısıdır.

Bu məqaləyə istinad edin: Thomas, B. 2013. Dinozavr sümüklərindəki DNT? Fəaliyyətlər və Faktlar. 42 (1): 15.


Budur, niyə biz bir dinozavrı klonlaya bilmərik ’, amma toyuq-zavr yarada bilərik

Şəkli tam ekranda baxın
  • şərhlər Şərh yazın
  • facebook Bu elementi Facebook-da paylaşın
  • whatsapp Bu elementi WhatsApp vasitəsilə paylaşın
  • twitter Bu elementi Twitter-də paylaşın
  • e-poçt Bu səhifəni e-poçt vasitəsilə kiməsə göndərin
  • daha çox Bu elementi paylaşın
  • daha çox Bu elementi paylaşın

TORONTO –-in açılışı ilə Yura Dünyası Bu həftə hər kəs bir daha soruşur: “Dinozavrları klonlaya bilərikmi?” Cavab asandır: Xeyr.

Ancaq hekayədə yalnız klonlaşdırmadan daha çox şey var.

DNT — deoksiribonuklein turşusu — bütün canlıların genetik kodunu saxlayır. The Yura parkı İdeya budur ki, qədim bir ağcaqanad dino qanı ilə yemək yeyəcək və sonra bəlkə də ağac qatranına ilişib öləcək.

Milyonlarla il sonra biz ağcaqanad və dinozor qanına rast gəlirik və sonra genetiklər ağcaqanadın son yeməyindən DNT çıxarmaq üçün öz sehrlərini işlədirlər və sözügedən ağcaqanaddan əsəbiləşən dinozavrı bərpa edirlər (T-rex-in məyusluğunu təsəvvür edə bilərsinizmi? ağcaqanad vurmağa cəhd edərdiniz?). Məsələ ondadır ki, bu, sadəcə olaraq, sehrdir.

Demək olmaz ki, genetiklər heyrətamiz şeylər etməyiblər (düşünmək: ümumiyyətlə klonlaşdırma). Sadəcə olaraq o dinozavr DNT-sini əldə etmək çox çətin olur.

Alimlər əslində ağac qatranından DNT çıxarmağa çalışıblar. 2013-cü ildə Mançester Universitetində tədqiqatçılar tərəfindən aparılan bir araşdırma, 60 ilə 10,600 il arasında olan kopalda (ağac qatranı) qorunan böcəklərdən DNT-nin çıxarılmasının həşəratların özlərindən heç bir DNT əldə etmədiyini göstərdi.

İZLƏ EDİN: Albertada yeni kəşf edilmiş dinozavr növləri aşkar edilib

Problem ondadır ki, qatran molekulyar səviyyədə yüksək məsaməlidir və qazların içəriyə və xaricə getməsinə imkan verir. Bir vaxtlar mövcud olan hər hansı DNT tamamilə parçalanacaqdı.

Fosillərdən DNT çıxarmağa gəlincə, elm adamları bunun da qeyri-mümkün olduğunu deyirlər, çünki DNT fosilləşmə proseslərindən sağ çıxmır. Sümüklər, üzvi maddələr minerallarla əvəz olunmaqla, mahiyyətcə daşa çevrilir.

Ancaq bu, bu canlıları keçmişdən geri gətirməkdə olan ictimai heyranlığı dayandırmır.

“Biri bunu belə yekunlaşdırdı ki, onlar böyük, şiddətli və nəsli kəsilmişdirlər,”, Albertadakı Kral Tyrrell Muzeyində Dinozavrların Kuratoru Donald Henderson dedi. “Beləliklə, onlar həqiqətən yaşayan canavarlardır, lakin bizdən təhlükəsiz şəkildə uzaqdadırlar.”

Və onların böyük ölçüləri bəlkə də başqa bir səbəbdir.

“Orta dinozavr bugünkü adi heyvandan təxminən 10 dəfə böyükdür.”

Bəs elm adamları nəsli kəsilmiş heyvanları yenidən yaratmağa çalışmalıdırlar? Ola bilərmi ki, onlar odla oynayırlar? görüldü Yura Parkı?)?

“Bəzi insanlar üçün çoxlu elmi təfəkkürün təbiətindədir, yəni bunu edə bilsəniz, cəhd etməlisiniz, çünki ondan nə çıxacağını heç vaxt bilmirsiniz””, Henderson bildirib.

McGill Universitetinin professoru və Onurğalılar Paleontologiyası üzrə Kanada Tədqiqat Kafedrası Hans Larsson, “Mən həmişə dinozavrların çox pis ələ keçirildiyini düşünürəm.”. “Düşünürəm ki, bu asteroidin zərbəsi üçün deyildi, onlar bu gün də dominant quru heyvanları olacaqlar.”.

Dinozavr qurmaq

Sonuncunun təxminən 4000 il əvvəl öldüyü güman edilən yunlu mamontun geri qaytarılması haqqında danışılır. Elm adamları 2013-cü ildə Sibirdə tapılan yunlu mamontun qalıqlarından 43 min illik DNT çıxara biliblər. Plan onu mamontun yaşayan ən yaxın qohumu olan filin DNT-si ilə birləşdirməkdir.

“Onları geri gətirmək əyləncəli olardı. Onlar heyrətamiz heyvanlardır,” Henderson dedi. “Nəhəng dişləri olan nəhəng, tüklü fili təsəvvür edə bilərsinizmi? Bu olduqca möhtəşəm olardı. Bəlkə də bu, dinozavrları geri qaytarmağa ən yaxın vaxtımızdır.”.

İZLƏ EDİN: Yünlü mamont kəşf edildi

Bəs dinozavr DNT-sini əldə etməyə gəlincə?

“Nəsli kəsilmiş dinozavrlardan orijinal, bütöv DNT tapmaq ideyası, o qapı demək olar ki, bağlıdır.”

Ancaq dinozavr xüsusiyyətlərini yenidən oyatmaq imkanı var.

Quşların dinozavrların əcdadları olduğunu eşitmiş ola bilərsiniz. Amma onlar əslində dinozavrların özləridir.

“Quşların dinozavr olduğunu bilirik” dedi Larsson.

Və məlum oldu ki, toyuq dinozavrlara ən yaxın olanıdır. Əslində, o qədər yaxındır ki, dinozavr kimi görünmək üçün yatmış, qədim genetik xüsusiyyətləri yenidən oyatmaq üçün araşdırma aparılır. Bu, ‘chickenozaurus’ layihəsi adlanır.

“Əgər biz toyuq embrionları və toyuq genetikası ilə işləyiriksə, biz dinozavr embrionları və dinozavr genetikası ilə işləyirik.”

İZLƏ: TED çıxışı “Toyuqdan dinozavr yaratmaq”

Genetiklər toyuq lələklərini sıxışdırmaq və ya pəncələrini və ya pulcuqlarını yenidən böyütmək üçün genetik xüsusiyyətləri manipulyasiya edə bilərlər. Dişlərə gəlincə, məlum olur ki, quşlar mina düzəldə bilməzlər. Onlar diş qönçələri düzəldə bilərlər, amma bu belədir. Elm adamları siçan kimi başqa bir növün DNT-si olan bir quş mənasını verən transgen quş yaratmalı olacaqlar.

“Siz bir daha tam velociraptor əldə etməyəcəksiniz, amma daha az quş və daha çox nəsli kəsilmiş dinozavr olan bir şey əldə edə bilərsiniz,” Larsson dedi.

“Biz həqiqətən dinozavrlar etmək üçün tərs mühəndislik toyuqlarından danışmırıq. Biz əslində deyirik ki, gəlin dinozavrlara çox bənzəyən bir şey yaratmaq üçün bir genomu işləyək.”.

Mutasyona uğrayan genlər ilə atavizm adlanan hərəkətsiz xüsusiyyətlərin yenidən oyanması arasında fərq var. Atavistik xüsusiyyətlərin yenidən oyanması isə açarı çevirmək qədər sadə deyil: genlər bir-birinə kodlanır ki, siz birini manipulyasiya etdiyiniz zaman digərinə təsir etsin. Larsson, bir xüsusiyyəti aktivləşdirməyin nəticələrini görmək üçün daimi bir sınaq olduğunu söylədi. Onun laboratoriyası toyuqun qədim quyruğunun yenidən aktivləşdirilməsi üzərində işləyir (toyuq rüşeyminin yumurtadan çıxmasına icazə verilmir).

View image in full screen

Larsson said that there are practical applications to being able to create something by altering the genomes, such as the work he and other scientists are doing with the chickenosaurus.

“Imagine taking a corn seed and planting it to grow a house. If we could actually engineer the genome in plants to grow shapes that we find useful, like house-shapes, or furniture shapes,” he said. “None of these are impossible, if we could fully understand how the genome works to create complex anatomy. It’s getting really sci-fi.”

So how long before we see the chickenosaurus?

Larsson said that funding for this kind of research is paltry in both Canada and the United States. In a perfect world, with no limit to funding, he estimates that they could make the chickenosaurus within five years. Instead, with the existing funding, it will take his lab the same time just to figure out the chickenosaurus’s tail.

While Yura parkı will remain the stuff of science fiction, chin up: there’s still the possibility we’ll create scary-looking monsters developed from chickens.


Understanding the Difference in Cloning and Reverse Engineering

When we are talking about the evolution of dinosaurs, we need not look further than our feathered friends. Birds may not strike the same fear in most that a tyrannosaurus would, but they’re still genetic relatives.

So we have chicken genomes and plenty of DNA to go off of – would it be possible for scientists to manipulate that genetic data and make it closer to a dinosaur than a bird? What if scientists added a long tail, rows of sharp teeth, and more size – would it be a dinosaur?

In terms of looks and functionality, perhaps – it would be as close to a dinosaur as we’ll ever see in the modern age. And even while they have DNA and traits in common, there’s no reason to think it would be the same as cloning a dinosaur.

In that case, it would merely be a creature that was reverse engineered and manipulated to give the appearance of a dinosaur. Because it lacks the true genome of these beasts, it is not the same as being cloned.

Cloning is a tricky concept, especially when we’re dealing with animals that are no longer on the earth anymore. The idea of cloning dinosaurs is possible, but it will require scientists to find the right genetic material.

This is a hard task, as the material is not only in scarce amounts but it is prone to breaking down quickly over time. But the search is on and the goal is in sight.


Cavab verin

Kat - Now it's time to look at your burning genetics questions, with the help of Naked Scientist Martha Henriques.

Martha - This month, listener Steve Cherry from Lethbridge, Alberta in Canada wanted to know how researchers extract dinosaur DNA from fossils and separate it from contaminant DNA from other organisms. Firstly, the bad news is, that no one has yet successfully isolated DNA from dinosaur fossils. Dr. Greger Larson from Durham University told me how DNA is isolated from fresh biological specimens and why doing the same for ancient specimens like dinosaur remnants is so difficult.

Greger - The way that we usually do it is to simply remove everything that isn't DNA and filter it off and that leaves us with the small tube that only has the DNA left in it. Of course, DNA exists in every single living organism, so we can't discriminate between all the different possible sources of DNA. All we can do is isolate DNA from everything that's non-DNA. And once we've got that in a tube then we can start to do all kinds of things including sequencing it or going after specific markers, or amplifying specific places, but the act of isolating it is a relatively straightforward process and we can do it from any number of things including skin cells or feathers or bone, or teeth, or anything that's biological and that is alive or was recently alive, we can isolate DNA from.

Martha - But when it comes to ancient specimens like dinosaur fossils, the chance of success with this method becomes vanishing small.

Greger - As soon as something dies, everything about that thing starts to degrade. So, the analogy would be, the bowl of fruit that you probably have in your kitchen and if you were just to leave that bowl of fruit there for a day or two, it'll be fine, but if you leave it there for a month, it will probably be no longer something that's even remotely appetizing. And if you leave it there for a year, it would be hard to differentiate the different kinds of fruit you had in that bowl a year before and if you leave it there for 20 years, there probably won't be anything even remotely resembling fruit in there and DNA is no different.

The longer that an organism is dead, the more of the DNA degrades and it degrades at a rate which is dependent upon lots of different factors including how long it's been, what temperature it's being stored at, or what sort of other organisms are eating it, or any number of other things. But even in the best case scenario where you have something frozen say, in the tundra where it's very cold, the half-life of DNA is somewhere in the order of maybe 100 or 200,000 years which means, half of the amount of DNA that you start with will be gone after about 100 and 200,000 years.

So, the reason it's difficult to get DNA out of dinosaur bones is simply because there is no DNA left. The same reason that if you were to leave the bowl of fruit on your kitchen table for 65 million years, the chances of you being able to come back and get any fruit out of that would be virtually nil. So, any reports that there's been of dinosaur DNA, they're either not reporting dinosaur DNA or they're reporting other bits of DNA that they've isolated that don't have anything whatsoever to do with that dinosaur bone.

Martha - This contaminant DNA is a problem for all work on ancient biological specimens. Dr. Mim Bower of Cambridge University worked from isolating DNA from prehistoric horse remains preserved in icy environments. These well-preserved specimens are much younger than dinosaur fossils and still have some of their original DNA present. Dr. Bower describes how she distinguishes any contaminant DNA from the horse DNA that she's interested in.

Mim - So, for every sample of bone that we try to extract DNA out of, we also examine a number of controls so that each time I do a DNA extraction, I work with a set number of 6 control reactions which have exactly the same components in except for the bone particle and that helps me control whether there is a DNA coming from me, or from the environment, or from the reagents that I'm using because if I see a positive DNA peak in my control samples which should have nothing in them then I know that I have made an error somewhere and I go back and I start again, and I'd clean everything down. So, we have a very strict contamination protocol nowadays and I have to say that most DNA researchers who are experienced can work very cleanly. And when we don't work cleanly, we can immediately see what has gone wrong and put it right.

Martha - That was Greger Larson from Durham University and Mim Bower from Cambridge University.


Birds are dinosaurs

The recognition that birds are dinosaurs is an idea that has been proven beyond reasonable doubt in the last 20 years, and also gives us new clues on what extinct dinosaurs might have been like.

Sinosauropteryx was the first dinosaur found to have feathers, other than birds and their immediate relatives. It was covered with simple filament-like feathers, which you can see preserved along the back and tail of this fossil. Scientists have even established that this dinosaur's tail had a striped colour pattern. © Sam Ose and Olai Skjaervoy, licensed under CC BY 2.0, via Flickr

As living dinosaurs, birds can be used to test some of the ideas that palaeontologists have proposed based on bones alone. They also carry a direct genetic legacy of their dinosaurian ancestry, which means that bird genes are dinosaur genes, even though birds represent only one specialised branch of the dinosaur family tree.


Yaradılış Araşdırmaları İnstitutu

In church, a friend asked me about the movie Jurassic World. Its high-tech presentation makes the idea of scientists resurrecting dinosaurs from DNA &ldquomined&rdquo from fossils almost seem believable. What parts can we trust, and what parts can we toss?

Good science supports about as many of this movie&rsquos major science-sounding concepts as it does those of recent superhero movies&mdashi.e., very few.

First, the movie&rsquos creators seem to have matched giant sauropods to their sizes known from fossils, but real dinosaurs hatched from small eggs and took several dozen years to get that big. Nobody can accelerate a creature&rsquos growth, and there wasn&rsquot enough time for them to achieve that size. Plus, many other dinosaurs appear much larger in the movie than they ever were when alive.

Much of the movie shows unrealistic technology. Geneticists have made incredible discoveries in the last few decades, but with each new detail they uncover, they find another mind-boggling feature of living creatures. Animal anatomies, genetics, and developmental regimes are so complicated we may never understand them well enough to manipulate them like the fictional geneticists in Jurassic World did. The human body accesses over 200 interactive genes involved in height alone. And many of the genes used during embryonic development perform important separate functions later in life, showcasing the awesome ingenuity of our great Creator. Geneticists would not know where to begin manipulating such a vast network of incredible complexity to produce a new type of creature from living animal genes&mdashlet alone an extinct animal like a dinosaur.

Speaking of which, no scientist has yet brought an extinct creature back to life from just its DNA, much less from isolated and degraded fragments of ancient DNA. It takes a mother to make a baby. It would be amazing indeed to make a machine that mimics all the complicated and wonderful features of a mother&rsquos egg and a mother&rsquos body. The opening scene of Jurassic World shows a dinosaur hatching from an already mature egg. They don&rsquot show how that egg got there&mdashwhere&rsquos the required mother? Scientists cannot craft eggs. The mere shell of a dinosaur egg consisted of precisely interwoven protein fibers and minerals thin enough to permit gas exchange but thick enough to protect the baby dinosaur.

Good science can achieve wonderful feats, but it cannot work miracles or magic. It cannot make a baby out of just DNA.

And what about the idea in Jurassic World that iron plus &ldquohydroxyl&rdquo can cause special chemical reactions that somehow preserve animal tissues&mdashand maybe even DNA&mdashfor millions of years? The scriptwriters needed a scientific-sounding basis for asserting that DNA buried in the earth stayed in good enough shape for geneticists to read its stored information even after that length of time. But this iron rescuing device fails for two reasons. First, although iron discourages bacterial growth, iron plus hydroxyl shreds proteins and DNA. In contrast to the assertions about iron&rsquos preserving power, experiments show it destroys tissues. 1 Second, researchers find few signs of iron or hydroxyls when they uncover bone proteins in fossils. Iron can do amazing things like help transport oxygen and conduct electricity, but it cannot halt or reverse the inevitable chemistry involved in the decay of proteins over time.

Jurassic World packs plenty of pure fiction into a literally unbelievable thriller. Here in the real world, incredibly complicated gene networks reveal the Creator&rsquos masterful mind. This fits with Genesis creation. Also, proteins and DNA found in fossils show that Earth&rsquos sedimentary layers are quite young. This fits the Bible&rsquos timeline. TheJurassic World filmmakers did a nice job making science-sounding concepts appear reasonable, but as usual, real science supports Scripture, not fiction.

  1. &ldquoDue to its strong reactivity with biomolecules, hydroxyl radical is capable of doing more damage to biological systems than any other ROS [reactive oxygen species].&rdquo Prousek, J. 2007. Fenton chemistry in biology and in medicine. Pure & Applied Chemistry. 79 (12): 2325&ndash2338.

Image credit: Copyright © 2015 Jurassic World Universe. Adapted for use in accordance with federal copyright (fair use doctrine) law. Usage by ICR does not imply endorsement of copyright holders.

* Mr. Thomas is Science Writer at the Institute for Creation Research.


Jurassic World science: can we clone dinosaurs?

Genetic engineers are working to restore extinct species to life, but doing so involves solving a massive jigsaw puzzle with missing pieces.

When he visited the George Poinar's lab in the 1980s, author Michael Crichton saw a way to lend plausibility to the plot of his novel-in-progress 'Jurassic Park'. Poinar was working to discover whether amber's ability to preserve the tissues of insects and other tiny creatures could also protect the DNA locked away inside the cells of those tissues.

In a case of life imitating art, Poinar gave samples of amber to his son Hendrik who teamed up with Raul Cano of California Polytechnic. Cano had developed and subsequently patented a process for extracting DNA from organisms trapped in the yellow resin. They extracted fragments of DNA from an ancient, stingless bee and then more extensive samples from a weevil that lived 120 million years ago - almost twice as long ago as the cataclysm that wiped out dinosaur species such as Tyrannosaurus rex.

The paper on the recovery of DNA from the weevil appeared in the journal Təbiət a day after the movie's premiere in Washington DC. It seemed that the idea of bringing long-extinct species back to life might be possible, even if they were only insects.

However, attempts to reproduce the original results failed and realisation dawned that the amber samples were hopelessly contaminated &ndash much of it from the DNA of modern bacteria that had either colonised the samples, or had been picked up in the lab itself. The idea of being able to sequence the DNA of a mosquito trapped in amber millions of years ago, let alone any dinosaur DNA rapidly faded.

Ice-age revival?

But the more stringent lab protocols developed by scientists such as Svante Paabo &ndash together with increasingly sophisticated extraction techniques &ndash have yielded usable ancient DNA from other long-extinct species, including our own Neanderthal relatives.

Ice-age species such as these and mammoths show prospects as good as any for revival. It's not just the relative youth of the fossils that helps. Some people want to go ahead and bring them back in the hope of reviving lost ecosystems.

Stewart Brand, president of The Long Now Foundation and the architect of the group's 'Revive and Restore' project, says: "Because it's cold in the Arctic and sub-Arctic, the DNA is relatively intact."

But ice-age DNA is in far worse condition than any DNA that can be extracted from the living. And all but the most recently extinct species yield DNA that is not in the form of whole chromosomes millions of base pairs long. Beth Shapiro, scientist and author of a recently published book on the practicality of de-extinction, describes it as "more like confetti that's been run over by mammoths in the rain".

Paabo says of the experiments conducted on Neanderthal samples: "The DNA fragments are very, very short. Just 50 or 60 bases. And even the best bones result in just 3 or 4 per cent Neanderthal DNA. The rest are from bacteria that colonise the bones."

Even the constituent bases that make up DNA go through chemical changes as the polymer degrades. Cytosine &ndash the 'C' in the familiar four letter 'GTCA' genetic code &ndash is often changed to uracil. In turn, this leads to errors in sequences, because the biological agents that generate multiple copies of a DNA strand to provide sequencing machines with more raw data miscode uracil, inserting a T for thymine rather than a C. Other chemical changes stop the enzyme that creates DNA copies in its tracks, yielding even less information from the highly fragmented chains.

Chemical error correction has made it possible to recover from many of these problems. But there are still problems for de-extinction proponents. Describing the process used to construct what is, for the moment, the best sequence for Neanderthals, Paabo says: "We sequenced a little over a billion fragments from the DNA recovered from the bones. Parts were missing but in the end we had a little over half the total genome."

Not only is a large portion of the DNA missing, there is no way to determine from the DNA itself how it should be structured in a reconstituted genome. Bioinformatics, biology's IT-oriented arm, can deal with some of the problems. Because individual strands of DNA will break down in different ways, there are often overlapping segments. By comparing these segments, computer software can piece together large parts of the molecular jigsaw puzzle of ancient DNA. By comparing the DNA to the genomes of modern species, it often determines whether they are contaminants. But some parts of the genome are currently beyond our reach for another reason.

Shapiro says: "How many genomes have been completely sequenced? None. Not even our own genome, for which a ridiculous amount has been published."

Missing links

Potentially important missing components are lengths of DNA called heterochromatin. The problem for sequencing heterochromatin is that it is highly repetitive and the repeating sequences are very short. There is no practical way for software, using the data that comes from sequencing machines, to determine how many repetitions there should be because overlaps produce little useful additional information.

The role of heterochromatin is fuzzy, but it seems to have a role in regulating when and where genes are active. As regulation of genes is a key factor in the developing embryo, subtle changes to heterochromatin could result in massive modifications to the organism. Without more information on heterochromatin's role, it is impossible to determine what ancient DNA sequences should even begin to look like. But this need not stop the de-extinction process.

Crichton's other plot element used both for biological plausibility and to deliver the novel's warning &ndash weaving together genes from today's species with those from ancient DNA &ndash may provide the template for de-extinctions in the short to medium term. It is likely to make more sense to start with modern DNA and add in the elements needed to reproduce the ancient species, as the heterochromatin and other poorly understood parts of the genome are already in place. Based on the genomes performed so far, the Asian elephant seems to be a closer relative to the mammoth than the African elephant. This has given geneticists hope that relatively simple changes could result in a surrogate mother elephant giving birth to a baby mammoth. "We could have the first mammoth embryo in three years' time," Brand claims.

George Church's group at Harvard University in Boston, which appears to be in the lead in manipulating elephant DNA to be more mammoth-like, has yet to demonstrate in published research that the genes stitched into elephant eggs result in the mammoth DNA being used even in early development.

But Church's team has developed efficient techniques for editing DNA. Conventional genetic engineering by comparison is hit-and-miss. Church's CRISPR technique makes it possible to insert DNA in a specific part of a chromosome in such a way that the organism is unlikely to reject the addition.

Reverse-engineering DNA to find out how it works is likely to be the only way that dinosaurs &ndash or at least animals that resemble them &ndash could possibly be brought back to life. There are other ways to recover lost DNA information than to sequence the fragments recovered from ancient specimens. A multi-university team realised their chances of finding DNA from a group of species that lived in ice-age South America were remote.

Although a group that included Hendrik Poinar managed to extract DNA from ice-age rodents found in Mexico, the region where these ungulates lived was too warm and wet for even well-preserved specimens to not have their DNA destroyed. But proteins that make up hair and other parts of the body are much more robust. Enzymes insert each amino acid in a protein in the order determined by the DNA sequence of the corresponding gene. Find variations in the proteins and you find how those genes differ from those used by other species. This is also one of the approaches being used by Mary Schweitzer of North Carolina State University, who found remnants of soft tissues and collagen in dinosaur bones. Although the sequences show similarity to bird proteins, they may yet be found to be modern contaminants.

There is another approach. Work has started on uncovering the genetic information that birds discarded over the past 65 million years by, in effect, rewinding their genetic clock. Scientists already think dinosaurs were a lot closer to birds than the giant lizards of popular imagination. In the movies, velociraptors are scaly. A number of fossils have turned up since that give clear indications that the animals were feathered and may even have been able to glide over very short distances.

Turn back the clock

The search for a way back has already begun: with hen's teeth. In 2006, scientists from the University of Wisconsin and the University of Manchester succeeded in coaxing the embryos of chickens to grow teeth similar to those found in dinosaur fossils by reactivating latent genes. Other work, based on the intuition that bird embryos briefly grow lizard-like tails before further development causes them to develop as those of birds, points to a number of individual genes lingering from the days of the dinosaurs that may have mutated very little over millennia because they are still required by the growing organism. Similar work by Richard Borowsky at New York University has given eyes back to blind cavefish, a species that has lost the ability to see since the Pleistocene.

Mutations that render the genes entirely inactive would put the animal itself at risk. What has changed is the framework that puts them to use. By working out ways in which these genes can be reactivated and develop more dinosaur-like features, scientists such as Jack Horner &ndash who acted as consultant on the movie of Crichton's novel &ndash believe it might be possible to reconstruct the creatures by engineering modern bird DNA.

But it's far from clear how much new DNA needs to be synthesised in order to recreate features that have been mutated out completely over millions of years. DNA that is not needed by species quickly turns to junk or is co-opted by other mechanisms in the cell if some of the mutations turn out to be beneficial. Simply rewinding the genetic clock and generating dinosaurs by atavistic mutation of chickens to create what might be called an 'alektosaur' is not a realistic option. De-extinction is likely to need new DNA to be created.

Brand says: "I think it's fair to say this century will be largely defined by intersection between the kind of coding [IT programmers] do and the kind of coding that life does."

But even if radical genetic engineering succeeds in constructing something that looks like a dinosaur, it is clear that it can never bring back what existed more than 65 million years ago. The specific information in those genomes has been chemically shredded forever. Such a chimera would have a lot in common with the beast that underpins the plot of Jurassic World. Maybe life can imitate art.

Sign up to the E&T News e-mail to get great stories like this delivered to your inbox every day.


Videoya baxın: Dinozavir (Iyul 2022).


Şərhlər:

  1. Shashura

    In my opinion the theme is rather interesting. I suggest you it to discuss here or in PM.

  2. Adolph

    Səhv etdiyinizə inanıram. Mən əminəm. Mən bunu sübut edə bilərəm.

  3. Tedrick

    Üzr istəyirəm, mənə yaxınlaşmır. Başqa kim, nə sövq edə bilər?

  4. Eagan

    Bu sadəcə gözəl bir mesajdır.

  5. Ryence

    Axırda nə istəyir?

  6. Sar

    Yaxşı fikirdir. Mən onu saxlayıram.



Mesaj yazmaq