Məlumat

Müəyyən bir fermentin müəyyən bir hüceyrəaltı yerdə meydana gəlməsi təsadüfi bir hadisədirmi?

Müəyyən bir fermentin müəyyən bir hüceyrəaltı yerdə meydana gəlməsi təsadüfi bir hadisədirmi?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Fermentlər müxtəlif subcellular yerlərdə olur. Bəziləri müəyyən bir hüceyrəaltı yer üçün səciyyəvidir, digərləri isə heterojen şəkildə paylanır. Müəyyən bölmələrdə fermentlərin meydana gəlməsinə hansı təkamül qərarları təsir edir? Məkanlar növlərə xasdırmı?


Zülalların hüceyrəaltı orqanellələrə və ya membran yerlərinə yönəldilməsi üçün müxtəlif üsullar mövcuddur. Ümumiyyətlə, onlar zülallardakı “etiket” və ya “siqnal” ardıcıllığından asılıdır. Bu cür işarələr və ya siqnallar zülalı membran maneəsi vasitəsilə xüsusi yerə keçirə bilən xüsusi zülallar tərəfindən tanınır.

Fərqli hədəf yerlər üçün fərdi proseslər fərqlidir, ona görə də burada təfərrüatları təqdim etməyi məqsədəuyğun hesab etmirəm. Onların xülasəsini bu Vikipediya məqaləsində oxuya bilərsiniz. Daha geniş müalicə üçün Lodişdəki müvafiq fəsillərə baxa bilərsiniz və b. və ya Albertsdə və b. on-line (köhnə nəşr).

(Əgər ondan istifadə edirsinizsə, lütfən, Vikipediyaya ianə etməyi düşünün.)


Ansambl təsnifatı və xüsusiyyət seçimi ilə subcellular yer apoptoz zülallarının proqnozlaşdırılması

Apoptoz zülalları orqanizmin inkişafında və homeostazında mərkəzi rola malikdir. Bu zülallar proqramlaşdırılmış hüceyrə ölümünün mexanizmini anlamaq üçün çox vacibdir. Apoptoz zülalının funksiyası onun hüceyrəaltı yeri ilə sıx bağlıdır. Məlum struktur zülalların sayı ilə zülal məlumat bankında məlum ardıcıllıqların sayı arasında sürətlə artan boşluq üçün apoptoz zülalının yerlərini proqnozlaşdırmaq üçün güclü alətlər hazırlamaq çox vacibdir. Bu işdə, effektiv xüsusiyyət çıxarmaq üçün tətbiq olunan ikili hissəciklər sürüsünün optimallaşdırılmasına əsaslanan zülal xüsusiyyətlərinin seçilməsi yanaşmasının nümunəsini təmsil etmək üçün xüsusiyyət dəstləri qurmaq üçün müxtəlif boşluqlara malik amin turşuları cüt kompozisiyalarından istifadə olunur. Ansambl təsnifatı proqnozlaşdırma mühərriki kimi istifadə olunur, bunun əsas təsnifatı qeyri-səlis K-ən yaxın qonşudur. Hər bir əsas klassifikator müxtəlif xüsusiyyət dəstləri ilə hazırlanır. Təklif olunan yanaşmanın performansını təsdiq etmək üçün əvvəlki işlərdə tez-tez istifadə olunan iki məlumat dəsti seçilir. Jackknife testi ilə əldə edilən nəticələr olduqca ümidvericidir ki, təklif olunan metod apoptoz zülalının hüceyrəaltı yerləşməsi üçün potensial olaraq faydalı bir vasitə ola bilər və ya ən azı müvafiq sahələrdə mövcud metodlara əlavə rol oynaya bilər. Matlabda yazılmış əlavə məlumat və proqram təminatını müvafiq müəlliflə əlaqə saxlamaqla əldə etmək olar.

Bu, abunə məzmununun, qurumunuz vasitəsilə girişin önizləməsidir.


Fermentlərin aktiv yerlərinin konvergent təkamülü nadir bir hadisə deyil

Ferment aktiv sahələrinin konvergent təkamülü ilk dəfə serin proteazlarda müəyyən edildiyi üçün bu fenomenin digər fərdi halları sənədləşdirilmişdir. Bununla belə, ferment məkanında bu fenomenin tezliyini qiymətləndirən sistematik bir analiz hələ də yoxdur. Bu iş Zülalların Struktur Təsnifatı (SCOP) verilənlər bazası tərəfindən təmin edilən təkamül məlumatı ilə Katalitik Sayt Atlası (CSA) vasitəsilə əldə edilən katalitik qalıqlar haqqında ilk dəfə ətraflı məlumatı inteqrasiya etmək üçün Query3d struktur müqayisəsi alqoritmindən istifadə edir.

Bu tədqiqat konvergent təkamülün iki rejimini nəzərdən keçirir: (i) əlaqəli, lakin ola bilsin ki, fərqli reaksiyaları yerinə yetirmək üçün eyni mexanizmdən istifadə edən fermentlər olan mexaniki analoqlar (burada EC nömrəsinin ilk üç rəqəmini paylaşan kimi nəzərdən keçirilir) və (ii) transformasiya eyni reaksiyanı kataliz edən analoqlar (eyni EC nömrələri), lakin fərqli mexanizmlərdən istifadə edə bilər.

Nəzərə alınan üç rəqəmli AK qruplarının 15%-də (169-dan 26-da) mexaniki analoqlar müəyyən edilmişdir ki, bu da bu fenomenin nadir olmadığını göstərir. Bundan əlavə, bu qruplardan 11-də transformasiya analoqları da var. Katalitik triada ən geniş yayılmış aktiv sahədir. Struktur müqayisənin nəticələri göstərir ki, bu mexanizm və ya onun variasiyaları 23 super ailədə mövcuddur.

CSA daxilində mövcud olan 951 dörd rəqəmli EC nömrələrindən 45-i üçün transformasiya analoqları müəyyən edilmişdir və bunların təxminən yarısı da aktiv sahələrinin yaxınlaşmasını nümayiş etdirən mexaniki analoqlar olmuşdur. Bu təhlil, həmçinin strukturu SCOP-da təsnif edilən bütün transformasiya analoqlarının tam və əl ilə seçilmiş siyahısını təmin etmək üçün bütün Protein Məlumat Bankına genişləndirilmişdir.

Bu işin nəticələri göstərir ki, konvergent təkamül fenomeni nadir deyil, xüsusən də böyük fermentativ ailələri nəzərə aldıqda.


Flüoresan Mikroskopiya və Təsadüfi Zülal Tagging

Hüceyrəaltı yer eksperimental olaraq subcellular fraksiya, elektron mikroskopiya və ya flüoresan mikroskopiya ilə müəyyən edilə bilər. Sonuncu ən ümumi üsuldur və xüsusi zülalları etiketləmək üçün flüoresan molekulları hüceyrələrə çatdırmaq qabiliyyətinə əsaslanır. Bunu etməyin iki yolu var.

Birinci üsul, immunofluoressensiya mikroskopiyası, çatdırılmasına əsaslanır xarici floresan molekulları hüceyrələrə daxil edir. Hüceyrələr birincidir sabit hüceyrədəki zülalları çarpaz bağlayan, mahiyyətcə bütün hüceyrə komponentlərini hərəkətsizləşdirən bir maddə (məsələn, paraformaldehid) əlavə etməklə. Bu, hüceyrələr növbəti olduqda hüceyrələrin məzmununun yuyulmasının qarşısını alır keçirici, yəni yuyucu vasitə hüceyrə membranını tam və ya qismən həll etmək üçün istifadə olunur. Membran baryerinin kənarda olması ilə istənilən molekulları, məsələn, flüoresan boyalarla birləşmiş antikorları hüceyrəyə daxil etmək mümkündür. Antikorların istifadəsinə alternativ, müəyyən bir zülala bağlandığı bilinən digər spesifik maddələrdən istifadə etməkdir. Məsələn, phalloidin sitoskeletonun əsas komponenti olan F-aktinə bağlanır. Buna görə də, boya ilə birləşmiş phalloidin, aktin sitoskeletonunu etiketləmək üçün istifadə edilə bilər. Belə zondların istifadəsi ciddi şəkildə deyil immunoflüoresan, lakin funksional olaraq eynidir. İmmunofluoresan etiketləmənin bir məhdudiyyəti, hədəf zülala bağlandığı bilinən xüsusi antikorların və ya zondların mövcudluğundan asılılıqdır. Digəri, fiksasiya və permeabilizasiya ehtiyacına görə canlı hüceyrələrlə istifadə edilə bilməz.

İkinci üsul floresan molekulların olmasıdır daxili maraq hüceyrələrində əmələ gəlir. Floresan zülalını (məsələn, eGFP) kodlayan DNT ardıcıllığı, hüceyrədəki endogen zülala təsadüfi bağlanacaq və beləliklə də həmin zülalı flüoresanla işarələyəcək şəkildə tərtib edilə bilər. Bu texnikanın istifadəsinə dair bir neçə nümunə var (12�). Bu üsul hədəf zülala bağlanan antikorların və ya zondların mövcudluğundan asılı deyil, çünki bu yanaşmalarla təsadüfi bir zülal işarələnir. Zülalların təsadüfi etiketlənməsi flüoresan zülalların əvəzinə kiçik epitopların (əsasən zülalın qısa hissələri) istifadəsi ilə də həyata keçirilə bilər (16,17). Bu halda immunofluoressensiya epitop etiketinə qarşı antikordan istifadə edərək etiketlənmiş zülalın yerini təsvir etmək üçün istifadə olunur. Bunun üstünlüyü ondan ibarətdir ki, epitop etiketləri flüoresan zülallardan çox kiçikdir və buna görə də onların bağlandığı zülalın funksiyasını pozmaq ehtimalı azdır. Digər tərəfdən, immunofluoressensiya üçün tələb olunan fiksasiya və rəngləmə hüceyrə strukturlarını poza bilər və bu, canlı hüceyrələrin təsvir edilə bilməyəcəyi deməkdir.

Təsadüfi etiketləmə təcrübələri kifayət qədər təkrar edildikdə, müəyyən bir hüceyrə tipində ən çox (və ya bəlkə də hamısı) zülalları etiketləyə bilərsiniz. Bu üsul flüoresan mikroskopiya ilə birlikdə müəyyən bir hüceyrə tipində zülalların yerləşmə nümunələrini əks etdirən hərtərəfli şəkillər kitabxanasını yaratmağa imkan verir.


Nəticələr

PfSHMTc və PfSHMTm ilə əlaqədar antikor spesifikliyi

The pfshmt gendən P. falciparum (PFL1720w) [41] funksional olaraq şərti sitoplazmik SHMT [21-23] kimi xarakterizə edilən məhsulu kodlayır. Bununla belə, proqnozlaşdırılan SHMT-yə oxşar gen məhsulu (PfSHMTm, PF14_ 0534-də kodlanmış) eyni zamanda 18% amin turşusu eyniliyi və PfSHMTc ilə 44% oxşarlıq ilə ehtimal edilən mitoxondrial siqnal ardıcıllığı [24] daşıyan, lakin demək olar ki, hamısına malik olmayan (16-sı) müəyyən edilmişdir. 21) sitoplazmatik və ya orqanelyar olan digər orqanizmlərin SHMT ortoloqlarında aktiv sahəyə töhfə verən məlum, çox yüksək qorunan qalıqların [42] (Bax Əlavə fayl 2 PfSHMT izoformalarının ardıcıl düzülüşü). Nisbətən aşağı şəxsiyyət səviyyəsinə baxmayaraq, müsbət siqnallar verən zülalın şəxsiyyətinə əmin olmaq üçün yüksəldilmiş anti-PfSHMTc və anti-PfSHMTm antikorlarının spesifikliyini müəyyən etmək vacib idi. Buna görə də hər iki tam uzunluqlu açıq oxu çərçivələri klonlandı Escherichia coli ifadə sistemləri və western blotting üçün işlənmiş bərabər miqdarda protein məhsulları. Anti-PfSHMTc antikoru heteroloji şəkildə ifadə edilmiş qohum zülalı tanıdı (Şəkil 1B) və iki sətirdən, K1 və 3D7-dən ümumi parazit lizatlarının ləkələri, tam uzunluqlu PfSHMTc zülalı üçün də proqnozlaşdırılan ölçüdə (49,8 kDa) tək bir zolaq göstərdi (Şəkil 1). 1D). Əhəmiyyətlisi odur ki, PF14_0534-ün PfSHMTm məhsulu ilə çarpaz reaksiyaya dair heç bir dəlil yox idi (Şəkil 1B), halbuki nəzarət anti-His-tag antikorları hər iki rekombinant məhsulu mahiyyətcə bərabər tanıdı (Şəkil 1A). Bu, qohum antikordan istifadə edərək sonrakı immunofluoressensiya siqnallarının yalnız PfSHMTc-dən yarandığına inam yaratdı. PfSHMTm vəziyyətində, bu antikor bütün zülala qədər yüksəldi (anti-PfSHMTc antikorundan fərqli olaraq), PfSHMTc ilə bəzi çarpaz reaksiya gözlənilməz olmadı və rekombinant zülala qarşı ləkələrdə aydın oldu. Bununla belə, bu, qohum PfSHMTm zülalının tanınmasında müşahidə ediləndən təxminən dörd dəfə az intensiv idi (Şəkil 1C). Parazit ekstraktlarına qarşı anti-PfSHMTm antikorları rekombinant zülal ilə eyni hərəkətliliyə malik üstünlük təşkil edən bir zolaq verdi (Şəkil 1E). Bütün ləkələrdə qeyd edildi ki, PfSHMTm bir qədər yüksək proqnozlaşdırılan molekulyar çəkisinə (55.2 kDa) baxmayaraq, PfSHMTc-dən bir qədər irəlidə getdi. Spesifiklikdəki bu fərqlər bizi belə bir nəticəyə gətirdi ki, aşağıda anti-PfSHMTc ilə yoxlanılan parazitlərin immunofluoressensiya görüntülərində anti-PfSHMTm istifadə edərək istehsal edilənlərdən fərqli olaraq, müvafiq hədəf zülalların paylanmasında bioloji əhəmiyyətli dəyişikliklərin etibarlı göstəricisidir.

Poliklonal anti-PfSHMT preparatlarının spesifikliyi. PfSHMTc (PFL1720w) və PfSHMTm (Pf14_0534) kodlayan genlərdən ifadə edilmiş tam uzunluqlu His-etiketli rekombinant zülal (500 ng) (A) anti-polihistidin IgG, (B) anti-PfSHMTC və (B) ilə yoxlanılır. sonrakı immunofluoressensiya tədqiqatları üçün istifadə edilən anti-PfSHMTm preparatları. Panel D və E anti-PfSHMTc (D) və anti-PfSHMTm (E) ilə yoxlanılmış K1 və 3D7-dən ümumi parazit ekstraktlarının qərb ləkələridir. Rc, rekombinant PfSHMTc Rm, rekombinant PfSHMTm M, əvvəlcədən ləkələnmiş molekulyar çəki markerləri.

PfSHMT izoformlarının sitoplazmik paylanması

Bir sıra orqanizmlərdə SHMT subhüceyrəvi paylanması sitoplazmik SHMT və orqanoidlərin daxilində yerləşən fermentin fərqli izoformları arasında bölünməni göstərir. Yalnız PfSHMTc-nin indiyədək enzimatik olaraq aktiv olduğu təsdiq edilmişdir P. falciparum[21-23], tək bir hüceyrə yeri proqnozlaşdırıla bilər. Bununla belə, onun qohum anticisimindən istifadə etməklə ilkin araşdırma göstərdi ki, PfSHMTc eritrositik dövr ərzində belə sadə paylanma modelinə əməl etmir. Bütün mərhələlər gözlənilən ümumiləşdirilmiş sitoplazma boyanmasını göstərdi və bu, vizual müayinə və Imaris proqramı tərəfindən həcmli analiz vasitəsilə PfSHMTc molekullarının əksəriyyətinin çox vaxt yerləşdiyi yerdir. Bununla belə, sitoplazmada flüoresan parlaqlığı vahid deyildi və sitoplazmanın orqanoidlər, xüsusən də nüvələr arasında daralması yamaqlı bir görünüş yaratdı (Şəkil 2). Şəkil 4, 5, 6, 7, 8 və 9-da da göründüyü kimi PfSHMTm zülalı (Şəkil 3) PfSHMTc fermenti üçün təsvir edilənə demək olar ki, eyni sitoplazmik paylanma göstərdi, burada anti-PfSHMTc və anti-PfSHMTm antikorlar orqanoid etiketli müxtəlif birləşmələrdə istifadə olunur. Bununla belə, hər iki antikorun kombinasiyada istifadə edildiyi şəkillərdə sitoplazmik lokalizasiyada və Şəkil 5C, D və 5F ilə misallaşdırılan fərdi parazitlər daxilində nisbi konsentrasiyada bəzi kiçik fərqlər göstərildi.

Mitoxondridə lokalizasiyanı göstərən PfSHMTc immunofluoressensiya şəkilləri. (A) PfSHMTc flüoresansı ilə kiçik bir mitoxondriyanın birləşməsini göstərən orta trofozoit. (B) Genişlənmiş qlobular mitoxondrinin daha sıx PfSHMTc flüoresansı bölgəsi ilə əlaqəsini göstərən erkən şizont. (C) PfSHMTc flüoresansı sahələri ilə mitoxondriyanın çox az birgə lokalizasiyasını göstərən gec şizont. Mitoxondriya nüvələrlə sıx uyğunlaşdırılıb və YOYO1 boyanması ilə bəzi birgə lokalizasiya göstərir (miqyaslı çubuqlar 3 μm). Əlaqədar cədvəl PfSHMTc (Sc) və MitoTracker (MIT) flüoresansı üçün faiz həcmini (V%) və materialın (M%) birgə lokalizasiyasını göstərir.

Mitoxondridə lokalizasiyanı göstərən PfSHMTm immunofluoressensiya şəkilləri. (A) İki gec trofozoit. (B-D) Mitotik şizontlar. (E) Postmitotik şizont. Şəkillər PfSHMTm flüoresansının inkişaf dövrü boyunca mitoxondriya ilə birgə lokalizasiyasının davamlılığını göstərir (miqyaslı çubuqlar 3 μm). Əlaqədar cədvəldə PfSHMTm (Sm) və MitoTracker (MIT) flüoresansı üçün faiz həcmi (V%) və materialın (M%) birgə lokalizasiya məlumatları göstərilir.

Apikoplastda lokalizasiyanı göstərən PfSHMTc immunofluoressensiya şəkilləri. (A) PfSHMTc flüoresansı ilə plastid xüsusi floresansının birgə lokalizasiyasını göstərən orta trofozoit. (B) PfSHMTc flüoresansı ilə plastid xüsusi flüoresansın (genişlənmiş qlobular apikoplast) çox nəzərə çarpan birgə lokalizasiyasını göstərən erkən mitotik şizont. (C) PfSHMTc flüoresansı ilə plastid xüsusi flüoresansın çox nəzərə çarpan birgə lokalizasiyasını göstərən mitotik şizont. Buradakı plastid uzanmanın ilkin mərhələsindədir. Piqment vakuoluna uyğun gələn parazitin ləkələnməmiş bölgəsinin periferiyasında PfSHMTc flüoresansının kiçik nöqtə konsentrasiyasına da diqqət yetirin. (D) Mitotik şizont inkişaf baxımından (C) şaxələnmənin ilkin mərhələlərində mitoxondrini göstərir. Güclü PfSHMTc flüoresans sahəsi mitoxondrinin 'Y' formasını yaxından izləyir (miqyaslı çubuqlar 3 μm, 2 μm olan (D) istisna olmaqla). Əlaqədar cədvəldə PfSHMTc (Sc) və asil daşıyıcı zülal (ACP) flüoresansı üçün faiz həcmi (V%) və material (M%) birgə lokalizasiya məlumatları göstərilir.

Üçqat etiketləmə təcrübələri. (A) və (B) Anti-PfSHMTc ilə yoxlanılan birləşdirilmiş mitoxondrial və apikoplast şəkilləri. Bunlar nüvə morfologiyasını göstərmir, buna görə də eritrosit dövrünün mərhələsini dəqiq müəyyən etmək mümkün deyil, lakin (A) və (B)-dəki orqanoidlərin ölçüsü və parazitlərin ümumi ölçüsü hər ikisinin orta trofozoitlər olduğunu göstərir. (A) parazit anti-PfSHMTc, MitoTracker və anti-ACP (plastid) ilə yoxlanır. Plastid qeyd olunan PfSHMTc flüoresans sahəsi ilə üst-üstə düşür, mitoxondri isə təsadüfi PfSHMTc flüoresansına dair heç bir dəlil göstərmir. (B) parazit anti-PfSHMTc, MitoTracker və anti-ACP (plastid) ilə yoxlanır. Plastid PfSHMTc flüoresansının diskret sahəsi ilə üst-üstə düşür, mitoxondri isə aşağı PfSHMTc flüoresansının cibində yerləşir. (C) Parazit, ehtimal ki, gec trofozoit və (D) mitoz şizontdur. Hər iki parazit DsRED etiketli ACP-ni ifadə edirdi və həm anti-PcSHMTc (IgY) və həm də anti-PfSHMTm (IgG) ilə araşdırıldı. İki SHMT flüoresan siqnalının paylanması oxşardır, lakin eyni deyil və hər ikisi apikoplastla birgə lokallaşdırılır (miqyaslı çubuqlar (A) və (C), 3 μm, (B) 2 μm, (D) 4 μm). Əlaqədar cədvəldə PfSHMTc (Sc), PfSHMTm (Sm), MitoTracker (MIT) və asil daşıyıcı zülal (ACP) flüoresansı üçün faiz həcmi (V%) və material (M%) birgə lokalizasiya məlumatları göstərilir.

Apikoplastda lokalizasiyanı göstərən PfSHMTm immunofluoressensiya şəkilləri. (A) Apikoplast PfSHMTm birgə lokalizasiyası olmayan erkən trofozoit. (B) 'C' formalı apikoplasta yaxından uyğun gələn PfSHMTm flüoresansı olan erkən mitotik şizont. (C) Uzatma apikoplastı olan mitotik şizont, PfSHMTm flüoresansı, medial hissədə az flüoresans ilə orqanellin distal hissələrində cəmləşmişdir. (D) PfSHMTm və çoxlu apikoplastların kiçik məkan təsadüfünü göstərən post-mitotik şizont (miqyaslı çubuqlar 3 μm, (D. 2 μm olan) istisna olmaqla). Əlaqədar cədvəldə PfSHMTm (Sm) və asil daşıyıcı zülal (ACP) flüoresansı üçün faiz həcmi (V%) və materialın (M%) birgə lokalizasiya məlumatları göstərilir.

PfSHMTm apikoplast immunofluoresan şəkilləri uzanan apikoplastların ekstremitələrində flüoresan konsentrasiyasını təsvir edir. (A) uzanan apikoplast ilə mitotik şizont. (B) Apikoplastın distal hissələrində PfSHMTm flüoresansının konsentrasiyasını və onun medial hissəsində PfSHMTm flüoresansının nisbi çatışmazlığını göstərən eyni parazit vasitəsilə 0,2 μm intervalı olan z-stack seriyası (miqyaslı çubuqlar 2 μm).

Anti-ACP antikorları əvəzinə endogen şəkildə ifadə edilmiş DsRED etiketli ACP istifadə edən müsbət nəzarət şəkilləri. Yalnız bir əsas antikorun, anti-PfSHMTc-nin ifadə DsRED etiketli Pf ACP ilə istifadəsi eyni vaxtda istifadə edilən iki əsas antikor arasında qarşılıqlı təsir nəticəsində yaranan hər hansı artefakt flüoresans ehtimalını aradan qaldırmağa yönəlmişdir. (A) İki parazit, yuxarı parazit birinci bölünmə keçir, aşağı parazit gec trofozoitdir. (B) uzanan apikoplast ilə mitotik şizont. (C) Şaxəli apikoplast ilə mitotik şizont. Bütün parazitlər anti-PfSHMTc flüoresansının apikoplastla birgə lokalizasiyasını, orqanoidin formasını yaxından izləyir, iki əsas antikordan (miqyaslı çubuqlar (A) və (C) 3 μm, (B) 2 μm) istifadə edilən nəticələrlə eyni nəticələr verir. ).

Gec şizontlar PfSHMTc flüoresansının mərkəzi konsentrasiyasını göstərir. (A) Parazitin mərkəzində PfSHMTc flüoresansının konsentrasiyasını göstərən və hemozoyinin xarici zonasını üst-üstə düşən post-mitotik şizont. PfSHMTc əsasən nüvələrdən xaric edilir. (B) Parazitin mərkəzində, eləcə də çoxsaylı kiçik apikoplastlarda aşağı intensivlikdə PfSHMTc flüoresansının konsentrasiyasını göstərən post-mitotik şizont. Gələcək qalıq gövdə üzərində mərkəzləşdirilmiş radial naxışda düzülmüş merozoit qönçələrinə diqqət yetirin. (C) Anti-PfSHMTc (IgY) və anti-PfSHMTm (IgG) ilə yoxlanılan post-mitotik parazit. Hər iki SHMT zülalları yuxarıda təsvir seriyası (A) və (B) üçün təsvir edildiyi kimi oxşar, lakin eyni olmayan paylanma göstərir (miqyaslı çubuqlar 3 μm).

PfSHMTc-nin mitoxondrial lokalizasiyası

Mitoxondri və apikoplast eritrositar mərhələ parazitlərinin inkişafı zamanı eyni vaxtda olmasa da, oxşar morfoloji təkamüldən keçir. İki orqanoid sıx fiziki əlaqədə olur və onların müvafiq membranları arasında birləşmə təsvir edilmişdir [43, 44]. Orqanoidlər ölçüdə böyüyür və burada istifadə edilən K1 izolatı vəziyyətində, tez-tez şizontun erkən mərhələsində kürə formasını qəbul etdikləri müşahidə olunurdu, sonra onlar uzanır və şaxələnir, nəticədə hər bir orqaneldən birinin inkişaf edən hər bir fərdi ilə birləşməsinə imkan vermək üçün bölünür. merozoit [45]. Beləliklə, bu orqanellər, genomlarının təkrarlanması üçün lazım olan DNT prekursorlarının sintezi üçün folat yolu metabolitlərinə tələbat var.

MitoTracker vasitəsilə vizuallaşdırılan mitoxondriya eritrositik dövr ərzində, lakin əsasən DNT replikasiyası ilə əlaqəli mərhələlərdə əlaqəli PfSHMTc flüoresansının bəzi sübutlarını göstərdi. Bir çox erkən və gec parazitlərdə mitoxondriya fiziki cəhətdən çox kiçik idi və buna görə də PfSHMTc flüoresansının orqanoid lümenində və ya sadəcə ona bitişik sitoplazmada olduğuna əminliklə nəticə çıxarmaq mümkün deyildi. Həqiqətən də bəzi erkən və orta trofozoitlər mitoxondrilərində PfSHMTc flüoresansına dair heç bir dəlil göstərmədilər. Bununla belə, bəzi orta trofozoitlər daha inandırıcı birgə lokalizasiya göstərdi, məs. Şəkil 2A, Şəkil 2B-də göstərildiyi kimi çox gec trofozoitlərdə və erkən şizontlarda tapılan daha böyük mitoxondriyalar, dərhal ətrafdakı sitoplazmadakı konsentrasiyaya oxşar konsentrasiyada olsa da, lümen daxilində PfSHMTc flüoresansını aydın şəkildə göstərdi. Şəkil 2C çox az birgə lokalizasiyanın qaldığı post-mitotik şizontun nümunəsidir.

PfSHMTc və MitoTracker-in birgə lokalizasiya səviyyələrinin hesablanması bu keyfiyyətli nəticəni gücləndirir. PfSHMTc materialının birgə lokallaşdırılmasının faizi 2,2% ilə 5,8% arasında dəyişdi (Şəkil 2) və PfSHMTc-nin birgə lokallaşdırılmasının faiz həcmi müqayisədə yalnız oxşar və ya bir qədər yüksək dəyər göstərdi ki, bu da mitoxondrinin nəzərəçarpacaq dərəcədə yığılmadığını təsdiqləyir. sitoplazmada olandan daha yüksək PfSHMTc konsentrasiyası. Şəkil 2C-dəki üçölçülü proyeksiya, eyni qızı merozoiti tutmaq üçün nəzərdə tutulmuş nüvələr və mitoxondriyalar arasında sıx məkan əlaqəsini göstərən post-mitotik şizontun xüsusilə yaxşı görünüşünü verir. Bununla belə, bu gec mərhələ parazitindəki mitoxondriya PfSHMTc boyanmasına dair çox az dəlil göstərdi.

PfSHMTm-in mitoxondrial lokalizasiyası

Anti-PfSHMTm-in istifadəsi mitoxondrial birgə lokalizasiyanın fərqli bir modelini ortaya qoydu. PfSHMTm zülalı, PfSHMTc-dən fərqli olaraq, erkən trofozoitlərdən gec, post-mitotik, şizontlara qədər bütün eritrositik dövr ərzində mitoxondriya ilə güclü əlaqəli olduğu aşkar edilmişdir. Mitoxondriya həmişə nisbətən yüksək intensivlikli PfSHMTm flüoresansı (Şəkil 3A və 3E) bölgələrində tapıldı və bir çox hallarda PfSHMTm flüoresansının forması mitoxondriyanın formasına uyğun gəlirdi (Şəkil 3B, C və 3D). Əhəmiyyətli olan, əlaqəli PfSHMTm flüoresansı olmadan mitoxondriyaların tapıldığı və ya belə flüoresansın qonşu sitoplazmanınkından nəzərəçarpacaq dərəcədə aşağı olduğu skan edilmiş şəkillərin heç bir nümunəsi yox idi. Bununla belə, Şəkil 3-ün kəmiyyət təhlili, MitoTracker ilə birgə lokallaşdırılmış PfSHMTm materialının faiz nisbəti ilə birgə lokallaşdırılmış həcmlə müqayisədə çox oxşar rəqəmlər verdi və bu, sitoplazmadakı səviyyələrdən yuxarı mitoxondrilərdə PfSHMTm-nin aktiv toplanmasının olmadığını göstərir. MitoTracker ilə birgə lokallaşdırılmış PfSHMTm materialının faizləri 5.0% ilə 12.9% arasında dəyişdi, bu da PfSHMTc üçün ölçüləndən (2.2 - 5.8%) daha yüksək diapazondur.

PfSHMTc-nin apikoplast lokalizasiyası

Hüceyrəaltı PfSHMTc paylanması və mitoxondri arasında nisbətən zəif məkan birliyindən fərqli olaraq, apikoplast daha aydın bir əlaqə nümayiş etdirdi. Apikoplast iki yolla vizuallaşdırıldı: apikoplasta xas olan asil daşıyıcı zülalına (anti-ACP) antikorlardan istifadə etməklə [37, 45] və konstruktiv olaraq DsRED etiketli PfACP ifadə edən transfeksiya edilmiş 3D7 xəttindən istifadə etməklə [39]. Şəkil 4A-da göstərilən parazit orta trofozoit mərhələsində idi və apikoplast hələ də nisbətən kiçik olsa da, PfSHMTc flüoresansı aydın şəkildə anti-ACP ilə birgə lokallaşdırılmışdı, bu da onun bu orqanellin lümenində olduğunu göstərir. Şəkil 4B və 4C-dəki parazitlər erkən şizontlardır, bu mərhələdə apikoplast mütləq həcmdə, eləcə də ümumi hüceyrə həcminə nisbətən xeyli böyükdür. Bu şəkillərdə istifadə edilən K1 izolatında apikoplast tez-tez əvvəlcə böyüdülmüş kürə formasını alır, sonra isə şaxələnmədən əvvəl uzanır. Bütün bu parazitlər parlaq PfSHMTc flüoresansı ilə apikoplastın mövqeyini təyin edən anti-ACP flüoresansı ilə üst-üstə düşdüyünü və ya böyük ölçüdə üst-üstə düşdüyünü göstərdi, ətrafdakı ümumi sitoplazmik PfSHMTc flüoresansı nəzərəçarpacaq dərəcədə az parlaq oldu. Şəkil 4B-də göstərilən parazit əvvəlki globular apikoplast morfologiyasını göstərir, Şəkil 4C-dəki parazit uzanmağa başlayan apikoplastı ehtiva edir. Şəkil 4C-də parazitin üçölçülü proyeksiyası həmçinin PfSHMTc-nin veziküllə əlaqəli yerini göstərən flüoresansın kiçik punktat konsentrasiyalarının aydın vizuallaşdırılmasına imkan verir, tez-tez trofozoitdə və erkən dövrlərdə piqment vakuolunu ehtiva edən hemozoyinə yaxın yerlərdə görünür. şizont mərhələləri. Şəkil 4D-dəki parazit inkişafının şaxələnmə mərhələsində olan apikoplastı göstərir və anti-PfSHMTc flüoresansının 'Y' formalı apikoplasta uyğunluğu diqqəti çəkir. PfACP-ni DsRED etiketi ilə ifadə edən 3D7 transfektantında apikoplastın inkişafı K1 parazitlərində tez-tez görülən qlobular mərhələni nümayiş etdirmirdi, dar şaxələnmiş apikoplastlar daha aydın görünürdü (Şəkil 8B və 8C). Bununla belə, apikoplast və PfSHMTc flüoresansının sıx üst-üstə düşməsi K1 və iki əsas antikordan istifadə edərkən olduğu kimi eyni dərəcədə aydın idi (həmçinin aşağıya bax).

Kəmiyyət təhlili yenidən apikoplast məlumatlarının vizual şərhini dəstəkləyir. Şəkil 4A-da göstərilən trofozoitdə PfSHMTc-nin anti-ACP ilə 5,9% material birgə lokalizasiyası və 5,8% həcmdə birgə lokalizasiya var idi ki, bu da bu parazitdə PfSHMTc flüoresansının apikoplast daxilində nəzərəçarpacaq dərəcədə yüksək olmadığını göstərir. . Şəkil 4B və 4C-dəki erkən şizont mərhələsi parazitləri PfSHMTc materialının 10.1% və 22.3% birgə lokalizasiyasının əhəmiyyətli dərəcədə yüksək faizlərini göstərdi, bu da bu xüsusi parazitlərin PfSHMTc-nin əhəmiyyətli bir hissəsinin apikoplastın nisbətən kiçik həcmində yerləşdiyini göstərir. Üstəlik, bu iki parazitdə PfSHMTc flüoresansı üçün birgə lokallaşdırılmış faiz materialı müvafiq faiz həcmlərindən təxminən üçdə bir yüksək idi və bu, bu parazitlərdə PfSHMTc-nin ümumiyyətlə sitoplazmada olduğundan apikoplast daxilində daha yüksək konsentrasiyada olduğu vizual təəssüratını gücləndirdi. Bir az gec yaranan parazit (Şəkil 4D), şaxələndirici apikoplastı göstərən, ətrafdakı sitoplazmanın konsentrasiyasından daha yüksək olmayan konsentrasiyada 4,5% anti-ACP ilə PfSHMTc-nin birgə lokalizasiyasının bir qədər aşağı səviyyəsini nümayiş etdirdi.

Üçlü boyanma təcrübələrində mitoxondrial və apikoplast PfSHMTc konsentrasiyaları arasında birbaşa müqayisə aparıldı. Bu halda, mövcud dalğa uzunluqlarının məhdudiyyətləri DNT-ni eyni vaxtda rəngləmək üçün boyanın istifadəsini istisna edirdi ki, baxılan parazitlərin dəqiq mərhələsi aydın görünmürdü, lakin orqanellərin ölçüsü və parazitlərin ümumi ölçüsü Şəkildə göstərilənlərin 5A və 5B orta trofozoitlərdir. Bu təcrübələrdə, PfSHMTc Alexafluor anti-toyuq IgY 488 nm (yalançı rəngli mavi) istifadə edərək boyandı, bunun xüsusilə ağartmaya meylli olduğu və buna görə də z-stack skanının qurulması üçün lazım olan lazer işığına təkrar məruz qalmaya uyğun olmadığını sübut etdi. Buna görə də burada təqdim olunan digər şəkillərdən fərqli olaraq, həm mitoxondrini, həm də apikoplastı göstərənlər hər iki orqanellin eyni z oxu müstəvisində olduğu tək müstəvi skanlardandır. Şəkil 5A-dakı parazit parlaq PfSHMTc flüoresansının diskret bölgəsində yerləşən apikoplasta xas flüoresansı göstərir, əksinə, mitoxondridə heç bir əlaqəli PfSHMTc flüoresansı yoxdur. Şəkil 5B-dəki parazit həmçinin yüksək PfSHMTc flüoresans bölgəsində apikoplast flüoresansını göstərir, halbuki mitoxondri daha aşağı intensivlikli PfSHMTc flüoresans cibini tutur. Kəmiyyət təhlili PfSHMTc-nin mitoxondri ilə müqayisədə apikoplastla daha əhəmiyyətli əlaqəsini təsdiqlədi. Bu rəqəmlər z-stack skanından üçölçülü proyeksiyada voksellərə deyil, tək müstəvidəki piksellərə istinad etdiyinə görə, bu xüsusi halda həcmli dəyərlərə ekstrapolyasiya təhlükəli idi.

PfSHMTm-in apikoplast lokalizasiyası

Anti-PfSHMTm-in anti-ACP ilə birlikdə istifadəsi PfSHMTm zülalının apikoplastda da tapıldığını göstərdi. PfSHMTm-in apikoplast daxilində eritrositik dövr ərzində müvəqqəti paylanması keyfiyyətcə PfSHMTc ilə eyni idi. Beləliklə, erkən trofozoitdə nəzərəçarpacaq birgə lokalizasiya müşahidə edilmədi (Şəkil 6A), lakin həm gec trofozoitlərin, həm də mitotik şizontların apikoplastlarında PfSHMTm flüoresansının nəzərəçarpacaq dərəcədə mövcudluğu var idi (Şəkil 6B və 6C, Şəkil 7 də Şəkilə baxın). 10). Sonrakı, post-mitotik, şizontlar, apikoplastla əlaqəli PfSHMTm flüoresansının PfSHMTc spesifik antikorundan istifadə edərək aşkar edilənə bənzər bir azalma göstərdi (Şəkil 6D). Bununla belə, erkən şizontların uzanan apikoplastları daxilində PfSHMTm flüoresansının məkan paylanması, əksinə, PfSHMTc tərəfindən göstəriləndən fərqli idi. Sonuncu apikoplastlar arasında nisbətən bərabər şəkildə flüoresans nümayiş etdirdiyi halda (Şəkil 4C və 4D Şəkil 8B və 8C), PfSHMTm onların ekstremitələrində aydın şəkildə cəmlənmişdir və bu orqanoidlərin medial hissələrində xüsusilə yox idi və ya çox aşağı konsentrasiyada idi (Şəkil ). 6C). Bu fenomen daha sonra Şəkil 7B-də göstərilən eyni parazit vasitəsilə ardıcıl z müstəvisi görünüşləri (0,2 μm intervallarla), xüsusən də bu ardıcıllığın ikinci panelində, uclarda PfSHMTm flüoresansının konsentrasiyasını aydın şəkildə göstərən və dördüncü və beşinci panellər, burada uclara nisbətən medial bölgələrin daha aşağı boyanma dərəcəsi aydın görünür. Anti-PfSHMTm materialının anti-ACP floresansı ilə birgə lokalizasiya faizi trofozoitdə apikoplast PfSHMTm konsentrasiyasının aşağı səviyyəsinin göstəricisi idi, məs. Şəkil 6A üçün 1,0%, ardınca mitotik aktiv şizontda daha yüksək apikoplast PfSHMTm konsentrasiyası: məs. Şəkil 6B üçün 11,3%, Şəkil 7A üçün 11,8% və Şəkil 6C üçün 36,3%. Daha sonra, post-mitotik, şizontlarda, birgə lokalizasiya səviyyələri daha aşağı dəyərlərə düşdü, Şəkil 6D-də göstərilən parazit PfSHMTm materialının anti-ACP ilə birlikdə lokallaşmasının cəmi 0,3% faizinə malikdir.

Eritrositik dövr ərzində flüoresansın orqanik paylanması. Mitoxondridə (mit) və apikoplastda (api) PfSHMTc (c) və PfSHMTm (m) üçün qeyd olunan flüoresanlığı göstərən parazit faizləri (hər mərhələ üçün skan edilmiş ümumi sayı). ET, erkən trofozoitlər LT, gec trofozoitlər MS, mitotik şizontlar PMS, mitozdan sonrakı şizontlar. PfSHMTc-nin orqanelyar lokalizasiyası üçün, PfSHMTm üçün n = 82, n = 76.

Endogen şəkildə ifadə edilmiş apikoplast markerindən istifadə edərək görüntüləmə

İki əsas antikorun eyni vaxtda istifadəsi, hətta müxtəlif növlərdə yetişdirildikdə, onların müvafiq flüoroxromla birləşmiş ikincil antikorları ilə birlikdə, hər hansı müşahidə edilən birgə lokalizasiyanın bu antikorlar arasında təsadüfi qarşılıqlı təsirlərin nəticəsi olması formal ehtimalını artırdı. Bu ehtimalı aradan qaldırmaq üçün DsRED müxbirinə birləşdirilmiş apikoplasta xas protein ACP-ni ifadə edən 3D7 transfeksiya edilmiş parazitlərdən istifadə edilmişdir [39]. When these parasites were probed with the single anti-PfSHMTc antibody, the images obtained showed an identical incidence of co-localization of the PfSHMTc fluorescence with the apicoplast (Figure 8A-C) as was seen using the two antibody approach above, although the relatively low absolute brightness of the DsRED fluorescence made these images unsuited to quantitative evaluation. The conclusion from this result is that the images created using two primary antibodies are a true reflection of the sub-cellular distribution of the proteins investigated and that the same distribution is found in two independent lines of the parasite, K1 and 3D7.

The parasites expressing PfACP-DsRED were also simultaneously probed with antibodies to both PfSHMTc (IgY) and PfSHMTm (IgG), again employing single plane scans without a DNA-specific dye rather than z-stacks for this triple labelling experiment. The parasite in Figure 5C (estimated to be a mid to late trophozoite), and that in Figure 5D (an early schizont) both show overlapping, though not identical, PfSHMTc and PfSHMTm fluorescence distribution in the cytoplasm. Both parasites show PfSHMTc and PfSHMTm coincident with the apicoplast as indicated by white colouration in the relevant merged image. Quantitative image analysis reinforces the visual indication of co-localization of both PfSHMTc and PfSHMTm with each other, and with the apicoplast specific fluorescence. In particular the apicoplast specific fluorescence was almost entirely (between 82.8% and 99.7%,) co-localized with the signals from both isoforms of SHMT.

SHMT distribution in the post-mitotic schizont

In late, post-mitotic, schizonts, PfSHMTc fluorescence was characterized by a concentration in the central portion of the parasite. The peripheral regions of the parasite occupied by the nuclei and other constituents of the developing merozoites contained conspicuously lower levels of fluorescence, as shown in Figure 9A and 9B. The central area of late schizonts is the region that becomes the residual body upon completion of merozoite maturation and lysis of the erythrocyte, a prominent component of which is the pigment vacuole containing the crystalline haemozoin. In the very late schizont when the majority of the haemoglobin has been digested, the pigment vacuole occupies a large volume. Figure 9A and 9B show the central mass of dense haemozoin exhibiting no PfSHMTc staining but with marked PfSHMTc fluorescence in the region immediately surrounding it. To assess the relative frequency of this category of PfSHMTc distribution, 48 scans of post-mitotic schizonts were viewed, of which 15 showed a marked concentration of fluorescence in the centre of the schizont when compared to their periphery, an incidence of 31%. The use of anti-PfSHMTm antibody in conjunction with anti-PfSHMTc showed that PfSHMTm has a very similar concentration within the central region of the very late schizont (Figure 9C). Additional to this general distribution pattern, the post-mitotic schizont contains numerous small apicoplasts, each associated with a developing merozoite. Despite the diminutive size of these organelles, the persistence of PfSHMTc fluorescence within the 'daughter' apicoplasts was still discernible in some images, e.g. in Figure 9B, where the lower right plastid in the parasite clearly shows its presence. The three-dimensional projection shown in Figure 9B is interesting as it shows a relatively late stage of daughter merozoite biogenesis.

Nuclear localization

In most parasites viewed there was a distinctly lower PfSHMTc fluorescence within nuclei than was found in the cytoplasm. However, PfSHMTc fluorescence was very rarely entirely excluded from the nucleus (see especially Figure 4C and 4D Figure 9B and 9C). The level of nuclear relative to cytoplasmic fluorescence was variable with higher levels of intranuclear PfSHMTc fluorescence seen in some late trophozoites and mitotic schizonts. Nuclear PfSHMTc fluorescence rarely approached the intensity of cytoplasmic fluorescence, however. In contrast, PfSHMTm showed very little evidence of nuclear localization throughout the erythrocytic cycle, with most images showing an essentially complete exclusion of PfSHMTm fluorescence from nuclei (Figure 3D and 3E Figure 6A, C and 6D).

Relative incidence of organellar SHMT fluorescence through the erythrocytic cycle

In view of the initially surprising results that PfSHMTc showed organellar co-localization patterns, a large number of z-axis scans of parasites were analysed in order to ascertain the relative incidence of organellar fluorescence for this isoform over the erythrocytic cycle. Parasites were assigned to one of four broadly defined developmental stages by examination of overall size, haemozoin development and nuclear morphology (Figure 10). These results emphasize the stage-specific dependence of organellar PfSHMTc fluorescence, which was undetectable in parasites up to and including the early trophozoite stages, visible from mid-trophozoites onward and peaking at the mitotic schizont stages. The corresponding analysis for PfSHMTm with respect to the mitochondrion is strikingly different in that 100% of parasites showed fluorescence in this organelle, regardless of the cell cycle stage. However, its incidence in the apicoplast was similar to that of PfSHMTc, in that it was not seen in the early trophozoite stage but peaked in the late trophozoite stage, although the percentage of parasites displaying this pattern was significantly higher than was the case for PfSHMTc.

GFP-tagging of SHMT via transfection

To support the immunofluorescence studies in a complementary manner, independent attempts were made in the two collaborating laboratories to produce transfected parasites expressing GFP-tagged, full length PfSHMTc and PfSHMTm endogenously, as well as shorter versions carrying a GFP-tag downstream of the first 100 amino acids of each protein (i.e. about one-quarter of their total length). Despite repeated transfections using several different protocols for these four constructs, viable parasites could only ever be recovered in the case of the truncated version of PfSHMTm + GFP. Fluorescence microscopy clearly located this hybrid protein in the mitochondrion (Figure 11), confirming the initial prediction based on sequence analysis that PfSHMTm carries a mitochondrial targeting signal at its N-terminus [24]. However, in contrast to the studies above using the anti-PfSHMTm antibody, no additional distribution in the cytoplasm or apicoplast was apparent, suggesting that localization to these areas was dependent upon properties of the full-length molecule.

GFP-tagging of truncated PfSHMTm in transfected 3D7 parasites. Fluorescence images of parasites transfected to yield a GFP-fusion carrying the first 100 amino acids of PfSHMTm at the N-terminus. MitoTracker was also used to localize the mitochondrion, which showed complete coincidence with the GFP fluorescence (three examples shown).

Transcript analysis of PfSHMTc

In the original characterization of the gene encoding PfSHMTc, comparison of cDNA and genomic sequences, together with RACE analyses of the transcript start point in two independent laboratories [8, 21], identified only a

240 base 5' UTR on the mRNA which lacked any AUG motif upstream of the documented start codon. To confirm and extend this result, we carried out RT-PCR experiments using a range of internal primers based on genomic sequence extending up to 1 kb upstream of the start codon. However, no splice variants were detected (data not shown), nor could any putative splicing event using the normal GU and AG intron junction signals within this sequence create an alternative start codon. Thus there was no evidence that PfSHMTc might employ a conventional signal sequence that had previously been overlooked to gain access to the organellar compartments.


4 In Situ Capturing Technologies

The spatial techniques described so far have been based on either isolation of already-known tissue regions of interest, or in situ visualization of RNA molecules by hybridization or sequencing. Another approach is to capture transcripts in situ, then perform sequencing ex situ. The concept is attractive since it avoids the typical limitations of direct visualization and allows for an unbiased analysis of the complete transcriptome. However, the main hurdle for these methods is restricted RNA capture efficiency, which becomes increasingly more challenging with higher resolution (i.e., smaller capture/barcoded areas). An overview of in situ capturing technologies mentioned here is shown in Şəkil 5.

4.1 Spatial Transcriptomics

The first technique employing this approach was the Spatial Transcriptomics (ST) technology, published in 2016. [ 41 ] Thin tissue sections are placed onto glass slides which are printed with barcoded RT primer, specifying the xy coordinates of the array. The tissue is fixed, stained, imaged, and permeabilized. During the permeabilization process, mRNA molecules diffuse vertically down to the solid surface and hybridize locally to the RT primers. RT is performed in situ, after which the tissue is removed, and the cDNA-mRNA complexes are extracted for library preparation and next generation sequencing (NGS) readout. The barcoded reads are superimposed back onto the tissue image. Although the method gives you spatially resolved whole-transcriptome information, the current barcoded regions of 100 µm in diameter, limits the resolution to ≈10–40 cells. At the end of 2018, the ST technology was acquired and further developed by the company 10X Genomics, under the name “10X Visium.” [ 42 ] The 10X Visium assay displays improvements in both resolution (55 µm in diameter and smaller distance between barcoded regions) as well as time to run the protocol. At the moment, both the ST and 10X Visium assays are only offering 3′ cDNA count data.

4.2 Slide-Seq

Instead of printing regional barcoded RT primers onto a glass slide, one could instead attach them onto beads in solution and then dispense them on a glass surface. This approach was taken by the research team behind the Slide-seq technology in 2019, [ 43 ] where barcoded 10 µm in diameter beads are randomly monolayered-packed onto a glass coverslip. Since the positions of the beads are not known beforehand, the beads barcode needs to be decoded in situ by using SBL prior to the sample preparation procedure. The experimental procedure is conceptually similar to the ST method, where permeabilization of the tissue section lets the mRNA within diffuse vertically downward to the barcoded beads on the surface. The method holds a resolution analogous to the size of a single cell, but in order to properly map spatially localized cell types, the sensitivity limitation of the current version implies that support by scRNA-seq data is needed. Of note is that, compared to the other in situ methods, the tissue image is obtained from an adjacent section and not from the same as the RNA data is acquired from. The impact of this will depend in large on the sample type and the biological question at hand. While tissue with highly conserved morphological structure (e.g., regions of the mouse brain) will display very high similarity across adjacent sections, samples with less structure and high degree of heterogeneity (e.g., within a tumor) will aggravate the interpretation.

4.3 High-Definition Spatial Transcriptomics

Shortly after the Slide-seq approach was published, another method using even smaller barcoded beads was announced, named high-definition spatial transcriptomics (HDST). [ 44 ] Here, they randomly deposit 2 µm-sized beads containing barcoded RT primers onto an ordered bead array. As well as with Slide-seq, the beads location on the array needs to be decoded before the sample preparation procedure begins, which is done by several rounds of hybridizations. Since the spatially resolved HDST data is currently very sparse, neighboring beads covering circular areas with a diameter of ≈13 µm is binned in order to enhance the read depth per region. Like for Slide-Seq, the lack of capture sensitivity demands scRNA-seq data to assist mapping of spatially localized cell types.

4.4 Nanostring GeoMx Digital Spatial Profiler

In March of 2019, NanoString announced the commercial launch of the GeoMx Digital Spatial Profiling instrument. [ 45 ] GeoMx differentiate itself by its ability to work on notoriously difficult FFPE samples. The instrument also has the ability to spatially profile proteins, although not on the same tissue section. It works in an iterative manner, where the user manually selects regions of interest (ROIs) via microscopy of varying sizes (10–600 µm in diameter). These regions are then excited with UV light, triggering the release of either RNA target probe (mRNA assay) or antibody (protein assay) coupled barcoded tags. In the current commercial form, the tags are collected and quantified with the NanoString nCounter instrument, putting a limit to multiplex capacity. However, NGS readout is demonstrated in a preprint, [ 46 ] in which the authors state that this type of readout has the potential for an unlimited multiplex capacity. While in theory the chemistry and the combinatorial approach might allow for such a statement, this capacity has not yet been demonstrated. The workflow of selecting ROIs, although largely automated, makes it infeasible to analyze whole tissue sections and therefore unbiased regional analysis could become difficult. While the shape and size of the ROI can be adjusted, the smallest available size of 10 µm (approximately the size of a single-cell), suffers from low protein detection efficiency, [ 47 ] and the same resolution on RNA level has not yet been demonstrated.

4.5 APEX-Seq

In situ capturing technologies described so far target the spatial landscape of anatomical regions within intact tissue sections. However, there are also approaches for profiling subcellular localizations of endogenous RNAs within individual living cells. Two recent publications showing how the specific locations of RNAs within living cells is bound to their cellular functions, used the APEX-Seq method. [ 48, 49 ] In APEX-Seq, one uses cell lines recombinantly expressing the enzyme APEX2 in specific subcellular regions of interest. By incubating the live cells in biotin-phenol and hydrogen peroxide, the APEX2 enzyme will tag nearby RNAs with biotin, which can then be isolated using streptavidin beads and subjected to RNA-seq. Whole-transcriptome profiles within individual cellular domains can therefore be assessed from living cells. As APEX-Seq requires recombinant technology, the methods not applicable to normal tissues.

4.6 Microfluidic Barcoding in Tissue Sections

A spatial method that attempts to combine spatially resolved mRNA and protein expression on the same tissue section, utilizing microfluidics and imaging, was recently presented in a preprint. [ 50 ] This method, named microfluidic Deterministic Barcoding in Tissue for spatial omics sequencing (DBiT-seq), is performed by first placing a microfluidics chip containing multiple parallel channels on top of a tissue section. For each channel, oligo-dT-tagged barcodes and/or antibody-tagged barcodes are streamed over the tissue. Next, the first chip is removed, and a second microfluidic chip is put on top of the tissue, but this time it is turned in a 90° angle to the first flow direction. New barcodes are now streamed through the parallel channels, resulting in a mosaic of 10 µm sided rectangles of the tissue, containing combined barcodes from the first and the second stream.


Is the occurrence of a particular enzyme in a given subcellular location a random phenomenon? - Biologiya

a Key Laboratory for Molecular Enzymology and Engineering of Ministry of Education, School of Life Science, Jilin University, 2699 Qianjin Street, Changchun 130012, China
E-poçt: [email protected]

b Department of Pathobiology, College of Basic Medical Sciences, Jilin University, Changchun, China
E-poçt: [email protected]

Mücərrəd

Adenosine deaminase (ADA) is an important enzyme related to purine nucleoside metabolism in human serum and various tissues. Abnormal ADA levels are related to a wide variety of diseases such as rheumatoid arthritis, AIDS, anemia, lymphoma, and leukemia and ADA is considered as a useful target for various diseases. Currently, ADA can be divided into open conformation and closed conformation according to the inhibitors of binding. As a consequence, we chose two inhibitors, namely, 6-hydroxy-1,6-dihydro purine nucleoside (PRH) and N-[4,5-bis(4-hydroxyphenyl)-1,3-thiazol-2-yl]hexanamide (FRK) to bind to ADA in the closed conformation or open conformation respectively. In this study, we performed the random acceleration molecular dynamics (RAMD) method, steered molecular dynamics (SMD) simulations and adaptive basing force (ABF) simulation to explore the unbinding tunnels and tunnel characteristics of the two inhibitors in ADA. Our results showed that PRH and FRK escaped from ADA using three main tunnels (namely, T1, T2, and T3). Inhibitors (PRH and FRK) escape through T3 more frequently and more easily. The results from ABF simulations confirm that the free energy barrier in T1 or T2 is larger than that in T3 when inhibitors dissociate from the ADA and have potential mean of force (PMF) depth. Moreover, in the complexes (ADA-PRH, ADA-FRK), we also found that the most active residue that remarkably contributed to the binding affinity is W117 in T3, and the residue played an important role in the unbinding tunnel for inhibitor leaving. Our theoretical study provided insight into the ADA inhibitor passway mechanism and may be a clue for potent ADA inhibitor design.


Concluding remarks

The major plant and animal miRNA pathways differ with respect to their biochemical mechanisms, the extent of their preferred target pairing, and numbers of functional targets. These differences have resulted in distinct characteristics of the evolution of plant and animal miRNAs. In particular, the co-evolution of target:miRNA pairs is common in plants, whereas it seems much more common for animal miRNAs to emerge and then acquire target genes. One interpretation is that this reflects independent emergence of miRNA pathways in plants and animals, on the backbone of an ancestral RNAi pathway that metabolized dsRNA into short RNAs that populate Argonaute proteins. This system might have emerged to defend against invasive nucleic acids such as viruses and transposons, and subsequently been adapted to generate miRNAs from endogenous inverted repeat transcripts. However, there are also analogies between plant and animal miRNA pathways. For example, certain vertebrate miRNA targets, as well as Drosophila hpRNA targets, exhibit 'plant-like' extensive complementarity. There is reciprocally a growing appreciation that plant miRNAs have emerged from incidentally emerged hairpins, akin to the presumed dominant mode for animal miRNA birth. Therefore, an alternative interpretation is that a miRNA pathway was extant in the last common ancestor of plants and animals, but became differentially deployed in these kingdoms.

In either case, it is clear that a limited set of core proteins, namely RNase III enzymes and Argonaute proteins, have been joined in remarkably diverse ways to control gene expression via small RNAs. Recent studies of fungal small RNA pathways provide additional evidence for innovation of RNase III-independent mechanisms for siRNA and miRNA production [136, 137], for which we can only guess at the underlying reasons that permitted the loss of canonical pathways and invention of new pathways. Altogether, it is evident that miRNAs are not a unitary entity, but instead encompass a variety of conceptually related phenomena, whose evolutionary pressures differ according to mechanism of biogenesis and even genomic location. Understanding the principles that govern the evolutionary flux of these myriad small RNA pathways will provide a fundamental complement to understanding the flux of protein-coding genes [138].


Nəticə

In this study three copies of TaOAT genes, TaAOT-5AL, TaOAT-5BLTaAOT-5DL, were cloned and localized on the long arm of chromosome 5 in wheat. We determined that due to the phenomenon of alternative splicing, two types of transcripts exist for TaOAT-5AL. Similar to OsOATAtOAT, TaOATs also target to mitochondria. Phylogenetic analysis showed that this enzyme is highly conserved among monocots as well as among dicots species. In silico promoter analysis revealed quite a number of cis-acting elements in the promoter region of the TaOAT gene, suggesting its role in drought- and salinity-stresses. Furthermore, qRT-PCR analysis showed the upregulation of the TaOAT gene in response to PEG and salt stress which supports its potential role in response to both of these stresses. The transgenic wheat plants overexpressing TaOAT displayed an increased tolerances to drought and salt stress conditions. Additionally, the presence of the plant AP-2-like cis-acting element and high expression of TaOAT in stamens suggest its role in floret development. The highest expression of TaOAT at the heading stage in combination with high expression of TaOAT in stamens suggested that it plays an important role in anther dehiscence and glume opening.


MATERİALLAR VƏ METODLAR

Plant Material

The T-DNA insertional mutant line mah1-1 (flanking sequence tag no. 427D09 Samson et al., 2002) was obtained from the Institut National de la Recherche Agronomique. T-DNA insertional mutant lines mah1-2 (SALK_049943) and mah1-3 (SALK_133155 Alonso et al., 2003) were obtained from the Arabidopsis Biological Resource Center. Seeds from all lines were initially planted and screened for allele homozygosity using genomic DNA extraction from leaves ( Berendzen et al., 2005) and touchdown PCR ( Don et al., 1991). Primers for screening and sequencing were designed with the aid of sequence-indexed Arabidopsis (Arabidopsis thaliana) T-DNA insertion data supplied by the Salk Institute for Genomic Analysis Web sites (http://signal.salk.edu/cgi-bin/tdnaexpress and http://signal.salk.edu/isects.html). Locations of reported insertion sites were confirmed by direct sequencing of flanking PCR products (utilizing a left-border T-DNA-specific forward primer in conjunction with a gene-specific reverse primer). Seeds from the positively identified homozygous lines were used to grow plants for all subsequent experiments.

Seeds were spread upon Arabidopsis agar plates ( Somerville and Ogren, 1982) with 5 m m KNO3, 2.5 m m KH2PO4, 2 m m MgSO4, 7H2O, 2 m m Ca(NO3)2, 4H2O, 50 μ m Fe(EDTA), 70 μ m H3BO3, 14 μ m MnCl2, 4H2O, 10 μ m NaCl, 1 μ m ZnSO4, 7H2O, 0.2 μ m NaMoO4, 2H2O, 0.05 μ m CuSO4, 0.01 μ m CoCl2, 6H2O, 0.8% agar, pH adjusted to 5.6 with KOH, and then stratified for 2 to 4 d at 4°C. Plates were placed under continuous light (approximately 150 μmol m −2 s −1 photosynthetically active radiation) for 7 to 10 d at 21°C for germination. Young seedlings were then transplanted into soil (1:1 ratio of Sunshine Mix 5 [SunGro Horticulture] and Seeding Mix [West Creek Farms]) and grown under the same light and temperature conditions as above.

Wax Extraction and Chemical Characterization

Leaves or stems were harvested from plants 4 to 7 weeks after plating. Total cuticular wax mixtures were extracted by immersing whole organs twice for 30 s into chloroform (CHCl3). The two solutions were combined, n-tetracosane (C24 alkane) was added as an internal standard, and the solvent was completely evaporated under vacuum. In TLC analyses, approximately 2 mg of wax were separated on silica gel with chloroform mobile phase using the sandwich technique ( Tantisewie et al., 1969) and visualized by staining with primuline and UV light.

For GC analyses, samples were resuspended in approximately 300 μL of CHCl3, transferred to a GC autosampler vial, dried under nitrogen, and derivatized with 10 μL of N,O-bis(trimethylsilyl) trifluoroacetamide (Sigma) and 10 μL pyridine (Fluka) for 60 min at 70°C. Wax composition was analyzed using a capillary GC (5890 n Agilent column 30-m HP-1, 0.32-mm i.d., d f = 0.1 μm Agilent) with He carrier gas inlet pressure programmed for constant flow of 1.4 mL min −1 with a MS detector (5973 n Agilent). GC was carried out with temperature-programmed on-column injection and oven temperature set at 50°C for 2 min, raised by 40°C min −1 to 200°C, held for 2 min at 200°C, raised by 3°C min −1 to 320°C, and held for 30 min at 320°C. Individual wax components were identified by comparing their mass spectra with those of authentic standards and literature data. Quantitative analysis of wax mixtures was carried out using capillary GC with flame ionization detector under the same conditions as above, but with H2 carrier gas inlet pressure regulated for constant flow of 2 mL min −1 .

Wax loads were determined by comparing GC-flame ionization detector peak areas against internal standard and dividing by the surface area extracted for the corresponding sample. Total leaf surface areas were calculated with ImageJ software ( Abramoff et al., 2004) by measuring the apparent leaf areas in digital photographs and multiplying by 2. Stem surface areas were calculated by measuring the projected two-dimensional stem areas in photographs and multiplying by π.

Semiquantitative RT-PCR

Total RNA was extracted from stems, roots, buds, and leaves of 4-week-old plants grown in soil. Tissues were ground up thoroughly in 200 μL of RNA later (Ambion/Applied Biosystems), using a tube and motorized pestle. The lysate was processed immediately by a Qiagen RNeasy plant mini kit and then used as template for RT by Moloney murine leukemia virus reverse transcriptase (New England Biolabs). cDNAs used for semiquantitative RT-PCR were normalized based on the intensity of PCR-amplified ACTIN2 fragments generated by the primers 5′-CCAGAAGGATGCATATGTTGGTGA-3′ and 5′-GAGGAGCCTCGGTAAGAAGA-3′ (yielding an approximately 250-bp fragment). MAH1 gene-specific primers 5′-AACTTTGTGCCCGCTTGGAA-3′ and 5′-ACAGCTTTGGCCACTGTCAA-3′ (generating a 434-bp fragment) were used in reactions conducted simultaneously under identical conditions as ACTIN2 controls. Because these primers amplify a downstream region of the gene stretching from +726 to +1,160 and because the mah1-1 T-DNA insert had been proposed to be localized approximately at position +692, we used an additional set of primers, 5′-ATGGCGATGCTAGGTTTTTACGTA-3′ and 5′-TTCGCCAATATCCGCAGCTT-3′ ranging from +1 to +638 to determine mah1-1 steady-state transcript levels.

Cryo-SEM

Segments from the apical 4 to 6 cm of stems were mounted onto cryo-SEM stubs using graphite paste and plunged into liquid nitrogen. Frozen stems were transferred into an Emitech K1250 cryosystem and water sublimed for 10 min at −110°C. Samples were viewed with a Hitachi S4700 field emission SEM (Nissei Sangyo America) using an accelerating voltage of 1.5 kV and a working distance of 12 mm.

Cloning of MAH1 and Construction of Vectors for Expression of MAH1:GFP and MAH1 Promoter:GUS Fusions

With aid from The Arabidopsis Information Resource SeqViewer (http://www.arabidopsis.org), 3,126 bp of Arabidopsis chromosome 1 surrounding and including the At1g57750 coding sequence (GenBank accession no. AY090941) was PCR amplified (Phusion DNA pol Finnzymes/NEB) using isolated genomic Col-0 DNA as a template with primers 5′-GCCGTTGGATGATGAATATGCACGACT-3′ and 5′-TTACAAAGATTCGAGGACCGGGCA-3′. The resulting product included the proposed 5′-UTR, 3′-UTR, the entire open reading frame (which lacks introns) of MAH1 (CYP96A15), and the additional nucleotide sequence stretching 1,310 bp upstream of the 5′-UTR. This genomic fragment was cloned into pGEM-EZ (Promega), then sequenced and found to perfectly match The Institute for Genomic Research sequence published on The Arabidopsis Information Resource. All subsequent constructs were made by using this clone as template.

Two MAH1-GFP C-terminal fusion constructs were produced using GATEWAY λ-phage-based site-specific recombination ( Landy, 1989 Hartley et al., 2000 Walhout et al., 2000). The first, pGWB4-MAH1N (the pGWB series was a kind gift from Tsuyoshi Nakagawa, Shimane University all pGWB sequences are available at http://bio2.ipc.shimane-u.ac.jp/pgwbs/index.htm), was designed to express MAH1:GFP under the control of the native (approximately 1,310 bp) promoter and the second, pGWB5-MAH135S, was designed to express MAH1:GFP under the control of the CaMV 35S promoter. pGWB4-MAH1N was constructed using the forward primer 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTTT GCCGTTGGATGATGAATATGCACGACT-3′ (underlined sequences = directional attB sites) and the reverse primer (without a stop codon) 5′- GGGGACCACTTTGTACAAGAAAGCTGGGTT TATCTTCTTTGTGACTGTGACTTTAAGACC-3′. pGWB5-MAH135S was constructed using the forward primer 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTTT ATGGCGATGCTAGGTTTTTACGTA-3′ along with the same reverse primer as pGWB4-MAH1N. One MAH1 promoter:GUS fusion construct (pGWB3-MAH1P) was produced by using the reverse primer 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT CAAAAGGATTTATGAGTATAGATACAAAACT-3′ (spanning into the 5′-UTR) along with the forward primer from pGWB4-MAH1N.

Resultant PCR products were placed into vector pDONR221 (Invitrogen) by performing a BP reaction (attB × attP → attL + attR) using Integrase and Integration Host Factor in the form of BP Clonase II (Invitrogen). Integrated constructs were then inserted in frame into binary vectors for fusion with either GFP (pGWB4 or pGWB5) or GUS (pGWB3) by performing an attL × attR → attB + attP reaction (LR reaction with Integrase, Integration Host Factor, and excisionase in the form of LR Clonase II from Invitrogen) between the entry clone (pDONR221) and the appropriate pGWB acceptor vector. Finished binary vector constructs were sequenced to confirm that the sequence was maintained.

GUS and GFP Visualization

Expression of GUS in transgenic pGWB3-MAH1P:GUS wild-type (Col-0) plants was assayed by submerging whole-plant tissues in acetone under vacuum for 30 min and then washing in buffer composed of 0.1% Triton X-100, 0.25 m m K4Fe(CN)6, 3H2O, 0.25 m m K3Fe(CN)6, 3H2O, and 50 m m phosphate buffer, pH 7.0, three times for 5 min each. Washed tissues were subsequently stained by incubation in this same buffer with the addition of 1 m m 5-bromo-4-chloro-3-indolyl-β- d -glucuronide under vacuum for 30 min, and then at ambient pressure (with gentle agitation) at 37°C for 16 h. Afterward, stained tissues were placed in 70% ethanol and imaged using a Stemi 2000-C dissecting microscope (Zeiss) mounted with a QCAM digital camera (QImaging) and Openlab 4.01 software (Improvision).

Arabidopsis plants were immersed for 10 to 30 min either in FM4-64 (8.2 μ m ) solution ( Vida and Emr, 1995) for plasma membrane staining or in rhodamine B hexyl ester solution (1.6 μ m ) for ER staining. Autofluorescence, as well as GFP, rhodamine B hexyl ester, and FM4-64 fluorescence was examined with a Zeiss LSM 5 Pascal confocal laser-scanning microscope. The excitation wavelength for GFP was 488 nm with the emission filter set at 505 to 530 nm autofluorescence was detected using an emission filter set at 600 to 650 nm. The excitation wavelength for rhodamine B hexyl ester was 568 nm with the emission filter set at 600 to 650 nm. The excitation wavelength for FM4-64 was 514 nm with the emission filter set at 600 to 650 nm.

Statistics

Comparisons of wild-type and mutant wax data utilizing mixed-effect univariate ANOVA (α = 0.05 treatment as a fixed effect, batch nested within treatment as a random effect), Dunnett's t, and Tukey-Kramer posthoc tests (α = 0.05 using harmonic means in cases of unequal n) were conducted with SPSS 11.0 software. When necessary to meet assumptions of normality or equal variance, datasets were transformed into normal scores using Tukey's formula (r − 1/3)/(w + 1/3), where r is the rank and w is the sum of the case weights ( Tukey, 1962). For each analysis, type II error statistics (β) were also calculated. Üçün dəyərlər β range from 0 to 1 and correspond directly to the chance of committing type II error in an ANOVA F test. The power of an ANOVA F test can be calculated as 1 − β, yielding the probability that the F test will detect the differences between groups equal to those implied by sample differences ( Sokal and Rohlf, 1995).

Supplemental Data

Supplemental Figure S1 . Cryo-SEM of inflorescence stem surfaces.

Supplemental Figure S2 . Confirmation of MAH1 subcellular localization.



Şərhlər:

  1. Deunoro

    Bizim aramızda, google.com-da axtarış etməyi məsləhət görürəm

  2. Shaktim

    Cavab əladır :)

  3. Diamont

    With this I completely agree!



Mesaj yazmaq