Məlumat

V(D)J rekombinasiyasını təsvir etmək üçün hansı proses düzgündür? RAG-1 və RSS təkrarlanan proses

V(D)J rekombinasiyasını təsvir etmək üçün hansı proses düzgündür? RAG-1 və RSS təkrarlanan proses


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mən V(D)J rekombinasiyasını öyrənirəm. Düşünürəm ki, prosesin izahı ilə bağlı iki uyğun olmayan kitabım var. Hansı doğrudur?

  • Hüceyrənin Molekulyar Biologiyasında 5-ci Nəşr, ilk olaraq RAG (-1?) müstəqil olaraq V və J genlərinin RSS-lərinə birləşir. Bundan sonra, təsadüfi (?) RAG-ların parçalanması ilə bir saç sancağı döngəsi formalaşır.
  • Janeway's Immunobiology 8th Ed., RAG kompleksində (RAG-1 və RAG-2) əvvəldən RSS-lər üçün iki sayt var. Şəkildə V geni ilk olaraq bir sayt üçün işə götürülür. J geni V genindən sonra RAG kompleksinə birləşir.

-dən çıxarış Hüceyrə və molekulyar immunologiya, 8-ci ED, s.181-182. Mənə səs vermə, sadəcə düşündüm ki, bu mətn yaxşı, müasir izahat təqdim edir.

V(D)J Rekombinasiyasının Mexanizmi

Ig və TCR genlərinin yenidən təşkili bir neçə fermentin koordinasiyalı fəaliyyəti ilə vasitəçilik edilən qeyri-homoloji DNT rekombinasiyası hadisəsini təmsil edir, bəziləri yalnız inkişaf etməkdə olan limfositlərdə olur, digərləri isə hər yerdə yayılmış DNT-nin ikiqat zəncirli qırılma təmiridir (DSBR). fermentlər.V(D)J rekombinasiyasının mexanizmi kifayət qədər yaxşı başa düşülsə də və burada təsvir edilsə də, rekombinasiyada iştirak edən mexanizmlər üçün konkret lokusların tam olaraq necə əlçatan edildiyi hələ müəyyən edilməmişdir. Çox güman ki, Ig və TCR lokuslarının rekombinasiyaya vasitəçilik edən fermentlərə əlçatanlığı inkişaf edən B və T hüceyrələrində bir neçə mexanizmlə tənzimlənir, o cümlədən əvvəllər müzakirə edildiyi kimi xromatin strukturunda və DNT-də epigenetik dəyişikliklər və gen lokuslarında bazal transkripsiya aktivliyi. . V(D)J rekombinasiya prosesini ardıcıl olaraq birindən digərinə keçən dörd fərqli hadisəyə bölmək olar (Şəkil 8-10):

1. Sinaps: Antigen reseptor geninin yerləşdiyi xromosomun hissələri rekombinasiya mexanizmi üçün əlçatan edilir. Seçilmiş iki kodlaşdırma seqmenti və onlara bitişik RSS-lər xromosomal döngə hadisəsi ilə bir araya gətirilir və sonrakı parçalanma, emal və birləşmə üçün vəziyyətdə saxlanılır.

2. Kəsmə: Limfoid spesifik mexanizmlər tərəfindən RSS-kodlaşdırma ardıcıllığı qovşaqlarında enzimatik olaraq iki telli qırılmalar yaradılır. Rekombinasiyanı aktivləşdirən gen 1 və rekombinasiyanı aktivləşdirən gen 2 (RAG1 və RAG2) adlanan limfoid-spesifik genlər tərəfindən kodlanmış iki zülal V(D)J rekombinasiyasında mühüm rol oynayan, hər bir zülalın iki molekulunu ehtiva edən kompleks əmələ gətirir. Rag-1/Rag-2 kompleksi həmçinin V(D)J rekombinaz kimi tanınır. Rag-1 zülalı, məhdudlaşdırıcı endonükleaza oxşar şəkildə, heptamer və kodlaşdırma seqmenti arasındakı birləşmədə DNT ardıcıllığını tanıyır. onu parçalayır, lakin o, yalnız Rag-2 zülalı ilə kompleksləşdikdə enzimatik aktivdir. Rag-2 zülalı Rag-1/Rag-2 tetramerini digər zülallarla əlaqələndirməyə kömək edə bilər, o cümlədən bu zülalları müəyyən vaxtlarda və limfosit inkişafının müəyyən mərhələlərində xüsusi açıq reseptor gen lokuslarına gətirən əlçatanlıq amilləri. Rag-1 və Rag-2, xromosom qatlanması və ya sinaps prosesi zamanı gen seqmentlərini bir yerdə tutmağa kömək edir. Rag-1 daha sonra kodlaşdırma ucu ilə heptamer arasında nick yaradır (bir DNT zəncirində). Kodlaşdırma ucunun sərbəst buraxılmış 3'OH daha sonra digər DNT zəncirindəki fosfodiester bağına hücum edərək kovalent saç sancağı yaradır. Siqnal ucu (heptamer və RSS-in qalan hissəsi daxil olmaqla) saç sancağı yaratmır və əlavə emaldan keçməyən küt ikiqat zəncirli DNT terminalı kimi yaradılır. Bu iki telli qırılma, bir kodlaşdırma seqmentinin qapalı saç sancağının digər kodlaşdırma ucunun qapalı saç sancağına uyğun olaraq tutulması və iki küt rekombinasiya siqnal uclarının bir-birinin yanında yerləşməsi ilə nəticələnir. Rag-1 və Rag-2, cüt telli qırıqlar yaratmaqdan başqa, kodlaşdırma uclarının dəyişdirilməsindən və bağlama prosesindən əvvəl saç sancağının uclarını və küt uclarını bir yerdə saxlayır.

RAGgenlər limfoid spesifikdir və yalnız inkişaf edən B və T hüceyrələrində ifadə edilir. Rag zülalları əsasən hüceyrə dövrünün G0 və G1 mərhələlərində ifadə edilir və çoxalmış hüceyrələrdə təsirsizləşir. Düşünülür ki, DNT parçalanması və rekombinasiyasının G 0 və G1 mərhələləri ilə məhdudlaşdırılması DNT replikasiyası və ya mitoz zamanı uyğun olmayan DNT qırılmalarının yaranması riskini minimuma endirir. Funksional Rag1 və ya Rag2genləri olmayan siçanlar (Ragknockout siçanlar) B və ya T limfositlərini inkişaf etdirə bilmir və Rag-1 və ya Rag-2 çatışmazlığı da xəstələrdə bütün limfositlərin olmadığı SCID-nin nadir səbəbidir.

3. Saç sancağının açılması və son işlənməsi: Qırılmış kodlaşdırma ucları əsasların əlavə edilməsi və ya çıxarılması ilə dəyişdirilir və beləliklə, daha çox müxtəliflik yaranır. İki telli qırıqların formalaşmasından sonra, kodlaşdırma qovşaqlarında saç sancaqları həll edilməlidir (açılmalı) və daha çox diversifikasiyanı təmin etmək üçün kodlaşdırma uclarına əsaslar əlavə edilə və ya çıxarıla bilər. Artemisis kodlaşdırma uclarında saç sancaqlarını açan endonükleazdır. Artemida olmadıqda, saç sancaqları açıla bilməz və yetkin T və B hüceyrələri əmələ gələ bilməz. ARTEMİS-dəki mutasiyalar, RAG1 və ya RAG2 mutasiyaları olan xəstələrdə olduğu kimi, SCID-nin nadir səbəbidir. (bax: Fəsil 21). Terminal deoksinukleotidil transferaza (TdT) adlanan limfoid spesifik ferment qırıq DNT uclarına əsaslar əlavə edir və qovşaq müxtəlifliyi kontekstində daha sonra fəsildə müzakirə olunacaq.

4. Qoşulma: Qırılan kodlaşdırma ucları, eləcə də siqnal ucları qeyri-homoloji uc birləşmə adlanan bütün hüceyrələrdə tapılan ikiqat telli qırılma təmiri prosesi ilə birləşdirilir və bağlanır. Qeyri-homoloji son birləşmədə bir sıra hər yerdə mövcud olan amillər iştirak edir. Ku70 və Ku80, qırılmalara bağlanan və DNT-dən asılı protein kinazın (DNT-PK) katalitik alt vahidini, ikiqat zəncirli DNT təmiri fermentini işə götürən DNT-ni son bağlayan zülallardır. Bu ferment ağır kombinə edilmiş immunçatışmazlığı (scid) mutasiyasını daşıyan siçanlarda qüsurludur və bu fermenti kodlayan gendə mutasiyalar insan SCID xəstələrində də aşkar edilmişdir (bax. Fəsil 21). Cırtdan çatışmazlığı olan siçanlar kimi, scidmice yetkin lenfositlər istehsal edə bilmir. DNT-PK həmçinin, əvvəllər qeyd edildiyi kimi, son emalda iştirak edən Artemis-i fosforlaşdırır və aktivləşdirir. İşlənmiş qırıq ucların bağlanmasına DNT liqaza IV və XRCC4 vasitəçilik edir, sonuncu liqazanın katalitik olmayan, lakin əsas alt bölməsidir.

Şəkil 8-10, Hüceyrə və Molekulyar İmmunologiya, 8e, p182.


RAG hədəfləri və RAG fəaliyyəti üçün yeni kəmiyyət flüoresan müxbir analizi


Rekombinasiyanı aktivləşdirən genlər (RAG) 1 və 2, lenfositlərin inkişafı üçün tələb olunan və onların müxtəlif antigen reseptorları repertuarına cavabdeh olan V(D)J rekombinasiyasına vasitəçilik edən sahəyə məxsus rekombinazanı təşkil edir. Səhv hədəflənmiş RAG fəaliyyəti genom dəyişikliyi ilə əlaqələndirilir və müxtəlif limfoid şişlərdən məsuldur. Bundan əlavə, bir sıra qeyri-limfoid şişlər ektopik olaraq RAG ifadə edir. İmmunologiya, onkologiya, gen terapiyası və inkişaf sahələrində RAG fəaliyyətinin kəmiyyət qiymətləndirilməsini həyata keçirmək və ehtimal olunan RAG-tanınma siqnal ardıcıllığını (RSS) qiymətləndirmək üçün praktik və güclü alət tələb olunur. Burada biz sadə axın sitometriyası analizi ilə rekombinasiya səmərəliliyini (RE) ölçməyə imkan verən alət olan GFPi adlı RAG fəaliyyətinin flüoresan əsaslı yeni məruzəçisinin ətraflı təsvirini təqdim edirik. GFPi həm hüceyrə xətlərində keçici transfeksiya təcrübələri üçün plazmid, həm də genomda sabit inteqrasiya üçün retrovirus kimi istehsal oluna bilər. ex vivoin vivo təhsil alır. GFPi analizi, genetik cəhətdən dəyişdirilmiş fibroblastlarda, şiş törəmə hüceyrə xətlərində, inkişaf edən pre-B hüceyrələrində və hematopoetik hüceyrələrdə sınaqdan keçirildiyi kimi endogen və ektopik RAG aktivliyini sədaqətlə müəyyən etdi. GFPi təhlili də daxil olmaqla müxtəlif RSS cütlərinin RE-ni uğurla sıraladı vicdanlı V(D)J seqmentləri ilə əlaqəli RSS, onların effektivliyinə təsir etdiyi məlum olan spesifik nukleotidlərdə dəyişdirilmiş və ya edilməmiş süni konsensus ardıcıllığı və ya onkogenlərin RAG-dan asılı aktivləşdirilməsində iştirak edən sirli RSS. Bizim işimiz GFPi müxbirini RAG fəaliyyətinin və RSS səmərəliliyinin öyrənilməsi üçün praktiki kəmiyyət aləti kimi təsdiqləyir. O, RAG-vasitəçiliyi ilə V(D)J və anormal yenidən qurulmaların, nəsil öhdəliyinin və onurğalıların təkamülünün öyrənilməsi üçün faydalı olmalıdır.


ORİJİNAL ARAŞDIRMA məqaləsi

Justyna Mika 1, Sylwia Kabacik 2, Christophe Badie 2, Joanna Polanska 1 və Serj M. Candéias 3 *
  • 1 Data Mining şöbəsi, Silesian Texnologiya Universiteti, Gliwice, Polşa
  • 2 Xərçəng Mexanizmləri və Biomarkerlər Qrupu, Radiasiya Təsirləri Departamenti, Radiasiya, Kimyəvi və Ətraf Mühit Təhlükələri Mərkəzi İctimai Sağlamlıq İngiltərə Chilton, Didcot, Birləşmiş Krallıq
  • 3 Université Grenoble Alpes, CEA, CNRS, IRIG-LCBM, Grenoble, Fransa

Antigen T-hüceyrə reseptorunun (TR) alt bölmələrini kodlayan genlər, sahəyə xüsusi rekombinasiya prosesi ilə diskret V, D və J genlərindən olan timositlərdə yığılır. Potensial olaraq zərərli rekombinasiya hadisələrinin qarşısını almaq üçün bu fəaliyyətə ciddi nəzarət tələb olunur. V, D və J genləri rekombinasiya siqnal ardıcıllığı (RSS) adlanan yarı qorunan nukleotid motivləri ilə əhatə olunur. V(D)J rekombinasiyası, RAG rekombinazı tərəfindən genlərin və onların RSS-lərinin sərhəddində DNT ikiqat zəncirinin dəqiq şəkildə daxil edilməsi ilə başlanır. Buna görə də, RSS-lər yenidən qurulmuş TR geninin yığılmasından əvvəl genlərin kodlaşdırma bölgəsindən fiziki olaraq ayrılır. Siçanlarda TRB genlərinin yüksək məhsuldarlıq profili zamanı biz V-D və ya D-J kodlaşdırma birləşmələrində yan RSS-nin bir hissəsinin və ya hamısının saxlanıldığı yenidən təşkil edilmiş TRB genlərini müəyyən etdik. Bəzi hallarda, cücərmə xətti DNT-nin bu tutulması alternativ RSS-in istifadəsi nəticəsində baş verir. Bununla belə, alternativ RSS olmadıqda cücərmə xətti DNT-nin tutulmasının baş verdiyi TRB ardıcıllıqlarını da müəyyən etdik ki, bu da rekombinasiya zamanı RAG fəaliyyətinin səhv hədəfləndiyini göstərir. Bənzər hadisələr insan yenidən qurulmuş TRB və TRG genlərində də müəyyən edilmişdir. V(D)J rekombinasiyası zamanı alternativ RSS-lərin istifadəsi V(D)J rekombinasiyası zamanı RAG-RSS-lərin qarşılıqlı təsirlərinin mürəkkəbliyini göstərir. Yanlış hədəflənmiş RAG fəaliyyəti nəticəsində yaranan xətaların tezliyi çox aşağı olsa da, biz inanırıq ki, bu RAG səhvləri onkogen translokasiyaların mənşəyində ola bilər və limfositlərin inkişafında genetik sabitlik üçün təhlükədir.


RAG kompleksinin biokimyası

Bəzən V(D)J rekombinaz adlanan RAG kompleksi iki polipeptiddən, RAG1 və RAG2-dən ibarətdir [17]. RAG1 və RAG2 zülallarının ifadəsi B və T hüceyrələrinin inkişafında məhduddur və beləliklə, V(D)J rekombinasiyasını nəsil və vaxta uyğun olaraq məhdudlaşdırır. RAG genlərinin kəşfindən bəri zülal kompleksinin geniş biokimyası aparılmışdır. RAG1-də nükleolitik reaksiya üçün lazım olan iki valentli kationları (DDE motivi) koordinasiya edən konservləşdirilmiş ardıcıllıqla spesifik DNT-ni bağlama motivi (adsız bağlama motivi, NBD) və üç turşulu amin turşusu var (Şəkil 2a) [18]. RAG2-nin öz-özünə aşkar edilə bilən DNT bağlaması və ya katalitik aktivliyi yoxdur, lakin nukleolitik fəaliyyət yalnız RAG1 və RAG2 kompleksi meydana gətirdikdə aktivləşir [19]. Yüksək hərəkətlilik qrupu zülalı B1 (HMGB1) və HMGB2 RAG parçalanma fəaliyyətini in vitro stimullaşdırır, lakin onun in vivo V(D)J rekombinasiyası daxilində funksiyası daha az aydındır. RAG kompleksi tərəfindən DNT-nin parçalanması bir sıra molekulyar hadisələrlə əldə edilir (Şəkil 2b). Əvvəlcə RAG kompleksi RSS-i tanıyır və sonra hər 12- və ya 23RSS-in 5′ sonunda nicking təqdim edir. RAG kompleksi daha sonra kodlaşdırma uclarında DNT saç sancaqları istehsal etmək üçün transesterifikasiyanı katalizləyir və bununla da DSB-lər yaranır. DSB-lər 12/23RSS (12/23 sinapsis) arasında səmərəli şəkildə baş verir. RAG kompleksinin aktiv bölməsi 2 RAG1 və 2 RAG2 daxil olmaqla heterotetramerdən ibarətdir, lakin RAG reaksiyasının kinetik sırası hələ aydın deyil [20-22]. Bir RAG tetrameri hər RSS-də nickinq addımını yerinə yetirə bilər və sonra iki RAG tetrameri DSB-ləri yaratmaq üçün birlikdə işləyə bilər. Və ya bir RAG tetrameri əvvəlcə iki RSS saytını sinaps edə bilər və sonra həm nicking, həm də DSB əmələ gəlməsini kataliz edə bilər. Biokimyəvi analizlərin məhdudiyyətlərinə görə biz in vitro parçalanma analizinin eksperimental olaraq müəyyən edilmiş kinetik məlumatlarına uyğun gələn kinetik modelləri tapmaq üçün riyazi simulyasiyalardan istifadə etdik [23]. Bu yanaşmaya əsasən, bir RAG tetramerinin 12RSS və 23RSS-ni sinapsisə gətirməsi, ardınca nicking və hairpinning (şək. 2b) olması proqnozlaşdırılır.

RAG kompleksinin biokimyası. a RAG kompleksi ilə DNT-nin parçalanması modeli. RAG kompleksi 12/23 sinapsis kompleksində hər RSS-də hidroliz yolu ilə nickinqi birləşdirir və katalizləyir. Üst zəncirinin 3′-OH RAG kompleksinin mövcudluğunda alt zəncirinə hücum edir və bununla da ikiqat zəncirli DNT qırılması ilə nəticələnir. Kodlaşdırma ucları DNT saç sancaqlarını əmələ gətirir, siqnal ucları isə 3′-OH ilə küt uclardır. b Sıçan RAG zülallarının domen təşkilatı. RAG1 əsas bölgəsi (a.a. 384-1,008) adsız bağlayıcı sahəni (NBD a.a. 389-446), sink barmağı B (ZFB a.a. 727-750) və aktiv sahəni, DDE motivini (a.a. 600, 708, 962) ehtiva edir. RAG1 əsas olmayan bölgəsində üzük barmağı (RING) var a.a. 299–330 və sink barmağı A (ZFA) a.a. 353–374. RAG2 əsas bölgəsi (a.a. 1-387) PHD bitki homeodomain barmaq a.a. 414–481 T490 siklin-asılı kinaz tərəfindən fosforilləşmə yeri (left( < ext)> sağ)_>) , ubiquitylation saytı

RAG zülalları daxilində in vitro biokimyəvi parçalanma analizləri və hüceyrədənkənar xromosomal V(D)J rekombinasiya analizləri üçün lazım olan bölgələr əsas RAG1 və əsas RAG2 adlanır (Şəkil 2a) [17]. Digər tərəfdən, RAG zülallarının əsas olmayan bölgələri genomik V(D)J lokuslarının səmərəli rekombinasiyası üçün lazımdır. Əhəmiyyətli odur ki, əsas olmayan bölgələrdəki mutasiyalar SCID-yə səbəb olur, lakin onların funksiyaları yaxşı başa düşülmür [24]. Qeyri-core bölgədəki RAG1 N terminalı ubiquitin ligase (E3) aktivliyinə malik olan və ya VprBP/DDB1/Cul4A/Roc1 zülalları ilə kompleksdə olan RING barmaq sahəsini ehtiva edir [25-27]. Bildirildi ki, bu bölgə histon H3-ü bağlayır və ubiquitinates, ehtimal ki, RAG kompleksini DSB təmir prosesi ilə əlaqələndirir. C terminalındakı RAG2 əsas olmayan bölgə, ardıcıllığın spesifikliyinin ayrı-seçkiliyinə töhfə verməklə genomun qeyri-sabitliyində rol oynayır [28-30]. Bu bölgədə həmçinin Thr490-da siklin A-Cdk2 üçün fosforlaşma yeri və PHD barmağı var [31]. Thr490 və 499-508 amin turşularını əhatə edən interval, Skp1-Cul1-Skp2 (Skp2-SCF) asılı poliubikitasiya ilə G1-S keçidində RAG2-nin dövri məhv edilməsi ilə əlaqələndirilir [32, 33]. V(D)J rekombinasiyası G1 fazasında baş verdiyi üçün RAG zülalının məhv edilməsi G1-dən kənarda aberrant RAG fəaliyyətinin qarşısını almaq üçün fəaliyyət göstərə bilər. RAG2 PHD barmağı hipermetilləşdirilmiş histon H3 lizin4-ü xüsusi olaraq bağlayır və bununla da səmərəli DSB əmələ gəlməsinə kömək edir, bu barədə daha sonra bu baxışda müzakirə edəcəyik [10-13].


Nəticələr

RAG-2-nin şərti inaktivasiyasına imkan verən siçan ştammının yaradılması və xarakteristikası.

Gen hədəfləmə strategiyası və rekombinant ES hüceyrələrinin Southern blotting üsulu ilə skrininqi müvafiq olaraq Şəkil 1A və Şəkil B-də göstərilmişdir. Şərti RAG-2 allel (RAG-2 fl ) C57BL/6 cücərmə xəttinə ötürüldü və mutant siçanlar təhlil edildi. BM-də B hüceyrə limfopoez RAG-2 fl/fl siçanları normal idi və periferik B hüceyrə hovuzunun ölçüsü vəhşi tipli siçanlarla müqayisə oluna bilərdi, bu da heç bir müdaxilənin olmadığını göstərir. RAG-2 ikisinin daxil edilməsi ilə ifadə edilir loxP saytlar (məlumatlar göstərilmir). Üçün homozigot siçanlar yaratmaq RAG-2 silinmə (RAG-2 del/del), RAG-2 fl/fl siçanları keçib silici hər yerdə silinməsinə imkan verən gərginlik loxP-germ hüceyrələri də daxil olmaqla qanadlı gen seqmentləri 37. B və T hüceyrələrinin inkişafı RAG-2 del/del siçanları pro-B və pro-T hüceyrə mərhələlərində bloklandı və klassik fenotipin meydana gəlməsinə səbəb oldu. RAG-1RAG-2 nokaut siçanları (29,30 məlumat göstərilmir).

Genotip siçanları RAG-2 fl/del , Mx-cre, olan RAG-2 silinmə IFN və ya onun induksiyası ilə effektiv şəkildə induksiya edilə bilər, sonrakı təcrübələrimizdə Poly(I)·Poly(C) 34 istifadə edilmişdir. Yetkinlərə Poly(I)·Poly(C) intraperitoneal yeridilməsindən 2 həftə sonra RAG-2 fl/del , Mx-cre siçanları, bu heyvanlardan oxşar şəkildə müalicə olunan zibil nəzarətindən bir qədər az BM hüceyrələri bərpa edildi. IgM-mənfi populyasiyaya görə, eksperimental heyvanlarda B220 aşağı CD43 + pro-B hüceyrə bölməsi nəzarət bölmələri ilə müqayisə oluna bilərdi, halbuki B220 aşağı CD43 - B hüceyrələrinin əsas olaraq yox idi, B hüceyrələrinin inkişafı blokunu göstərir. pro-B hüceyrə mərhələsində (Şəkil 1 C). B220 aşağı IgM + yetişməmiş B hüceyrələri fon səviyyələrində idi, B220 yüksək IgM + yetkin B hüceyrələri təsirlənmədi. BM-də B hüceyrəsinin inkişafı kimi, timusda T hüceyrələrinin inkişafı pro-T hüceyrə mərhələsində bloklandı. RAG-2 silinmə (məlumat göstərilmir). Yetişməmiş B hüceyrələrinin 12,14 qısa ömrü ilə razılaşaraq, Poly(I)·Poly(C) ilə müalicə olunmuş mutantların dalağında IgM + HSA yüksək yetişməmiş B hüceyrə bölməsi fon səviyyələrinə endirildi (bax. Şəkil 1). C mutantların dalaqlarında olan bir neçə IgM + HSA yüksək hüceyrələri əsasən CD21 + və buna görə də ehtimal ki, MZ B hüceyrələri idi). Yetkin siçanlarda olduğu kimi, B hüceyrələrinin inkişafı da siçanlarda pro-B hüceyrə mərhələsində bloklandı RAG-2 doğulanda və ya 2 həftə yaşında silindi (məlumatlar göstərilmir). Bu siçanlarda, eləcə də yetkin yaşda induktorla müalicə olunanlarda Şəkil 1 C-də göstərildiyi kimi B hüceyrəsinin inkişafı bloku müşahidənin bütün dövrü ərzində saxlanılıb (göstərilməyən məlumatlara baxın). Silinmə səmərəliliyi RAG-2 Southern blotting analizi ilə ölçülən BM-də fl alleli həm böyüklərdə, həm də yenidoğulmuşlarda 100%-ə yaxın idi, halbuki dalaqda və periton boşluğundakı hüceyrələrdə ~90% olmuşdur (məlumatlar göstərilmir).

B hüceyrələrinin inkişafının induksiya edilmiş blokunun həqiqətən tamamlandığını yoxlamaq üçün biz subletal şüalanmış singenikləri bərpa etdik. RAG-1 −/ − 13 həftəlik BM hüceyrələri olan siçanlar (B və T hüceyrələri olmayan) RAG-2 fl/del , 8 həftə yaşında Poly(I)·Poly(C) ilə müalicə edilmiş Mx-cre siçanları. Eyni şəkildə müalicə olunan BM hüceyrələri RAG-2 fl/del siçanları nəzarət kimi xidmət edirdi. Köçürmədən 4 həftə sonra bərpa edilən dalaq hüceyrələrinin ümumi sayı Poly(I)·Poly(C) ilə müalicə olunan BM ilə bərpa edilmiş alıcılarda 2,8 × 106 olmuşdur. RAG-2 fl/del , Mx-cre siçanları və idarəetmədə 2.2 × 10 7. Şəkil 1 D-də göstərildiyi kimi, induksiya edilmiş mutantlardan BM hüceyrələrini almış siçanlar B hüceyrələri üçün aşkar edilə bilən sulandırma nümayiş etdirmədilər, halbuki nəzarət elementləri tamamilə yenidən quruldu. Oxşar nəticələr 19 həftəlik donor siçanların BM hüceyrələrindən istifadə etməklə əldə edilmişdir RAG-2 doğuş zamanı təsirsiz hala salınmışdı (məlumatlar göstərilmir). Hər iki sulandırma təcrübəsində iki donor siçanın BM hüceyrələri fərdi olaraq sınaqdan keçirildi. Bütün hallarda donordan qaynaqlanır RAG-2 delesiya resipiyentlərin BM-də və dalağında PCR ilə aşkar edilə bilər ki, bu da donor hüceyrələrin sonuncular tərəfindən qəbul edildiyini göstərir (məlumatlar göstərilmir).

Yetkin siçanlarda BM-dən B hüceyrə axınının induksiya olunmuş blokadası zamanı periferik B hüceyrələrinin yavaş azalması və sonrakı davamlılığı.

Dalaq, limfa düyünləri və BM-də B hüceyrələrinin sağ qalma kinetikası BM-dən yeni immiqrantların olmadığı siçanlarda izlənildi. RAG-2 8-10 həftəlik yaşlarında silindi. İdarələrlə müqayisədə, dalağındakı B hüceyrəsi hovuzunun ölçüsü RAG-2 fl/del , Mx-cre siçanları 2-ci həftədə 67%-dən (bu zaman yetişməmiş hüceyrələr yox olmuşdu [Şəkil 1 C]) Poly(I)·Poly(C) inyeksiyasından sonra 17-ci həftədə 32%-ə endirildi və sonradan 54 həftəyə qədər sabit saxlanıldı (Şəkil 2 A). Limfa düyünlərində B220 + IgD + B hüceyrələrinin sayı ilk 2 həftə ərzində azalmadı və sonradan 10-cu həftə ilə 17-ci həftə arasında hüceyrə sayının sürətlə azalması (nəzarətlərin 58-dən 11% -i) ilə azaldı. induksiyadan sonra RAG-2 silinməsi (Şəkil 2 B). 17 ilə 54 həftə arasında limfa düyünlərində B hüceyrələrinin sayında daha da azalma olmadı. Şəkil 2 C-də göstərildiyi kimi, BM-də B220 yüksək IgM + yetkin B hüceyrə hovuzunun ölçüsü Poly(I)·Poly(C) inyeksiyasından 2 həftə sonra nəzarət elementləri ilə müqayisədə yarıya qədər azaldı və sonra yavaş-yavaş azaldı. müşahidə müddəti ərzində, yarımxaricolma dövrü 156 d. Dalaqda olduğu kimi, ilk 2 həftə ərzində B hüceyrələrinin sayının azalması əsasən HSA yüksək B hüceyrələrinin itirilməsi ilə bağlıdır. Birlikdə götürüldükdə, yetkin siçanların ikincil limfoid orqanlarındakı B hüceyrələrinin ümumi sayı BM-dən B hüceyrə axını olmadığı halda ilk 17 həftə ərzində azaldı və sonradan 54 həftəyə qədər saxlanıldı. Bunun əksinə olaraq mutantların periton boşluğundakı IgM + CD5 + B-1a hüceyrələrinin sayı nəzarət orqanlarının sayı ilə müqayisə edilə bilər (məlumatlar göstərilmir).

Yetkinlərdə RAG-2 silindikdən sonra FO B hüceyrələrinin azalması və MZ B hüceyrələrinin saxlanması.

MZ B hüceyrələri anatomik yeri və fenotipik xüsusiyyətləri ilə resirkulyasiya edən FO B hüceyrələrindən fərqlənir. CD21 və CD23 ifadə səviyyələrinə uyğun olaraq, dalaq B hüceyrələrini MZ (CD21 yüksək CD23 aşağı) və FO (CD21 int CD23 yüksək) B hüceyrələrinə böldük və induksiyadan sonra onların sayını izlədik. RAG-2 yetkin siçanlarda silinmə. Şəkil 3 A-da göstərildiyi kimi, səthi IgM-müsbət hüceyrələrin populyasiyasında MZ B hüceyrələrinin nisbəti 2-ci həftədə 10%-dən 17%-ə, 31-ci həftədə isə ~40%-ə yüksəlmişdir. RAG-2 Silinmə, eyni müddət ərzində idarələrdə isə sabit idi. Hüceyrə nömrələri baxımından, eksperimental heyvanların dalağındakı MZ B hüceyrə hovuzu nəzarət elementləri ilə müqayisə edilə bilər və 54 həftədən çox sabit idi (Şəkil 3 B). Bunun əksinə olaraq, FO B hüceyrələrinin sayı yavaş-yavaş azaldı, hesablanmış yarım ömrü 134 d (Şəkil 3 B) və beləliklə, BM-də təkrar dövriyyədə olan B hüceyrələrinin azalması ilə ağlabatan uyğunluq (Şəkil 2 C).

Doğuş zamanı B Hüceyrəsinin İnkişafı Engellendiğinde, Peritoneal Boşluqda B-1 Hüceyrələrinin və Dalaqda MZ B Hüceyrələrinin Genişləndirilmiş Populyasiyası ilə Kiçik Sayıda B Hüceyrələri Saxlanılır.

Yeni doğulmuş siçanlarda mövcud olan yetişməmiş B hüceyrələri BM-dən B hüceyrə axını olmadığı halda periferik B hüceyrə bölməsini nə dərəcədə qura bilər? Nə vaxt RAG-2 yenidoğulmuşlarda IFN inyeksiyası ilə silindi, heyvanlar uzun müddət dalaq və limfa düyünlərində B hüceyrələrinin kiçik bir populyasiyasını saxladılar, lakin B hüceyrələrinin sayı nəzarət qruplarında inkişaf edənlərdən çox aşağı idi (Şəkil 2D və Şəkil E). . Bunun əksinə olaraq, periton boşluğunda B-1a hüceyrələrinin (IgM + CD5 +) inkişafı pozulmadı və IFN inyeksiyasından sonra 8-ci həftədən etibarən heyvanlardan nəzarət orqanlarından 2-3 dəfə çox belə hüceyrələr çıxarıldı (Şəkil 2). 2 F). Beləliklə, doğuş zamanı B hüceyrəsi nəsil bloku B-1a hüceyrələrinin inkişafı və genişlənməsinə mane olmadı, bu, B1 hüceyrələrinin özünü yeniləyən hüceyrələr olduğunu göstərən əvvəlki tapıntılara uyğundur.

Siçanlarda MZ adətən 38 yaşdan 3 həftəyə qədər inkişaf etmir. Yeni doğulmuş siçanlarda bütün dalaq B hüceyrələri yüksək səviyyədə HSA ifadə edir və yetişməmiş fenotipə malikdir (məlumatlar göstərilmir). Təhrik etdik RAG-2 yeni doğulmuş siçanlarda IFN inyeksiyası ilə silinmə və bu heyvanların dalaqlarında olan B hüceyrələrinin BM-dən B hüceyrə axını olmadığı halda MZ B hüceyrələrinə diferensiasiya olub-olmadığını soruşdu. Təəccüblüdür ki, bəzi B hüceyrələri MZ B hüceyrə fenotipini və bəziləri FO B hüceyrə fenotipini artıq 2 həftə sonra əldə etmişlər. RAG-2 yaşla uyğunlaşdırılmış nəzarətlərdə daha az aşkar olan silinmə (Şəkil 3 C). Səth IgM-müsbət hüceyrələrin populyasiyasında MZ B hüceyrələrinin faizi 4-cü həftədən sonra 28-ci həftəyə qədər ~25% təşkil etmişdir. RAG-2 silinməsi (Şəkil 3 C). Hüceyrə sayı baxımından, MZ B hüceyrələri induksiya olunur RAG-2-çatışmaz mutantlar zamanla bir qədər artdı, 4-cü həftədə ~8 × 10 5-dən 28-ci həftədə 2 × 10 6-ya qədər RAG-2 silinməsi (Şəkil 3 D). Heyvanlarda inkişaf edən FO B hüceyrələri (Şəkil 3 C) zamanla sayca sabit qaldı (Şəkil 3 D). MZ və FO B hüceyrələrindən başqa heyvanların dalağında IgM+ və ya CD19+ hüceyrələrinin 30-50%-ni təşkil edən CD5+B hüceyrələri aşkar edilə bilər. Mütləq ədədlərlə bu, idarəetmə vasitələrinin dalağındakı CD5 + B hüceyrələrinin (B-1a hüceyrələri) bölməsinə uyğun gəlir (məlumatlar göstərilmir, lakin Şəkil 3 C, alt panelə baxın).

Axın sitometriyası ilə görünən MZ B hüceyrə hovuzunda nisbi artım histologiya səviyyəsində də aydın idi. 8-10 həftəlik yaşda mutantlarda dalağın histoloji bölmələrində nəzarətlə müqayisədə MZ B hüceyrələrində artım və FO B hüceyrələrində azalma müşahidə edilə bilər (şək. 4).

Doğuş zamanı B Hüceyrəsinin İnkişafının Engelləndiyi Siçanlarda Periferik B Hüceyrələri Aktivləşdirilmiş Fenotip Alır və Proliferativ Fəaliyyətə Sahibdir.

Doğuş zamanı B hüceyrəsinin inkişafının bloklandığı heyvanların dalağında saxlanılan kiçik B hüceyrəsi populyasiyası təkcə onların MZ B hüceyrələrinə çevrilmə meyli baxımından qeyri-adi deyil. Bu hüceyrələr də ölçüsünü artırdı və 8 həftəlik yaşda təhlil edildikdə CD25, CD69, CD86 və MHC II sinif kimi aktivləşdirmə markerlərinin yuxarı tənzimlənməsini göstərdi (Şəkil 5). MZ və ya FO fenotipindən asılı olmayaraq aktivləşdirilmiş hüceyrələr əhəmiyyətli proliferativ aktivlik nümayiş etdirdilər, MZ B hüceyrələrinin 10%-i və BrdU-nu birləşdirən FO B hüceyrələrinin 7%-i 3-günlük etiketləmə dövründən sonra nəzarətdə olan 16 və 11%-lə müqayisədə. (burada BM-dən yeni yaranan B hüceyrələrinin axını var Şəkil 6 A). DNT tərkibinə görə hüceyrələrin təhlili hüceyrələrin 1%-ə qədərinin hüceyrə dövrünün S və ya G2/M fazasında olduğunu göstərdi (Şəkil 6 A). Bu məlumatlar göstərir ki, dalaq və limfa düyünlərində bu heyvanlarda saxlanılan B hüceyrələrinin əhəmiyyətli bir hissəsi özünü yeniləyir. Bununla belə, bütün hüceyrələr bu özünü yeniləmə fəaliyyətində iştirak edə bilməz, çünki 3 həftəlik bir müddət ərzində BrdU administrasiyası hüceyrələrin ən çox dörddə birinin etiketlənməsi ilə nəticələndi (məlumatlar göstərilmir).

8 həftəlik yaşda B hüceyrələrinin inkişafının bloklandığı siçanlarda vəziyyət tamamilə fərqli idi. Bu heyvanlar Poly(I)·Poly(C) tətbiq edildikdən sonra 3 gün, 10 həftə ərzində içməli suda BrdU ilə qidalandıqda, FO B hüceyrələrinin yalnız 1%-i və MZ B hüceyrələrinin 2%-i etiketlənmişdir. nəzarətdə müvafiq olaraq 2 və 3% ilə (Şəkil 6 B). DNT tərkibinə görə, yenə də hüceyrələrin təxminən 1%-i hüceyrə dövrünün S və ya G2/M fazasında idi (Şəkil 6 B). Mümkündür ki, bu heyvanlarda qalan B hüceyrələri yalnız sonra, hüceyrə sayı B hüceyrəsinin inkişafının erkən mərhələdə bloklandığı heyvanlarda müşahidə olunan səviyyəyə düşdüyü zaman tam özünü yeniləyən fəaliyyətə sahib olur. Bu ehtimala uyğun olaraq, nə vaxt RAG-2 silinmə yetkin siçanlarda induksiya olundu, B hüceyrəsi Şəkil 5-də təsvir olunan kimi aktivləşdirilmiş fenotipi yalnız təxminən 4 ay sonra əldə etdi (məlumatlar göstərilmir).

Doğuş zamanı yaranan RAG-2-nin silinməsi serum IgM səviyyələrinin və İgM ifraz edən hüceyrələrin sayının artmasına səbəb olur.

Heyvanlarda olan B hüceyrələrinin sayı RAG-2 doğumda silindi nəzarət az 10% (Şəkil. 2D və Şəkil. E). Yenə də 8 və 17 həftəlik yaşlarında bu siçanlarda serum immunoqlobulin səviyyələri nəzarət qruplarında olanlara yaxın və bəzən hətta ondan da yüksək idi (Şəkil 7A və Şəkil B). Bu fenomeni başa düşmək üçün biz 8 həftəlik siçanların dalağında və BM-də IgM və IgG3 ifraz edən hüceyrələrin sayını təyin etmək üçün ELISPOT-dan istifadə etdik. Şəkil 7 C-də göstərildiyi kimi, IgM ifraz edən hüceyrələrin ümumi sayı induksiya edilmiş hüceyrələrdə üç-dörd dəfə çox idi. RAG-2 mutantlar nəzarət qruplarından fərqli olaraq, heyvanlarda da xeyli sayda IgG3 ifraz edən hüceyrələr var idi. Antikor ifraz edən hüceyrələr böyük ölçüdə bu heyvanlarda normal sayda olan və IgM 39 istehsalına əhəmiyyətli dərəcədə töhfə verdiyi məlum olan B-1 hüceyrələrindən yarana bilər.


İnsanların modelləşdirdiyi homojen hüceyrələr üçün maksimum yerdəyişmə 2 ​​ilə 4 m arasında dəyişdi ki, bu da nəhəng vakuolların bildirilən ölçüləri ilə müqayisə edilə bilər (Tripathi 1972)

İnsanların modelləşdirdiyi homojen hüceyrələr üçün maksimum yerdəyişmə 2 ​​ilə 4 m arasında dəyişdi ki, bu da nəhəng vakuolların ölçüləri ilə müqayisə edilə bilər (Tripathi 1972). periferiyalarından öz alt təbəqələri ilə əhəmiyyətli əlavələrə malikdirlər. Bu, örtüyün yarada biləcəyi hərəkət müqavimətinə məhdudiyyətlər qoyur, bu, demək olar ki, bütün hərəkət müqavimətinin sağlam və qlaukomatoz gözdə yaradıla biləcəyi veb saytla bağlı təsirləri ehtiva edir. irisCkornea mövqeyindən genişlənmədə sulu gülüş hərəkətinin yolunu göstərən gözün ön hissəsinin sxematik təsviri (SC-nin daxili divar quruluşunu inkişaf etdirən endotel hüceyrələrinin ötürücü elektron mikroqrafında sulu gülüş SC.V lümeninə daxil olmaq üçün dəri məsamələri vasitəsilə endoteldən keçir. , böyük vakuollar JCT, juxtacanalicular birləşdirici hüceyrələr (Overby et al. 2014) Schlemms kanal hüceyrələri nisbətən eksklüziv biomexaniki mühitin alfa-Amanitin mərhəmətindədirlər.Damar endotel hüceyrələrindən fərqli olaraq, apikal-bazal təzyiq qradientinə məruz qalırlar. SC hüceyrələri bazal membranı ilə hüceyrələrini köməkçi bazal membrandan itələyən bazal-apikal təzyiq gradientinin mərhəmətindədir.Nəticədə SC hüceyrələri böyük deformasiyalardan keçir və böyük vakuollar kimi tanınan konstruksiyalar yaradır (Brilakis və Johnson 2001 Grierson and Lee 1977) bu deformasiyaların bu hüceyrələrdə məsamələrin inkişafı ilə nəticələndiyinə inanılır. sulu gülüş hərəkət edir (Ethier et al. 1998 Johnson et al. alfa-Amanitin 1990). Məsamələrin sıxlığının qlaukomatoz gözdə aşağı alfa-Amanitinə çevrilməsi müşahidə olunmağa davam etdiyi üçün (Allingham et al. 1992 Johnson et al. 2002), SC-nin daxili divar strukturundan biomexanikanı daha yaxşı başa düşmək lazımdır. Burada biz RAC2 seriyalı blok üz skan edən elektron mikroskopiyasının (SBSEM) və sonlu komponent modelləşdirməsinin (FEM) istifadəsini SC hüceyrələrinin modulundan atom təkan mikroskopiyası (AFM) ölçmələri ilə birlikdə təsvir edirik (Vargas-Pinto et al. 2013) Hüceyrə həndəsəsinin nəticələrini, hüceyrə sıxlığının, həmçinin hüceyrə korteksinin SC hüceyrələrinin təzyiq nəticəsində yaranan deformasiyasına olan töhfəsini xarakterizə etmək üçün bu hüceyrələrin də dəstəkləyə biləcəyi ən yüksək təzyiq düşməsini hesablayırıq. Bu yuxarı təyinatı yaratmaqla, SC-nin daxili divar strukturunun endotelinin müntəzəm çıxış yolu üzərində tam təzyiq düşməsinin əhəmiyyətli kiçik bir hissəsinə kömək etmək üçün ədalətli bir şəkildə qəbul edilə biləcəyini müəyyən edə bilərik. 2 Strategiyalar 2.1 SC hüceyrələrinin təsviri Göz xəstəliyi məlum olmayan (yaş 69 və 70 yaş) iki insan donor gözü ölümdən sonra 24 saat ərzində Ölkə üzrə Xəstəliklərin Tədqiqi Mübadiləsindən (Filadelfiya, PA) qəbul edilmişdir. Trabekulyar şəbəkənin radial və frontal toxuma nümunələri 0,1-M natrium kakodilat tamponunun içərisində 2,5% qlutaraldehid və 4% paraformaldehid ilə quruldu və kəsildi. Qurulmuş toxumalar tannik turşuluğu ilə boyanmış və tetrakarbohidrazid müalicəsi ilə müşayiət olunan osmium-ferrosiyanid ilə boyanmış və daha sonra sulu osmium tetroksid ilə boyanmışdır. Bundan sonra hüceyrələr doymuş sulu uranil asetatda inkubasiya edilib və Waltons biznes qurğuşun aspartatı müşayiət olunub (Deerinck et al. 2010). Üçüncüsü, toxumalar susuzlaşdırılmış və Eponda inlayasiya edilmişdi. SBSEM picture data sets had been obtained at Renovo Neural Inc. (Cleveland, OH). An example image is provided in Online Source 1. The cells blocks were installed, analyzed, and sectioned inside a Zeiss Sigma VP checking electron microscope built with a Gatan 3View in-chamber ultramicrotome stage with low-kV backscattered electron detectors optimized for 3View systems. The internal wall structure endothelium of SC in each test stop was initially determined, and the parts of curiosity were chosen to add small part of lumen of SC, internal wall structure endothelium of SC, as well as the root JCT. The first sample block was sectioned along the much longer axis of SC longitudinally. Some 500 EM pictures inside a field size of 204.80 61.40 m were acquired at 2.25 kV with an answer of 10 nm per pixel and 100 nm per cut. Five internal wall structure endothelial cells had been captured out of this data arranged. However, because of the great cell size, the limited field size could just catch one endothelial cell (SC04), as the other four cells were out of field partially. To make sure catch of the entire amount of SC cells while preserving very similar field quality and size, cross areas along the shorter axis of SC had been cut in the next sample stop. Each image attained from this stop demonstrated a transverse watch from the cell. Some 1001 EM pictures within a field size of 53.30 31.98 m.


Raw NGS sequencing data analyzed with a custom analysis pipeline, available from the docker hub repository at hub.docker.com under kamhonhoi/iganalysis. Principal Component Analysis performed using the ‘princomp’ function and Repertoire Similarity Index, implemented using the ‘sdists’ function in the package ‘cba’ in R version 3.5.0.

Schroeder, H. W. Jr. & Cavacini, L. Structure and function of immunoglobulins. J. Allergiya Klinikası. İmmunol. 125, S41–S52 (2010).

Cobb, R. M., Oestreich, K. J., Osipovich, O. A. & Oltz, E. M. Accessibility control of V(D)J recombination. Adv. İmmunol. 91, 45–109 (2006).

Bassing, C. H., Swat, W. & Alt, F. W. The mechanism and regulation of chromosomal V(D)J recombination. Hüceyrə 109(Suppl), S45–S55 (2002).

Rajewsky, K. Clonal selection and learning in the antibody system. Təbiət 381, 751–758 (1996).

Nemazee, D. Mechanisms of central tolerance for B cells. Nat. Rev. İmmunol. 17, 281–294 (2017).

Zemlin, M. et al. Expressed murine and human CDR-H3 intervals of equal length exhibit distinct repertoires that differ in their amino acid composition and predicted range of structures. J. Mol. Biol. 334, 733–749 (2003).

Schroeder, H. W. Jr. Similarity and divergence in the development and expression of the mouse and human antibody repertoires. Dev. Komp. İmmunol. 30, 119–135 (2006).

Bagnara, D. et al. A reassessment of IgM memory subsets in humans. J. İmmunol. 195, 3716–3724 (2015).

Wardemann, H. et al. Predominant autoantibody production by early human B cell precursors. Elm 301, 1374–1377 (2003).

Wu, Y. C. et al. High-throughput immunoglobulin repertoire analysis distinguishes between human IgM memory and switched memory B-cell populations. qan 116, 1070–1078 (2010).

Roskin, K. M. et al. IgH sequences in common variable immune deficiency reveal altered B cell development and selection. Sci. Tərcümə. Med. 7, 302ra135 (2015).

Doorenspleet, M. E. et al. Rheumatoid arthritis synovial tissue harbours dominant B-cell and plasma-cell clones associated with autoreactivity. Ann. Reum. Dis. 73, 756–762 (2014).

Bashford-Rogers, R. J. M., Smith, K. G. C. & Thomas, D. C. Antibody repertoire analysis in polygenic autoimmune diseases. İmmunologiya 155, 3–17 (2018).

DeKosky, B. J. et al. Large-scale sequence and structural comparisons of human naive and antigen-experienced antibody repertoires. Proc. Natl akad. Sci. ABŞ 113, E2636–E2645 (2016).

Ivanov, I. I. et al. Development of the expressed Ig CDR-H3 repertoire is marked by focusing of constraints in length, amino acid use, and charge that are first established in early B cell progenitors. J. İmmunol. 174, 7773–7780 (2005).

Larimore, K., McCormick, M. W., Robins, H. S. & Greenberg, P. D. Shaping of human germline IgH repertoires revealed by deep sequencing. J. İmmunol. 189, 3221–3230 (2012).

Elhanati, Y. et al. Inferring processes underlying B-cell repertoire diversity. Filos. Trans. R. Soc. London. B Biol. Sci. 370, 20140243, https://doi.org/10.1098/rstb.2014.0243 (2015).

Miqueu, P. et al. Statistical analysis of CDR3 length distributions for the assessment of T and B cell repertoire biases. Mol. İmmunol. 44, 1057–1064 (2007).

Marcou, Q., Mora, T. & Walczak, A. M. High-throughput immune repertoire analysis with IGoR. Nat. Kommun. 9, 561 (2018).

Briney, B., Inderbitzin, A., Joyce, C. & Burton, D. R. Commonality despite exceptional diversity in the baseline human antibody repertoire. Təbiət 566, 393–397 (2019).

Goldstein, L. D. et al. Massively parallel single-cell B-cell receptor sequencing enables rapid discovery of diverse antigen-reactive antibodies. Kommun. Biol. 2, 304 (2019).

Laserson, U. et al. High-resolution antibody dynamics of vaccine-induced immune responses. Proc. Natl akad. Sci. ABŞ 111, 4928–4933 (2014).

DeKosky, B. J. et al. In-depth determination and analysis of the human paired heavy- and light-chain antibody repertoire. Nat. Med. 21, 86–91 (2015).

Busse, C. Dynamics of the human antibody repertoire after influenza vaccination. NCBI BioProject Database, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA349143 (2016).

DeWitt, W. S. et al. A public database of memory and naive B-cell receptor sequences. PLoS BİR 11, e0160853 (2016).

Lefranc, M. P. IMGT, the international ImMunoGeneTics database: a high-quality information system for comparative immunogenetics and immunology. Dev. Komp. İmmunol. 26, 697–705 (2002).

Greiff, V. et al. Systems analysis reveals high genetic and antigen-driven predetermination of antibody repertoires throughout B cell development. Cell Rep. 19, 1467–1478 (2017).

Matsutani, T. et al. Comparison of CDR3 length among thymocyte subpopulations: impacts of MHC and BV segment on the CDR3 shortening. Mol. İmmunol. 44, 2378–2387 (2007).

Miho, E., Roskar, R., Greiff, V. & Reddy, S. T. Large-scale network analysis reveals the sequence space architecture of antibody repertoires. Nat. Kommun. 10, 1321 (2019).

Boyd, S. D. et al. Individual variation in the germline Ig gene repertoire inferred from variable region gene rearrangements. J. İmmunol. 184, 6986–6992 (2010).

Kidd, M. J. et al. The inference of phased haplotypes for the immunoglobulin H chain V region gene loci by analysis of VDJ gene rearrangements. J. İmmunol. 188, 1333–1340 (2012).

Gidoni, M. et al. Mosaic deletion patterns of the human antibody heavy chain gene locus shown by Bayesian haplotyping. Nat. Kommun. 10, 628 (2019).

Shirai, H., Kidera, A. & Nakamura, H. H3-rules: identification of CDR-H3 structures in antibodies. FEBS Lett. 455, 188–197 (1999).

North, B., Lehmann, A. & Dunbrack, R. L. Jr. A new clustering of antibody CDR loop conformations. J. Mol. Biol. 406, 228–256 (2011).

Weitzner, B. D., Dunbrack, R. L. Jr. & Gray, J. J. The origin of CDR H3 structural diversity. Struktur 23, 302–311 (2015).

Vander Heiden, J. A. et al. Dysregulation of B cell repertoire formation in Myasthenia Gravis patients revealed through deep sequencing. J. İmmunol. 198, 1460–1473 (2017).

Jain, T. et al. Biophysical properties of the clinical-stage antibody landscape. Proc. Natl akad. Sci. ABŞ 114, 944–949 (2017).

Collis, A. V., Brouwer, A. P. & Martin, A. C. Analysis of the antigen combining site: correlations between length and sequence composition of the hypervariable loops and the nature of the antigen. J. Mol. Biol. 325, 337–354 (2003).

Breden, F. et al. Comparison of antibody repertoires produced by HIV-1 infection, other chronic and acute infections, and systemic autoimmune disease. PLoS BİR 6, e16857 (2011).

Magoc, T. & Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatika 27, 2957–2963 (2011).

Chen, Y. et al. Barcoded sequencing workflow for high throughput digitization of hybridoma antibody variable domain sequences. J. İmmunol. Metodlar 455, 88–94 (2018).

Ye, J., Ma, N., Madden, T. L. & Ostell, J. M. IgBLAST: an immunoglobulin variable domain sequence analysis tool. Nuklein turşuları Res. 41, W34–W40 (2013).

Sankar, K., Hoi, K. H., Jr. & Hotzel, I. Dynamics of heavy chain junctional length biases in antibody repertoires. Dryad Database, https://doi.org/10.5061/dryad.cjsxksn5062x (2020).


Giriş

In mouse and man, B cells are continuously generated from B cell progenitors over lifetime, with the fetal liver and, from around birth on, the bone marrow (BM) as the main sites where this process takes place. The immature B cells generated in the BM emigrate into the peripheral immune system and give rise to a heterogeneous population of peripheral B cells including naive, memory and plasma cells 1. In terms of their anatomical location and surface markers, the B cell population in the periphery consists of recirculating IgM low IgD high CD21 int CD23 high cells located in follicles in spleen and lymph nodes, and IgM high IgD low CD21 high CD23 low non-recirculating cells enriched mainly in the marginal zone (MZ) of the spleen 2,3. Follicular (FO) B cells in the spleen account for 80–90% and MZ B cells for 5–10% of the splenic B cells in an adult mouse 4. Another B cell subset, consisting of the so-called B-1 cells, has self-renewing capacity and predominates in the peritoneal and pleural cavities 5. Recent data on the function of MZ B cells 6,7,8 and B-1 cells 9,10 suggest that these cells provide a first line of defense against antigens in the blood, and in the peritoneal and pleural cavities, respectively. FO B cells are involved in T cell–dependent antibody responses, in which memory and plasma cells are generated 7.

About 1–2 × 10 7 immature B cells are generated daily in the adult murine BM 11. Of these, only 3% enter the pool of mature B cells of the various subsets 12. Peripheral B cell pools represent dynamic, yet stable compartments where the input contributed by BM immigrants and antigen driven cell proliferation is balanced by apoptosis and terminal differentiation 13.

For an understanding of this homeostatic control it is of critical importance to determine the life spans of B cells of various subsets under physiological conditions. It is therefore not surprising that B cell life spans have been the subject of many investigations in the past. However, while it is generally agreed that newly generated immature B cells in adult mice have life spans of ∼3-4 d 12,14, the life spans of mature B cells are still controversial. Experiments based on (a) adoptive transfer of LPS-reactive B cells into LPS-nonreactive recipient mice 15 (b) the ablation of cycling B cell precursors with cytotoxic drugs which selectively kill cycling cells 16,17 and (c) induction of BM aplasia using a radioactive strontium isotope, 89 S 18 support the hypothesis that most mature B cells have a life span of just a few days 13. In contrast, experiments in which B cell development was blocked by anti–IL-7 19, or anti–IL-7 receptor antibodies 20 or cells were labeled by [ 3 H]thymidine 21,22,23 or bromo deoxyuridine (BrdU) in vivo 24,25,26 lead to the conclusion that the majority of splenic B cells can persist for several weeks or months.

To further clarify this matter and to extend the analysis to the various subsets of mature B cells, we have now generated a transgenic mouse strain in which B cell development can be blocked permanently at any stage of development under quasi-physiological conditions. To achieve this goal we made use of the fact that both B and T cell development critically depend on the somatic assembly of Ig or T cell receptor variable region gene segments, called V, D, and J, by a process known as V(D)J recombination 27. V(D)J recombination is mediated by the products of the recombination-activating genes RAG-1RAG-2 28. Consequently, in RAG-1– və ya RAG-2–deficient mice B and T cell development are blocked at an early progenitor stage 29,30. Induced inactivation of RAG-1 və ya RAG-2 in B and T cell progenitors in the BM can thus be expected to lead to a block in B and T cell generation. Using conditional gene targeting 31, we established a transgenic mouse strain in which RAG-2 can be inducibly and efficiently inactivated whenever desired. In the present paper, we describe this experimental system and use it to study the maintenance and differentiation of the various peripheral B cell subsets in intact, healthy animals, in the absence of B cell influx from the BM, i.e., a situation in which B cell life spans should be maximized.


Materials And Methods

Isolation of Thymocytes.

Methods for maintenance of SCID-hu mice and harvest of thymocytes from SCID-hu Thy/Liv organs were identical to those previously published 17. In some cases, SCID-hu Thy/Liv organs were harvested and placed in RPMI 1640 media (Life Technologies) supplemented with 10% FCS (Summit Biotechnology) and transported overnight at 4°C before harvest of thymocytes. After isolation, thymocytes were resuspended in PBS supplemented with 2% FCS and kept on ice before staining with mAbs for flow cytometric analysis or cell sorting. All procedures and practices were approved by the University of California, San Francisco Committee on Human Research (CHR) or Committee on Animal Research.

Isolation of PBMCs.

Whole blood samples from human subjects were collected by phlebotomy into EDTA collection tubes (Becton Dickinson). PBMCs were isolated from whole blood by density–gradient centrifugation (Life Technologies). PBMCs were washed twice with PBS before resuspension in PBS supplemented with 2% FCS before staining with mAbs for flow cytometry or cell sorting.

Stimulation of Cord Blood Cells In Vitro.

Human umbilical cord blood cells were obtained (with CHR approval) from healthy delivery specimens and placed in heparinized collection tubes (Becton Dickinson) under sterile conditions. Cord blood mononuclear cells (CBMCs) were isolated as described above for whole blood specimens and resuspended at a concentration of 2 × 10 6 cells/ml in RPMI 1640 supplemented with 10% human AB serum (Ultraserum Gemini Bio-Products). CBMCs were then cultured (at 37°C in 5% CO2) for 48, 72, or 96 h or 9 d (time points encompassed in two different experiments) and stimulated with 5 μg/ml of PHA (Sigma Chemical Co.) and 10 U/ml purified IL-2 (Boehringer Mannheim). The supplemented medium was changed every 3 d. Cell culture controls did not receive PHA or IL-2 stimulation but were cultured for 72 h in the same medium. Aliquots of the cell cultures at different time points were analyzed by flow cytometry for the expression of the cell surface markers CD45RA and CD62L.

Immunophenotypic Analysis and Cell Sorting by Flow Cytometry.

PBMCs, thymocytes from SCID-hu mice, or CBMCs were stained with fluorescent-conjugated mABs specific for cell surface markers at a concentration of 10 7 cells/ml at 4°C for 30 min. After staining, cells were washed with PBS supplemented with 2% FCS and sorted on either a FACStar™ or FACS Vantage™ cell sorter (both from Becton Dickinson). The cells were stained with one of the following antibody combinations: (a) anti-CD8–FITC and anti-CD4–PE (Becton Dickinson) (b) anti-CD45RA–FITC or anti-CD45RO–FITC (Immunotech), anti-CD62L–PE (Becton Dickinson), and anti-CD4–ECD (Coulter Immunology) (c) anti-CD62L–FITC, anti-CD45RA–PE (PharMingen), and anti-CD4–tricolor or anti-CD4–allophycocyanin (Caltag Labs., Inc.). Sort purities were checked after each sort and were ≥97%. For analysis of cord blood CD45RA and CD62L expression, CBMCs were stained with anti-CD45RA–FITC (Immunotech) and anti-62L–PE (Becton Dickinson) and analyzed using a FACScan™ cytometer and CELLQuest™ software (both from Becton Dickinson).

Detection of TCR-β Rearrangement Deletion Circles.

Total DNA from distinct cell populations was extracted and purified via a standard protocol 18 before spectrophotometric quantitation at 260 and 280 nm. The freshly isolated DNA was stored at 4°C for further processing. Thermal cycling was performed for 30 cycles (1 min at 94°C, 1.5 min at 65°C, and 1.5 min at 72°C) for each round of a seminested PCR protocol designed to detect VβDβ-specific deletion circles (DCs) generated by TCR-β recombination. All first and second round primers were generated to fully hybridize with noncoding regions of the TCR-β locus 19 located next to the recombination signal sequences (RSS available from EMBL/GenBank/DDBJ under accession numbers U66059, U66060, and U66061 see Table). Four PCR replicates were performed on each total DNA serial dilution to ensure a precise readout for each experiment. Concentrations of total DNA were adjusted so that a constant volume of 3 μl was added to each 50-μl PCR reaction (200 μM dNTPs, 1× PCR buffer [Boehringer Mannheim], 100 ng of each primer, and 2 U of Taq polymerase [Boehringer Mannheim]). From the first PCR amplification, 3 μl of the first PCR product was used as template for the second (seminested) PCR reaction (under the same conditions) using the “Circle” primer and the DC-Dβ1 primer.

Quantitative Analysis of Endpoint Dilutions.

Second round PCR products were visualized with ethidium bromide on 1.25% agarose gels and digitally photographed. Individual amplifications were scored as positive or negative by two observers. The highest dilution returning a positive amplification was taken as the endpoint for each dilution series. Dilution series with more than two “skipped” wells (i.e, a failed amplification followed by a successful amplification at higher dilution) were omitted from the analysis. The abundance of DCs was estimated by the Reed-Muench method 20,21. This method uses information from replicate dilution series to estimate an endpoint (measured in terms of nanograms of input DNA) in which 50% of samples were positive for DCs (the 50% DC endpoint). The DC frequency (DCF) was arbitrarily defined as the reciprocal of the 50% DC endpoint × 100. Alternatively, the seminested PCR data were analyzed by a maximum likelihood estimated method of dilution endpoint with a parametric method 22. Unlike the Reed-Muench method, this method returns an estimate of goodness of fit of the data to the estimated endpoint. Endpoints estimated by the two methods were highly correlated (r 2 = 0.929), and the choice of method did not alter the conclusions drawn from the data. The degree of inter- and intraassay variation was assessed by performing two independent experiments on two different samples from the same individuals (n = 3) and ranged on the order of two- to threefold (data not shown).


Metodlar

RAG and HMGB1 protein purification

Truncated and full-length forms of RAG1 (residues 384–1040 and 1–1040, respectively) and RAG2 (residues 1–387 and 1–517, respectively) containing an amino-terminal maltose binding protein fusion partner (cMR1, FLMR1, cMR2, and FLMR2, respectively) were coexpressed in 293 cells and purified by amylose affinity chromatography according to published procedures [30]. Full-length, truncated, or mutant forms of amino-terminal polyhistidine-tagged HMGB1 were expressed in E. coli and purified as described elsewhere [26].

DNA substrates

Oligonucleotide substrates containing a 12-RSS or 23-RSS cRSS labelled at the 5' end of the top strand were prepared as described elsewhere [24, 30]. A substrate containing the bps6197 sequence was similarly prepared from the oligonucleotide 5'-TCCCCGAAAAGTGCCACCTGACG TCTAAGAAACC ATTATTATCATGACATTAACC TATAAA-3' and its complement (positions equivalent to the 23-RSS heptamer and nonamer motifs are underlined). Derivatives of this substrate containing mutations at positions indicated in the text were also prepared. Unlabeled DNA substrates containing consensus 12-RSS, 23-RSS, Hox11 or non-specific DNA sequences (DAR81/82) were prepared from oligonucleotides described previously [11, 24].

The plasmid V(D)J recombination substrates pGG49, its derivatives containing Ttg-1 or Hox11 cRSS sequences, and pJH299 have been described elsewhere [4, 10]. Derivatives of pGG49 lacking the 12-RSS or 23-RSS were generated by Sal mən və ya BamH I digestion, respectively. Variants of pGG49 and pJH299 containing the wild-type or mutant bps6197 sequences discussed in the text were generated according to procedures described in Additional File 3: Supplementary Materials and Methods. Long DNA fragments (

650 bp) radiolabeled at the 5' end of the top strand containing the RSS, cRSS, and/or wild-type or mutant bps6197 sequences present in pGG49 and its derivatives were generated by PCR using radiolabeled primer 6000F (5'-TATTGTCCTCATGAGCGGATAC-3') and unlabeled primer 6624R (5'-GAACGGTGGTATATCCAGTG-3'). PCR samples (100 μl final volume) containing plasmid template DNA (70 ng) and primers (20 pmol each) were subjected to initial denaturation at 95°C for 4 min, followed by 30 cycles of amplification (95°C for 45 sec, 56°C for 30 sec, and 72°C for 60 sec) and a final extension (72°C for 4 min). PCR products were isolated using a QIAquick PCR purification kit (Qiagen), eluted in 50 μl buffer EB (10 mM Tris, pH 8.0), fractionated on a vertical agarose gel (1.4%) at 150V for 1.5 h, and gel-isolated DNA purified using a QIAquick Gel Extraction Kit (Qiagen).

In vitro RAG cleavage and binding assays

RAG-mediated cleavage of oligonucleotide substrates, PCR-generated long DNA fragments, or plasmid DNA was analyzed using an in vitro cleavage assay described previously [24]. Unless otherwise noted, basic in vitro cleavage reactions (10 μL) contained cMR1/cMR2 (


Videoya baxın: Immunology - Antibody Somatic VDJ Recombination I (Iyul 2022).


Şərhlər:

  1. Taurisar

    Nömrə keçmir!

  2. Waescburne

    Bu variant mənə yaxınlaşmır. Başqa kim, nə sövq edə bilər?

  3. Hennessy

    I congratulate, remarkable idea and it is duly

  4. Tat

    Üzr istəyirəm, amma mənim fikrimcə səhv edirsən. Mən mövqeyimizi müdafiə edə bilərəm.

  5. Karlyn

    As much as necessary.

  6. Kester

    Small zhzhot)))) yyyyyyyyyy



Mesaj yazmaq